Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2012 Mar 21;13(8):900–914. doi: 10.1111/j.1364-3703.2012.00799.x

The NADPH oxidase‐mediated production of hydrogen peroxide (H2O2) and resistance to oxidative stress in the necrotrophic pathogen Alternaria alternata of citrus

SIWY LING YANG 1, KUANG‐REN CHUNG 1,✉
PMCID: PMC6638813  PMID: 22435666

SUMMARY

It has become increasingly apparent that the production of reactive oxygen species (ROS) by the NADPH oxidase (Nox) complex is vital for cellular differentiation and signalling in fungi. We cloned and characterized an AaNoxA gene of the necrotrophic fungus Alternaria alternata, which encodes a polypeptide analogous to mammalian gp91phox and fungal Noxs implicated in the generation of ROS. Genetic analysis confirmed that AaNoxA is responsible for the production of ROS. Moreover, deletion of AaNoxA in A. alternata resulted in an elevated hypersensitivity to hydrogen peroxide (H2O2), menadione, potassium superoxide (KO2), diamide and many ROS‐generating compounds. The results implicate the involvement of AaNoxA in cellular resistance to ROS stress. The impaired phenotypes strongly resemble those previously seen for the ap1 null mutant defective in a YAP1‐like transcriptional regulator and for the hog1 mutant defective in a HOG1‐like mitogen‐activated protein (MAP) kinase. The noxA null mutant was also hypersensitive to Nox inhibitors, nitric oxide (NO·) donors and NO· synthase inhibitors, implying a role of AaNoxA in the NO· signalling pathway. Expression of AaNoxA was activated by H2O2, menadione, KO2, NO· donors and l‐arginine (a substrate for NO· synthase). AaNoxA may be able to sense and respond to both ROS and nitric oxide. Moreover, AaNoxA is required for normal conidiation and full fungal virulence. AaNoxA promoted the expression of the AaAP1 and AaHOG1 genes in A. alternata. Inactivation of AaNoxA greatly reduced the transcriptional activation of AaAP1 in response to ROS stress. Thus, we conclude that the regulatory functions of AaNoxA conferring ROS resistance are modulated partially through the activation of the YAP1‐ and HOG1 MAP kinase‐mediated signalling pathways.

INTRODUCTION

Alternaria alternata is a common necrotrophic fungus. Many of these fungi produce unique host‐selective toxins (HSTs) and cause disease on different host plants (Kohmoto et al., 1991). The tangerine pathotype of A. alternata causes brown spots on citrus leaves and fruit, primarily as a result of the production of a host‐selective ACT toxin with a 9,10‐epoxy‐8‐hydroxy‐9‐methyl‐decatrienoic acid chromophore (Kohmoto et al., 1993). ACT toxin is extremely toxic, causing rapid electrolyte leakage from susceptible citrus cells. In addition to HSTs, recent studies have demonstrated that the mitigation of reactive oxygen species (ROS) produced by the host plants, operated by the fungal redox‐responsive transcriptional regulator AaAP1, is also essential for A. alternata pathogenicity in citrus (2009, 2011; Yang et al., 2009).

A synergistic interaction between AaAP1‐controlled gene expression and AaFUS3 mitogen‐activated protein (MAP) kinase‐mediated signalling pathways for multidrug resistance has also been discovered in A. alternata (Lin et al., 2010). AaAP1 has been shown to suppress AaFUS3 phosphorylation. AaFUS3 and AaSLT2 MAP kinases are not involved in cellular resistance to oxidative stress, even though both AaFUS3 and AaSLT2 null mutants are defective in pathogenicity (Lin et al., 2010; Yago et al., 2011). A HOG1 MAP kinase homologue, AaHOG1, has been shown to be necessary for ROS resistance and pathogenicity. In contrast, a ‘two‐component’ histidine kinase (AaHSK1) has no effect on ROS resistance or pathogenicity (Lin and Chung, 2010). Recent studies have discovered serendipitously that fungal strains disrupted at any of the AaAP1, AaHSK1, AaFUS3, AaHOG1 and AaSLT2 genes are hypersensitive to 2‐chloro‐5‐hydroxypyridine (CHP) or 2,3,5‐triiodobenzoic acid (TIBA). Moreover, two genes encoding putative major facilitator superfamily (MFS) transporters have been identified to be co‐ordinately regulated by these signalling regulators. Pyridine, occurring ubiquitously in natural compounds, is a heteroaromatic compound composed of five carbons and one nitrogen atom. Pyridine has been shown to accelerate the production of superoxide and hydroxyl radicals in the presence of Cu2+ and hydrogen peroxide (H2O2) (Nerud et al., 2001; Watanabe et al., 1998). In biological systems, pyridine and its derivatives have important functions—as electron carriers, such as NADP/NADPH and flavin nucleotides (FAD/FADH), as constituents of RNA and DNA, and as energy storage molecules, such as ATP and GTP. TIBA is a plant growth regulator that is often used as a herbicide or as an inhibitor of indole‐3‐acetic acid (IAA) transportation (Lahey et al., 2004; Tsurumi and Ohwaki, 1978).

The production of ROS, including superoxide (O2 ·¯), H2O2 and hydroxyl radicals (OH·), is an inevitable event in all organisms. ROS can serve diverse roles in cellular defence and in the signalling transduction pathways controlling cell differentiation or developmental modifications. The NADPH oxidase (Nox) complex transfers electrons from NADPH to oxygen molecules, leading to the production of superoxide, which is further metabolized to H2O2 by superoxide dismutase (SOD). H2O2 is less toxic, but stable, and able to pass freely through membranes (Branco et al., 2004), often serving as a signalling stimulus. In humans, the phagocytic Nox complex, involved in the production of superoxide and immunity, contains two major catalytic components gp91phox (also known as Nox2) and gp22phox, and multiple regulatory subunits Rac (a small GTPase), p67phox, p47phox and p40phox (Diekman et al., 1994). Plants possess oxidases analogous to gp91phox, which are vital for ROS generation in response to pathogen invasion (Torres et al., 2002).

Some fungi also harbour Nox homologues, NoxA (Nox1), NoxB (Nox 2) and NoxC, which have been documented by genetic analysis to be required for cell differentiation, pathogenicity or cellulose degradation in diverse fungal species (Aguirre et al., 2005; Brun et al., 2009; Cano‐Domínguez et al., 2008; Egan et al., 2007; Giesbert et al., 2008; Lara‐Ortiz et al., 2003; Malagnac et al., 2004; Scott and Eaton, 2008; Segmüller et al., 2008; Semighini and Harris, 2008). Both NoxA and NoxB are analogous to the mammalian gp91phox. The function of NoxA/B is tightly regulated by the regulatory subunit, NoxR (p67phox homologue), and by the small GTPase (Rac homologue). The production of ROS mediated by the Nox complex has recently been shown to prevent excessive proliferation and hyphal branching of the fungal endophyte Epichloë festucae within its host plant (ryegrass, Lolium perenne), thus allowing the fungus to maintain mutually beneficial interactions (Scott et al., 2007; Takemoto et al., 2007). Functional disruption of a gene encoding the component of the Nox complex in E. festucae generated fungal strains defective in H2O2 generation, but highly pathogenic to the host plant (Takemoto et al., 2006; Tanaka et al., 2006). Yeast two‐hybrid and pull‐down analyses further indicated that Rac interacts with NoxR and both are essential for the functional activation of NoxA in E. festucae (2006, 2008).

The Nox complex is widely distributed in animals, plants and fungi, but appears to be completely absent in prokaryotes and most unicellular eukaryotes. No Nox gene homologues have been identified in Saccharomyces cerevisiae, Schizosaccharomyces pombe or other species belonging to Saccharomycota, as well as Ustilago maydis, Rhizopus oryzae or Cryptococcus neoformans (Takemoto et al., 2007). Aspergillus species have only one Nox homologue, whereas other fungi may have at least two Nox homologues (Aguirre et al., 2005; Lara‐Ortiz et al., 2003; Malagnac et al., 2004). In general, NoxA/B are thought to have evolved in fungi for the formation of fruiting body or multicellular structures, or for ascospore germination (Takemoto et al., 2007). The Nox complex may have very different roles in asexual fungi, such as A. alternata, which does not have known sexual stages. The maintenance of ROS homeostasis via the regulation of ROS formation by the Nox complex is critical for fungal cellular differentiation, development and pathogenesis. Previous studies with A. alternata have uncovered that AaAP1‐ and AaHOG1 MAP kinase‐activated gene expression is essential for ROS resistance, and this ability is absolutely required for fungal pathogenicity on citrus (Lin and Chung, 2010; Lin et al., 2009; Yang et al., 2009). In order to further understand the mechanisms underlying oxidative stress resistance, we isolated and characterized the AaNoxA gene that encodes an orthologue of gp91phox in the human phagocytic oxidase and fungal NoxA, as well as the developmental and physiological functions of this gene in A. alternata. We provided genetic evidence to indicate that the expression of the AaAP1 and AaHOG1 genes is regulated by AaNoxA in response to ROS and chemical stimuli. We also showed that AaNoxA is involved in sensing and responding to both ROS and NO· in A. alternata.

RESULTS

Cloning of fungal NoxA gene homologue from A. alternata

A 668‐kb fragment was amplified from genomic DNA of A. alternata with two degenerate primers NOXf1 and NOXr1. Sequence analysis of the amplicon revealed a strong amino acid similarity to fungal Noxs. The cloned gene was designated as A. alternata NoxA. The 5′ and 3′ flanking sequences were obtained from a genomic library. Several overlapping cDNA fragments were amplified and determined by sequencing. Analysis of the combined genomic and cDNA sequences identified an 1810‐bp open reading frame (ORF) and the presence of three small introns (50, 52 and 55 bp). All three introns had typical 5′‐xx/GT and xx/AG‐3′ splicing junctions commonly found in the genes of filamentous fungi. The AaNoxA gene product has 550 amino acids, displaying 72%–93% identity and 84%–96% similarity to a number of Noxs (NOXA or NOX1) or hypothetical proteins of fungi (Fig. S1, see Supporting Information). Analysis of the predicted translational product of the A. alternata NoxA gene identified a ferredoxin synthase‐type FAD‐binding domain, a NADPH‐binding domain and six transmembrane domains, commonly found in the NoxA‐like family.

Inactivation of the A. alternata NoxA gene

Two overlapping DNA fragments, 5′AaNoxA::PHY and 3′AaNoxA::YGT, were generated (Fig. S2A, see Supporting Information) and transformed directly into protoplasts of the wild‐type EV‐MIL31 strain. Of five transformants recovered from a medium containing hygromycin, two (DN2 and DN6) exerted a reduced radial growth of 15% and were selected for further analyses. Polymerase chain reaction (PCR) diagnosis with the primers NoxA‐atg and hyg3 amplified an expected 1.7‐kb fragment from genomic DNA of the DN2 and DN6 strains; an expected 2.5‐kb fragment was also obtained by PCR with the primers hyg4 and NoxA‐taa (Fig. S2B). No fragments were amplified from genomic DNA of the wild‐type with different primer pairs. Northern blot hybridization of fungal RNA to an AaNoxA probe identified a 1.8‐kb transcript from the wild‐type, but not from the DN2 and DN6 strains (Fig. S2C), confirming successful inactivation of the AaNoxA gene in A. alternata.

A. alternata NoxA is involved in resistance to oxidative and nitrosative stress

Compared with the wild‐type, the A. alternata noxA null mutants were hypersensitive to H2O2, tert‐butyl‐hydroxyperoxide (t‐BHP), cumyl hydrogen peroxide and the superoxide‐generating agents menadione (MND), potassium superoxide (KO2) and diamide (Fig. 1A). The A. alternata noxA null mutants also exhibited an increased sensitivity to the singlet oxygen‐generating compounds (haematoporphyrin and rose bengal), TIBA, CHP and SDS (Fig. 1B). All defect phenotypes strongly resembled those observed in the fungal strain impaired at AaAP1, a functional homologue of the yeast redox‐responsive transcriptional regulator. Mutational inactivation of AaNoxA in an A. alternata strain resulted in less severe hypersensitivity to these compounds compared with the sensitivity seen in mutants defective at AaAP1. For example, H2O2 at 1.5 mm had no inhibitory effect on the fungal mutant impaired at AaNoxA, but completely blocked growth of the fungal mutant defect at AaAP1. Similarly, the A. alternata ap1 mutant was highly sensitive to t‐BHP, MND, KO2, cumyl hydrogen peroxide, rose bengal and diethyl maleate, whereas the AaNoxA mutant was moderately sensitive. The A. alternata noxA mutant was more sensitive than the ap1 mutant to diamide and SDS. Expression of a functional copy of AaNoxA, under the control of its own promoter, in the DN2 null strain resulted in fungal strains (NCp1, NCp7 and NCp16) that exhibited resistance to all test compounds (Fig. S3, see Supporting Information). This confirmed further that the AaNoxA disruption was indeed contributory to the deformed phenotypes.

Figure 1.

Figure 1

Open in a new tab

Hypersensitivity of the wild‐type (WT), noxA mutant and ap1 mutant strains of Alternaria alternata. Fungal strains were grown on potato dextrose agar (PDA) or PDA amended with test compounds as indicated for 4–7 days. Radial growth was measured. Sensitivity (percentage growth reduction) was calculated as a cumulative percentage of the growth of the wild‐type and the deletion mutants grown on the same plate. APC, apocynin; Arg, l‐arginine; CHP, 2‐chloro‐5‐hydroxypyridine; DEM, diethyl maleate; DPI, diphenylene iodonium; HDA, hydroxylamine HCl; HP, haematoporphyrin; MND, menadione; N‐Arg, nitro‐arginine methyl ester; RB, rose bengal; t‐BHP, tert‐butyl‐hydroxyperoxide; TIBA, 2,3,5‐triiodobenzoic acid; SDS, sodium dodecylsulphate; SNP, sodium nitroprusside. The data presented are the mean and standard deviation of two independent experiments with at least three replicates.

Compared with the ap1 mutant, the A. alternata noxA mutant displayed much greater sensitivity to diamide, a compound that is well known to stimulate the formation of superoxide anion (O2 · ‐) and nitric oxide (NO·). We tested whether the A. alternata noxA and ap1 mutants were sensitive to diphenylene iodonium (DPI), apocynin (APC), sodium nitroprusside (SNP), hydroxylamine HCl (HDA), l‐arginine (an NO· synthase substrate) and nitro‐arginine methyl ester (nitro‐Arg). Both DPI and APC are Nox inhibitors. SNP and HDA are capable of producing NO·, whereas nitro‐Arg is a NO· synthase inhibitor. The A. alternata noxA mutant was moderately sensitive to DPI, APC, SNP, HDA, l‐arginine and nitro‐Arg (Fig. 1C). The A. alternata ap1 mutant was also moderately sensitive to DPI, APC and SNP, but completely insensitive to HDA, l‐arginine and nitro‐Arg. The noxA mutant was apparently more sensitive than the ap1 mutant to DPI.

Expression of AaNoxA in response to oxidative and nitrosative stress

Northern blot analyses were carried out to assess whether the expression of the AaNoxA gene responded to H2O2 and other compounds related to oxidative stress in axenic cultures. Accumulation of the 1.8‐kb AaNoxA gene transcript was barely detectable when the fungus was grown on potato dextrose agar (PDA), but was elevated in the presence of H2O2, KO2, MND, t‐BHP and haematoporphyrin (Fig. 2A). Moreover, expression of the AaNoxA gene was up‐regulated in the wild‐type strain responding to l‐arginine, SNP, HDA, DPI and APC (Fig. 2B). In contrast, the expression of AaNoxA was down‐regulated by nitro‐Arg (an NO· synthase inhibitor).

Figure 2.

Figure 2

Open in a new tab

(A) RNA gel blotting. The wild‐type strain of Alternaria alternata grown on cellophane overlaid onto potato dextrose agar (PDA) for 2 days was shifted to PDA containing H2O2 (3 mm), KO2 (0.5 mg/mL), tert‐butyl‐hydroxyperoxide (t‐BHP, 0.05%), menadione (MND, 1 mm) or haematoporphyrin (HP, 50 µm) and incubated for an additional 24 h. The mock treatment contained RNA obtained from fungal mycelia shifted to the nonamended PDA. Fungal RNA was purified, electrophoresed in a formaldehyde‐containing denaturing gel, blotted and washed at high stringency after hybridization with an AaNoxA probe. (B) Image of RNA gel blotting. Fungal strains were shifted to PDA containing apocynin (APC, 200 µm), diphenylene iodonium (DPI, 20 µm), l‐arginine (Arg, 100 mm), hydroxylamine HCl (HDA, 2 mm), sodium nitroprusside (SNP, 0.5 mm) or nitro‐arginine methyl ester (N‐Arg, 10 mm) and incubated for an additional 24 h. The intensity of the hybridizing bands was quantified using an ImageJ program (http://rsb.info.nih.gov/ij/).

AaNoxA is required for conidiation and fungal virulence

Although the A. alternata noxA null mutants displayed a slight growth reduction, both wild‐type and mutant produced branching hyphae in a similar manner. Mutational inactivation of AaNoxA in A. alternata had little or no effect on conidial germination; more than 85% of conidia prepared from all test strains germinated as assayed on glass slides. The A. alternata noxA null mutants showed reduced conidiation and pigmentation compared with the wild‐type in axenic cultures (Fig. 3A,B). Introduction and expression of a functional copy of AaNoxA in a null mutant fully restored conidiation and pigmentation. Light microscopy analysis revealed that the wild‐type strain of A. alternata often formed multicellular, obpyriform conidia with both vertical and transverse septae and dark pigment on PDA. In contrast, the A. alternata noxA mutant generated less melanized conidia with less distinct septae (Fig. 3C). The complementation strain (NCp) produced dark‐coloured conidia with both vertical and transverse septae, resembling those produced by the wild‐type.

Figure 3.

Figure 3

Open in a new tab

The Alternaria alternata noxA mutants reduce pigmentation and conidiation. (A) Morphological appearance of the wild‐type (WT) and two noxA mutants (DN2, DN6) grown on potato dextrose agar (PDA). (B) Quantitative analysis of conidial formation by A. alternata strains. The genetically reverted strain (NCp1) was derived from a mutant strain expressing a functional copy of AaNoxA. (C) Images of conidia. Note that the noxA null mutants produced light‐coloured conidia with indistinct septae. Only representative replicates are shown.

Pathogenicity assays using a point inoculation method indicated that the A. alternata noxA null mutants induced significantly smaller necrotic lesions than the wild‐type on detached Minneola or calamondin leaves 3 days after inoculation (dai) (Fig. 4A). Statistical analyses using t‐tests indicated that the mean number of lesions per leaf (n= 12) induced by the wild‐type was significantly different from that induced by the A. alternata noxA mutant (P≤ 0.05) (Fig. 4B). Pathogenicity assessed further on detached Minneola leaves sprayed uniformly with conidial suspension revealed a reduction in necrotic lesions induced by the A. alternata noxA mutant relative to those induced by the wild‐type (Fig. 4C). The mean number of diseased lesions per leaf (n= 6) induced by the wild‐type was much larger than that induced by the A. alternata noxA mutant (Fig. 4D). Expression of a copy of AaNoxA in a noxA null mutant restored the ability for lesion induction. Inactivation of AaNoxA in A. alternata did not have an impact on ACT toxin production, as evidenced by thin layer chromatography analysis and a bioassay on detached calamondin leaves (Fig. S4, see Supporting Information).

Figure 4.

Figure 4

Open in a new tab

Assays for the pathogenicity of Alternaria alternata. (A) Necrotic lesions induced by wild‐type (WT) and two noxA null mutants (DN2 and DN6) on detached leaves of citrus cv. Minneola 3 days after inoculation. Conidial suspension (104 conidia/mL) was inoculated onto Minneola leaves by placing 5 µL of suspension in each of the spots. The inoculated leaves were incubated in a mist chamber for lesion development. Some representative replicates are shown. (B) Quantification of the mean size of necrotic lesions induced by the A. alternata strains on detached calamondin leaves (n= 12) 2 or 3 days after inoculation (dai). The mock controls were treated with water only. The mean values that are significantly different from those of the wild‐type, separated by Student's t‐test (P≤ 0.05), are indicated by asterisks. The experiments were repeated twice with similar results. (C) Fungal pathogenicity assayed on detached Minneola leaves uniformly sprayed with conidial suspension (104 conidia/mL) of A. alternata with the inoculated leaves incubated in a mist chamber for 3 days. (D) Quantification of diseased lesions on detached Minneola leaves (n= 6) using an ImageJ program. Fungal strains NCp1, NCp7 and NCp16, derived from the transformation of AaNOXA in the DN2 mutant, exhibit the wild‐type conidiation and pigmentation.

AaNoxA is involved in the production of ROS

Nitroblue tetrazolium (NBT) can be reduced by superoxide to form a dark blue, water‐insoluble formazan. The staining of fungal hyphae with NBT indicated that the A. alternata noxA mutant seemingly produced less superoxide anions than the wild‐type. The wild‐type mycelia were stained with NBT, forming dark blue precipitates around the colony (Fig. 5). The noxA mutant mycelia displayed less intensity, showing dense precipitates primarily along the surface of the colony. Microscopic examination revealed that blue precipitates were observed in some of the young hyphal tips of the noxA null mutant. In contrast, nearly all hyphae at the proximal ends of the wild‐type and the complementation strain were stained dark blue by NBT.

Figure 5.

Figure 5

Open in a new tab

Accumulation and detection of superoxide anions within the hyphae of the wild‐type, noxA null mutants (ΔnoxA) and the complementation strain (NCp16) of Alternaria alternata. Fungal strains were grown on potato dextrose agar (PDA) for 6 days and stained with nitroblue tetrazolium (NBT). Images of the edge of fungal colonies after staining with NBT (top panels). Microscopic images of fungal hyphal tips showing the deposition of water‐insoluble formazan (indicated by an arrow) after staining with NBT. Bar, 20 µm.

The staining of fungal hyphae with 3,3′‐diaminobenzidine (DAB) resulted in a dark brown pigmentation—indicative of the formation of H2O2—in apical tips, also showing some differences between the wild‐type and noxA null mutant (Fig. 6A). Quantitative analysis revealed a reduced accumulation of H2O2 inside the mutant cells relative to the wild‐type (Fig. 6B). Acquisition and expression of AaNoxA restored the accumulation of H2O2 to the wild‐type level. Similarly, the amount of H2O2 secreted into the medium by the A. alternata noxA null mutant was much smaller and slower than that produced by the wild‐type (Fig. 6C). The genetically reverted strain accumulated extracellular H2O2 at a rate and magnitude similar to that of the wild‐type.

Figure 6.

Figure 6

Open in a new tab

The AaNoxA homologue is required for the production of H2O2 in Alternaria alternata. (A) Accumulation and detection of H2O2 within the hyphae after staining with 3,3′‐diaminobenzidine (DAB). Bar, 20 µm. (B) Quantitative analysis and comparison of intracellular H2O2 among the wild‐type (WT), two noxA null mutants (DN2 and DN6) and two genetically complemented strains (NCp1 and NCp7) using a xylenol orange assay. Asterisks indicate the values, separated by Student's t‐test (P≤ 0.05), that are significantly different from those of the wild‐type. (C) Detection of extracellular H2O2 in axenic culture by measuring the increase in absorbance at 240 nm. Complete medium was used as the mock control. The quantity of H2O2 was calculated by referring to a standard curve that was established using authentic H2O2. Each column or point represents the mean number of H2O2 ± the standard deviation from two independent experiments with at least three replicates.

To determine the production of other ROS, fungal mycelium was stained with 2,7‐dichlorodihydrofluorescein diacetate (H2DCFDA). H2DCFDA is a fluorogenic probe commonly used to detect the cellular production of H2O2, hydroxyl radicals and nitric oxide. H2DCFDA is not fluorescent until it is converted to H2DCF when exposed to ROS. ROS production, based on fluorescent intensity, was apparently higher within incipient hyphae of the wild‐type and the complementation strains (Fig. 7). The noxA null mutants emitted much fainter fluorescence which diffused along the hyphal cytoplasm. Fungal hyphae treated with water only did not emit fluorescence (data not shown). The results confirm further that NoxA plays an important role in ROS generation.

Figure 7.

Figure 7

Open in a new tab

Detection of reactive oxygen species within Alternaria alternata hyphae staining with the oxidatively active fluorescent dye 2,7‐dichlorodihydrofluorescein diacetate (H2DCFDA, Molecular Probes). Fungal mycelium was collected from the wild‐type (WT), the noxA null mutants (DN) and the genetically complemented strains (NCp) grown on potato dextrose agar for 6 days, stained with H2DCFDA (2.5 µg/mL) dissolved in water for 15 min, and examined with a microscope equipped with a 450–490‐nm excitation filter and a 520‐nm barrier filter. Bar, 20 µm.

AaNoxA regulates a YAP1 transcription factor and a HOG1 MAP kinase

Previous studies have revealed that the A. alternata ap1 and hog1 disruption mutants are hypersensitive to H2O2, ROS‐generating compounds, TIBA and CHP. Northern blot analyses showed that the expression of the AaAP1 gene was nearly abolished in the noxA mutants (Fig. 8A). The introduction of a copy of AaNoxA into a null mutant restored AaAP1 gene expression, as exemplified in an NCp1 strain. Accumulation of the AaHOG1 transcript was undetectable in the noxA mutants, yet was restored in the NCp1 strain expressing AaNoxA (Fig. 8B). There was no difference in expression of the AaNoxA gene between the wild‐type, A. alternata ap1 mutants and the genetically reverted strain (Fig. 8C). Similar to AaAP1, AaHOG1 disruption apparently did not influence the accumulation of the AaNoxA transcript (Fig. 8D).

Figure 8.

Figure 8

Open in a new tab

Autoradiographic images of RNA gel blots. (A, B) Fungal RNA purified from the wild‐type (WT), noxA null mutants (DN2 and DN6) and genetically complemented strain (NCp1) of Alternaria alternata, electrophoresed in a formaldehyde‐containing gel, blotted and hybridized with an AaAP1 (A) or AaHOG1 (B) gene probe. (C) Fungal RNA purified from WT, two ap1 null mutants (Y1 and Y2) and a strain expressing functional AaAP1 (YCpl1) was hybridized to an AaNoxA probe. (D) Fungal RNA purified from WT and two hog1 null mutants (HG1 and HG2) was hybridized to an AaNoxA probe. Gels staining with ethidium bromide indicate relative loading of the RNA samples. The sizes of the hybridization bands are indicated in kilobase pairs (kb).

Expression of AaAP1

Expression of the AaAP1 gene was investigated further in the wild‐type and noxA mutant in response to TIBA and ROS‐generating agents (Fig. 9). Assays by Northern blotting indicated that the accumulation of the AaAP1 gene transcript was elevated in the noxA mutant in response to H2O2, KO2 and other treatments (Fig. 9A). The increased level of the AaAP1 gene transcript in the wild‐type strain was much greater than that in the noxA mutant in response to either H2O2 or TIBA (Fig. 9B,C), further indicating that the activation of AaAP1 gene expression was partially regulated by AaNoxA.

Figure 9.

Figure 9

Open in a new tab

Autoradiographic images of RNA gel blots. (A, B) The Alternaria alternata noxA null mutant (DN2) was grown on cellophane overlaid onto potato dextrose agar (PDA) for 2 days, shifted to PDA containing H2O2 (1 or 3 mm), KO2 (0.5 mg/mL), tert‐butyl‐hydroxyperoxide (t‐BHP, 0.05%), menadione (MND, 1 mm), haematoporphyrin (HP, 50 µm) or 2,3,5‐triiodobenzoic acid (TIBA, 2.5 or 5 mm), and incubated for an additional 24 h. Fungal RNA was hybridized with an AaAP1 gene probe. (C) Total RNA was purified from the wild‐type grown on H2O2 or TIBA, and hybridized with an AaAP1 probe. Gels staining with ethidium bromide indicate relative loading of the RNA samples. The sizes of the hybridization bands are indicated in kilobase pairs (kb).

DISCUSSION

Successful pathogenesis by the necrotrophic pathogen A. alternata in citrus is highly dependent on the production of a host‐specific toxin and the ability to detoxify ROS (Lin et al., 2009). In this article, we have described the cloning and functional characterization of an AaNoxA gene, a homologue of gp91phox (Nox2) in the human phagocytic oxidase, and have demonstrated pleiotropic roles in the tangerine pathotype of A. alternata. The cloned AaNoxA gene, encoding a putative membrane‐associated Nox, has been shown to promote ROS production, conidiation and fungal virulence. Impairment of the AaNoxA gene in A. alternata created a strain that was hypersensitive to H2O2, superoxide‐generating compounds (MND and KO2), diamide, SDS, CHP, TIBA and potent singlet oxygen‐generating compounds (haematoporphyrin and rose bengal). These deficiencies strongly resemble the phenotypes previously seen for the A. alternata ap1 null mutant defective at a YAP1‐like transcriptional regulator and for the A. alternata hog1 mutant defective at a HOG1‐like MAP kinase (Lin and Chung, 2010; Lin et al., 2009). Diamide is a sulphydryl‐targeted compound that has been shown to facilitate the formation of superoxide and NO· (de Lamirande et al., 2009). In the budding yeast S. cerevisiae, YAP1 senses peroxide stress and diamide stress using different mechanisms (Delaunay et al., 2000).

Little is known about how the Nox complex is regulated in fungi. In mammalian systems, p38 MAP kinase (HOG1 homologue) has been shown to activate the Nox complex via the phosphorylation of p47phox and p67phox (NoxR homologue) (Brown et al., 2009). Furthermore, a p21‐activated kinase (Pak) is also known to regulate the mammalian Nox complex (Martyn et al., 2005). Deletion of a Pak homologue in the ergot fungus Claviceps purpurea repressed accumulation of the Nox1 gene transcript (Rolke and Tudzynski, 2008). In the filamentous fungus Aspergillus nidulans, expression of a NoxA homologue has been shown to be suppressed by SakA, a HOG1 MAP kinase homologue (Lara‐Ortiz et al., 2003). In the endophytic fungus E. festucae, inactivation of a SakA homologue did not alter the expression of NoxA or NoxR. It was speculated that the interaction might occur at the post‐translational level (Eaton et al., 2008). Studies with Podospora anserina have indicated that NoxA facilitates the nuclear localization of the PaMpk1 MAP kinase (Kicka et al., 2006; Malagnac et al., 2004).

Experimental evidence derived from the present study revealed a regulatory expression of the AaAP1 and AaHOG1 genes by AaNoxA in response to ROS and chemical stimuli, implying a close interaction between ROS production and resistance. The involvement of AaNOXA in ROS resistance is mediated through the regulation of AaAP1 and AaHOG1. Both AaAP1 and AaHOG1 are absolutely required for cellular resistance to ROS and multidrug (Lin and Chung, 2010; Lin et al., 2009). Deletion of AaAP1 in the tangerine pathotype of A. alternata resulted in a severe reduction in catalase, peroxidase and SOD activities. It appears that AaNoxA, in conjunction with AaAP1 and AaHOG1, is responsible for maintaining ROS homeostasis in A. alternata. Impairment of AaNoxA in A. alternata decreased the production and accumulation of superoxide and H2O2. Thus, AaNoxA is one of the primary sources responsible for ROS production. Surprisingly, deletion of a Nox1 homologue in P. anserina or Magnaporthe grisea increased ROS production (Egan et al., 2007; Malagnac et al., 2004).

In mammalian phagocytic cells, gp91phox plays a central role in the high level of accumulation of superoxide in response to pathogen attacks (Diekman et al., 1994). However, disruption of AaNoxA or AaAP1 resulted in fungi showing an elevated sensitivity to NO· donors, as well as NO· synthase substrates and inhibitors, implying a possible involvement of the NOX system and AaAP1 in the NO· signalling pathways. The important role of AaNoxA in response to ROS and NO· was further supported by observations that the expression of AaNoxA was activated by H2O2, MND, KO2, haematoporphyrin, NO· donors (SNP and HDA) and l‐arginine (the prime substrate for NO· synthase). Expression of AaNoxA was almost abolished in fungi treated with nitro‐l‐arginine, an NO· synthase inhibitor. Hypersensitivity of the A. alternata noxA mutants to Nox inhibitors (DPI and APC) could be a result of the reduced expression of AaAP1 and AaHOG1. In addition to ROS resistance, both AaAP1 and AaHOG1 are also required for multidrug resistance.

We have observed that AaNoxA inactivation does not alter hyphal branching (data not shown). Recent studies with As. nidulans revealed that the production and deposition of ROS, regulated by the Nox complex, are responsible for apical dominance and for the suppression of growth of secondary hyphae (Semighini and Harris, 2008). The endophytic fungus E. festucae apparently generates ROS by the Nox complex in order to restrict hyphal branching and extensive growth within its grass host, thus maintaining the mutualistic association with its host (Tanaka et al., 2006). In addition, the Nox homologues have been shown to be necessary for the formation of multicellular fruiting bodies in Neurospora crassa, As. nidulans and P. anserina (Cano‐Domínguez et al., 2008; Lara‐Ortiz et al., 2003; Malagnac et al., 2004) and sclerotia in the phytopathogenic fungi Botrytis cinerea and C. purpurea (Giesbert et al., 2008; Segmüller et al., 2008).

AaNoxA has also been shown to be required for the formation of asexual spores (conidia) in A. alternata. Double mutations of Nox1 and Nox2 in M. grisea also reduced the production of conidia (Egan et al., 2007). Similar reduction of conidia was observed in N. crassa disrupted at the Nox1 locus (Cano‐Domínguez et al., 2008). These studies indicate an important function of the Nox complex in fungal conidial production. Previous studies have indicated that conidiation is partially regulated by the G protein‐controlled cyclic adenosine monophosphate (cAMP) level in A. alternata (Wang et al., 2010). Further investigations revealed that conidiation was also synergistically controlled by FUS3 and SLT2 MAPK‐mediated signalling pathways because targeted disruption of each of the genes nearly abrogated the production of conidia in A. alternata (Lin et al., 2010; Yago et al., 2011). Expression of the Nox complex has recently been suggested to be regulated by Fus3/Kss1 (pheromone signalling) and Slt (cell integrity) MAP kinases in fungi (Cano‐Domínguez et al., 2008; Segmüller et al., 2008). Our preliminary studies revealed that the expression of the AaFUS3 gene and phosphorylation of AaFUS3 in A. alternata were negatively regulated by the Gα subunit and cAMP‐dependent protein kinase (K. R. Chung, unpublished data). Further tests are required to determine whether or not expression of the AaFUS3 or AaSLT2 gene is regulated by AaNoxA in the context of conidiation by A. alternata.

The Nox complex has important functions in phytopathogenic fungi. In the rice blast pathogen M. grisea, both Nox1 and Nox2 are crucial for appressorium‐assisted penetration of rice (Egan et al., 2007). In the necrotrophic fungus B. cinerea, Nox2 regulates the formation of an appressorium‐like structure and Nox1 is required for in planta growth (Segmüller et al., 2008). The C. purpurea NoxA homolog is required for full virulence in cereals (Giesbert et al., 2008). It appears that AaNoxA is also an important virulence determinant in A. alternata, as the impaired mutant showed drastically decreased fungal virulence and rate of lesion formation on Minneola leaves. This pathological deficiency may be primarily a result of the reduced expression of AaAP1 and AaHOG1, because both genes have been demonstrated to be essential for pathogenicity in A. alternata (2009, 2011). In the present study, we showed that the expression of AaAP1 and AaHOG1 was controlled by AaNoxA. Similarly, the hypersensitivity of the A. alternata noxA null mutant to ROS, CHP, haematoporphyrin, TIBA, DPI and APC could also be attributed to the reduced expression of AaAP1 and AaHOG1. The A. alternata ap1 and hog1 null mutants also displayed hypersensitivity to these compounds (Lin and Chung, 2010). It is tempting to speculate that AaNoxA may perceive environmental stimuli, producing low levels of superoxide and H2O2, which serve as secondary messages to activate the expression of various regulators, including AaAP1, AaHOG1 and, perhaps, AaNoxA itself. The expression of AaAP1 and AaHOG1 might be up‐regulated by other unidentified factors, rather than AaNoxA, because the phenotypes resulting from the inactivation of AaNoxA were not completely identical to the levels seen in the ap1 and hog1 null mutants. Through the coordinate regulation of ROS‐detoxifying and sensing systems, A. alternata could effectively colonize host plants.

It remains uncertain whether the expression of AaNoxA is regulated by other Nox regulatory components, such as NoxR and Rac (small GTP‐binding protein), as demonstrated in other filamentous fungi (Cano‐Domínguez et al., 2008; Segmüller et al., 2008; Semighini and Harris, 2008; Tanaka et al., 2008). Our studies show that the expression of AaAP1 and AaHOG1, whose functions have been defined by genetic analysis to be responsible for ROS resistance (Lin et al., 2009), is partially regulated by AaNoxA. Indeed, the fungal mutants disrupted in AaAP1, AaHOG1 and AaNoxA displayed several common phenotypes in which they were all sensitive to ROS‐generating agents, CHP and TIBA, further supporting functional connections between AaAP1, AaHOG1 and AaNoxA.

In summary, this study has demonstrated that AaNoxA acts as a key regulator for the production of ROS and for signalling transductions leading to appropriate conidiation, fungal virulence and cellular resistance to ROS and multidrugs in a necrotrophic pathogen of citrus. These regulatory functions of AaNoxA conferring ROS resistance are probably modulated partially through the activation of the AaAP1 and AaHOG1 genes, whose products are responsible for the activation of ROS‐scavenging enzymes. Intriguingly, AaNoxA may be able to sense and respond to both ROS and NO·, which have been intensively examined for their roles in cellular differentiation, defence and pathogenicity in diverse fungal species (Brown et al., 2009). The results further highlight a fundamental complexity in maintaining the steady‐state levels of ROS in fungal systems.

EXPERIMENTAL PROCEDURES

Fungal strains and culture conditions

The wild‐type EV‐MIL31 strain of Alternaria alternata (Fr.) Keissler, which causes brown spots on tangerines, was used throughout the study. Fungal mutants disrupted at the AaAP1 gene, encoding an oxidative stress‐responsive transcription activator, or the AaHOG1 gene, encoding a HOG1 MAP kinase, were created in separate studies (Lin and Chung, 2010; Lin et al., 2009). Fungi were cultured on PDA (Difco, Sparks, MD, USA), complete medium (CM) or minimal medium (MM) at 28 °C (Chung, 2003). Assays for chemical sensitivity were conducted by transferring hyphal segments with sterile toothpicks onto a medium containing the test chemical and incubating the plates in an incubator. Fungal growth, indicating the sensitivity of chemicals, was determined by measuring the radius of the colonies at 4–7 days, depending on the type of chemicals tested. Fungi were cultured in liquid CM for 3 days for protein purification. To purify DNA and RNA, fungal strains were grown on an agar medium with a layer of sterile cellophane.

Molecular cloning and sequence analysis

The AaNoxA gene fragment was amplified by PCR with the primers NOXf1 (5′‐GAGACCTTYTGGTACACTCAYC‐3′) and NOXr1 (5′‐GATYTCGTTCTCRAAGACGTC‐3′) which are complementary to a NoxA‐like gene of A. brassicicola from the genome of A. alternata. The entire AaNoxA coding sequence and its 5′ and 3′ nontranslated regions were amplified by PCR from a library of A. alternata. The library was constructed from genomic DNA digested with DraI, EcoRI, PvuI and StuI, and ligated to adaptors using the Universal GenomeWalker kit (BD Biosciences, Palo Alto, CA, USA). PCR fragments were cloned into a pGEM‐T easy vector (Promega, Madison, WI, USA) for sequencing from both directions at Eton Bioscience (San Diego, CA, USA). blast similarity searches were performed at the National Center for Biotechnology Information. ORF and exon/intron positions were deduced from comparisons of genomic and cDNA sequences.

Functional analyses through targeted gene disruption and complementation

The AaNoxA gene was disrupted in the EV‐MIL31 strain using a split marker approach, as described previously (You et al., 2009). Two truncated fragments, PHY and YGT, overlapping within the HYG gene, encoding a phosphotransferase under the control of the As. nidulans trpC promoter (P) and terminator (T), and conferring hygromycin resistance, were amplified by PCR with the primers M13R (5′‐AGCGGATAACAATTTCACACAGGA‐3′) and hyg3 (5′‐GGATGCCTCCGCTCGAAGTA‐3′) and the primers hyg4 (5′‐CGTTGCAAGAACTGCCTGAA‐3′) and M13F (5′‐CGCCAGGGTTTTCCCAGTCACGAC‐3′), respectively. The 5′AaNoxA fragment was amplified with the primers NoxA‐pro2F (5′‐TGAGACGCTCTTCACACACTAGCTG‐3′) and M13R:NoxA (5′‐TCCTGTGTGAAATTGTTATCCGCTGGCGGACCTGCACACGTTCAACA‐3′) and fused with the PHY fragment (Fig. S2A). The 3′AaNoxA fragment was obtained with the primers M13F:NoxA (5′‐GTCGTGACTGGGAAAACCCTGGCGTCAAGTCGGTGACTTTACCCGC‐3′) and NoxA‐taa (5′‐TTAGAAATGCTCCTTCCAGAACTTGA‐3′) and fused with the YGT fragment. The italic sequences in the primers M13R:NoxA and M13F:NoxA are complementary to the primers M13R and M13F, respectively. Split marker fragments (10 µL each) were mixed and transformed into protoplasts prepared from the EV‐MIL31 strain using CaCl2 and polyethylene glycol, as described by Chung et al. (2002). Fungal transformants were recovered in a regeneration medium impregnated with 250 µg/mL hygromycin (Roche Applied Science, Indianapolis, IN, USA). Putative mutants disrupted at the AaNoxA locus were screened by PCR with the NoxA‐atg (5′‐ATGGGAGCAAGCGGAGGCAC‐3′) and hyg3 primers, or the NoxA‐taa and hyg4 primers.

Manipulation of nucleic acids

A DNeasy Plant kit (Qiagen, Valencia, CA, USA) was used to isolate fungal genomic DNA. RNA was isolated with Trizol solution (Molecular Research Center, Cincinnati, OH, USA), treated with DNase and employed to synthesize the first strand of cDNA using the SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Double‐stranded cDNA was amplified with gene‐specific primers and analysed by sequencing. Escherichia coli DH5α cells were used for the propagation of plasmid DNA. Plasmid was purified using a Quickclean miniprep kit (GenScript, Piscataway, NJ, USA). Standard molecular procedures were followed for the digestion of DNA with endonucleases, electrophoresis, ligation, transformation of bacterial cells and Northern blot hybridization. DNA probes used for RNA or DNA hybridization were amplified by PCR and simultaneously labelled with digoxigenin (DIG)‐11‐dUTP (Roche Applied Science) with gene‐specific primers. A Disodium 3‐(4‐methoxyspiro {1,2‐dioxetane‐3,2′‐(5′‐chloro)tricyclo [3.3.1.1]decan}‐4‐yl)phenyl phosphate (CSPD) chemofluorescent (Roche Applied Science) was used as a substrate for alkaline phosphatase in an immunological assay to detect the probe.

Detection and quantification of H2O2 and superoxide

Superoxide was detected by staining fungal hyphae with NBT, which is reduced by superoxide to form a dark blue, water‐insoluble formazan (Shinogi et al., 2003). Intracellular H2O2 of A. alternata was detected by staining fungal hyphae with DAB, showing a brown stain caused by the polymerization of DAB (Torres et al., 2002). Peroxide was further determined on the basis of the oxidation of ferrous (Fe2+) to ferric (Fe3+) ions in the presence of xylenol orange in acidic conditions, producing a purple substance with an absorbance between 540 and 620 nm (Jiang et al., 1990; Nourooz‐Zadeh et al., 1994). To detect and quantify intracellular H2O2, fungal isolates were grown on CM agar plates with a layer of cellophane for 3 days. Mycelia (1 g) were scraped off, ground with liquid nitrogen and soaked in 3 mL of 100 mm phosphate buffer (pH 7.0). Protein samples (50 µL) were added to a reaction mixture (500 µL) containing 250 µm ammonium ferrous(II) sulphate, 25 mm sulphuric acid, 100 mm sorbitol and 125 µm xylenol orange, and incubated at room temperature for 15 min. The amounts of H2O2 in the solution were determined spectrophotometrically by measuring the absorbance at 595 nm. Extracellular H2O2 was assayed by measuring an increase in absorbance at 240 nm (Aebi, 1984). Fungal isolates were cultured in liquid CM for 3 days and the amounts of H2O2 in the medium were determined spectrophotometrically over time. The concentration of H2O2 was calculated by referring to a standard curve that was established using authentic H2O2. ROS production was also evaluated using H2DCFDA (Molecular Probes, Eugene, OR, USA). Fungal hyphae were stained with H2DCFDA and examined with a Leitz Laborlux phase contrast microscope (Leica Microsystems, Deerfield, IL, USA).

Pathogenicity and toxin production

Assays for fungal pathogenicity were performed on detached Minneola (Citrus paradisi Macfad. ×C. reticulata Blanco) or calamondin (Citrus mitis Blanco) leaves inoculated by placing 10 µL of conidial suspension on each spot or by uniformly spraying them with a minisprayer, as described previously (Lin et al., 2009). The inoculated leaves were incubated in a mist box for 2–4 days for lesion development. ACT toxin was extracted from fungal cultures using Amberlite XAD‐2 resin and ethyl acetate, and analysed by thin layer chromatography as described by Kohmoto et al. (1993). The production of ACT toxin was also assessed by applying 5 µL of ethyl acetate extracts onto detached calamondin leaves.

Nucleotide sequences

Sequence data reported in this article have been deposited in the GenBank/EMBL Data Libraries under Accession Nos. JN900389 (AaNoxA), FJ376607 (AaAP1) and GQ414509 (AaHOG1).

Supporting information

Fig. S1 Alignment of amino acids among fungal NADPH oxidases NOXA and NOX1.

Fig. S2 Targeted disruption of AaNoxA in Alternaria alternata using a split marker approach. (A) Schematic depiction of the generation of truncated, but overlapping, hygromycin phosphotransferase gene (HYG) under the control of the Aspergillus nidulans trpC promoter, and gene disruption within AaNoxA. Oligonucleotide primers used to amplify each fragment are also indicated. (B) Image of DNA fragments amplified from genomic DNA prepared from wild‐type (WT) and two putative disruptants (DN2 and DN6) with the primers Nox‐atg and Hyg3, or the primers Nox‐taa and hyg4, electrophoresed in agarose gel and stained with ethidium bromide. (C) RNA gel blotting. Fungal RNA was electrophoresed in a formaldehyde‐containing denaturing gel, blotted and washed at high stringency after hybridization with an AaNoxA probe.

Fig. S3 Assays for sensitivity of the wild‐type (WT), the AaNoxA mutant (ΔN) and the AaAP1 mutant (ΔY) strains , and their complementation strains (Cp) of Alternaria alternata. Fungal strains were grown on potato dextrose agar (PDA) or PDA amended with test compounds as indicated for 4–7 days. Radial growth was measured. Only certain representative replicates are shown. MND, menadione; t‐BHP, tert‐butyl‐hydroxyperoxide.

Fig. S4 (A) Development of necrotic lesions on detached calamondin leaves after 3 days of treatment with ethyl acetate extracts prepared from cell‐free culture filtrates of Alternaria alternata wild‐type (WT), noxA deletion mutants DN2 and DN6, and noxA DN2/AaNoxA complementation strains (NCp1 and NCp7) grown in Richard's medium for 24 days. The mock controls were treated with ethyl acetate only. (B) Thin layer chromatography analysis of the ethyl acetate extract separated with benzene–ethyl acetate–acetic acid, indicating that the noxA null mutants are able to produce ACT toxin (indicated by an arrow) at levels similar to the wild‐type.

Supporting info item

Click here for additional data file. (648KB, doc)

ACKNOWLEDGEMENTS

This research was supported by the Florida Agricultural Experiment Station.

REFERENCES

  1. Aebi, H. (1984) Catalase in vitro . Methods Enzymol. 105, 121–126. [DOI] [PubMed] [Google Scholar]
  2. Aguirre, J. , Ríos‐Momberg, M. , Hewitt, D. and Hansberg, W. (2005) Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 13, 111–118. [DOI] [PubMed] [Google Scholar]
  3. Branco, M.R. , Marinho, H.S. , Cyrne, L. and Antunes, F. (2004) Decrease of H2O2 plasma membrane permeability during adaptation to H2O2 in Saccharomyces cerevisiae . J. Biol. Chem. 279, 6501–6506. [DOI] [PubMed] [Google Scholar]
  4. Brown, A.J.P. , Haynes, K. and Quinn, J. (2009) Nitrosative and oxidative stress responses in fungal pathogenicity. Curr. Opin. Microbiol. 12, 384–391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brun, S. , Malagnac, F. , Bidard, F. , Lalucque, H. and Silar, P. (2009) Functions and regulation of the Nox family in the filamentous fungus Podospora anserina: a new role in cellulose degradation. Mol. Microbiol. 74, 480–496. [DOI] [PubMed] [Google Scholar]
  6. Cano‐Domínguez, N. , Álvarez‐Delfín, K. , Hansberg, W. and Aguirre, J. (2008) NADPH oxidases NOX‐1 and NOX‐2 require the regulatory subunit NOR‐1 to control cell differentiation and growth in Neurospora crassa . Eukaryot. Cell, 7, 1352–1361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chung, K.‐R. (2003) Involvement of calcium/calmodulin signaling in cercosporin toxin biosynthesis by Cercospora nicotianae . Appl. Environ. Microbiol. 69, 1187–1196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chung, K.‐R. , Shilts, T. , Li, W. and Timmer, L.W. (2002) Engineering a genetic transformation system for Colletotrichum acutatum, the causal fungus of lime anthracnose and postbloom fruit drop. FEMS Microbiol. Lett. 213, 33–39. [DOI] [PubMed] [Google Scholar]
  9. Delaunay, A. , Isnard, A.D. and Toledano, M.B. (2000) H2O2 sensing through oxidation of the Yap1 transcription factor. EMBO J. 19, 5157–5166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Diekman, D. , Abo, A. , Johnstone, C. , Segal, A.W. and Hall, A. (1994) Interaction of Rac with p67phox and regulation of phagocytic NADPH oxidase activity. Science, 265, 531–533. [DOI] [PubMed] [Google Scholar]
  11. Eaton, C.J. , Jourdain, I. , Foster, S.J. , Hyams, J.S. and Scott, B. (2008) Functional analysis of a fungal endophyte stress‐activated MAP kinase. Curr. Genet. 53, 163–174. [DOI] [PubMed] [Google Scholar]
  12. Egan, M.J. , Wang, Z.‐Y. , Jones, M.A. , Smirnoff, N. and Talbot, N.J. (2007) Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. USA, 104, 11 772–11 777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giesbert, S. , Schürg, T. , Scheele, S. and Tudzynski, P. (2008) The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea . Mol. Plant Pathol. 9, 317–327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jiang, Z.‐Y. , Woollard, A.C.S. and Wolff, S.P. (1990) Hydrogen peroxide production during experimental protein glycation. FEBS Lett. 268, 69–71. [DOI] [PubMed] [Google Scholar]
  15. Kicka, S. , Bonnet, C. , Sobering, A.K. , Ganesan, L.P. and Silar, P. (2006) A mitotically inheritable unit containing a MAP kinase module. Proc. Natl. Acad. Sci. USA, 103, 13 445–13 450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kohmoto, K. , Akimitsu, K. and Otani, H. (1991) Correlation of resistance and susceptibility of citrus to Alternaria alternata with sensitivity to host‐specific toxins. Phytopathology, 81, 719–722. [Google Scholar]
  17. Kohmoto, K. , Itoh, Y. , Shimomura, N. , Kondoh, Y. , Otani, H. , Nishimura, S. and Nakatsuka, S. (1993) Isolation and biological activities of two host‐specific toxins from tangerine pathotype of Alternaria alternata . Phytopathology, 83, 495–502. [Google Scholar]
  18. Lahey, K.A. , Yuan, R. , Burns, J.K. , Ueng, P.P. , Timmer, L.W. and Chung, K.‐R. (2004) Induction of phytohormones and differential gene expression in citrus flowers infected by the fungus Colletotrichum acutatum . Mol. Plant–Microbe Interact. 17, 1394–1401. [DOI] [PubMed] [Google Scholar]
  19. de Lamirande, E. , Lamothe, G. and Villemure, M. (2009) Control of superoxide and nitric oxide formation during human sperm capacitation. Free Radic. Biol. Med. 46, 1420–1427. [DOI] [PubMed] [Google Scholar]
  20. Lara‐Ortiz, T. , Riverose‐Rosas, H. and Aguirre, J. (2003) Reactive oxygen species generated by microbial NADPH oxidase NoxA regulate sexual development in Aspergillus nidulans . Mol. Microbiol. 50, 1241–1256. [DOI] [PubMed] [Google Scholar]
  21. Lin, C.‐H. and Chung, K.‐R. (2010) Specialized and shared functions of the histidine kinase‐ and HOG1 MAP kinase‐mediated signaling pathways in Alternaria alternata, the filamentous fungal pathogen of citrus. Fungal Genet. Biol. 47, 381–391. [DOI] [PubMed] [Google Scholar]
  22. Lin, C.‐H. , Yang, S.L. and Chung, K.‐R. (2009) The YAP1 homolog‐mediated oxidative stress tolerance is crucial for pathogenicity of the necrotrophic fungus Alternaria alternata in citrus. Mol. Plant–Microbe Interact. 22, 942–952. [DOI] [PubMed] [Google Scholar]
  23. Lin, C.‐H. , Yang, S.L. , Wang, N.‐Y. and Chung, K.‐R. (2010) The FUS3 MAPK signaling pathway of the citrus pathogen Alternaria alternata functions independently or cooperatively with the fungal redox‐responsive AP1 regulator for diverse developmental, physiological and pathogenic processes. Fungal Genet. Biol. 47, 381–391. [DOI] [PubMed] [Google Scholar]
  24. Lin, C.‐H. , Yang, S.L. and Chung, K.‐R. (2011) Cellular responses required for oxidative stress tolerance, colonization and lesion formation by the necrotrophic fungus Alternaria alternata in citrus. Curr. Microbiol. 62, 807–815. [DOI] [PubMed] [Google Scholar]
  25. Malagnac, F. , Lalucque, H. , Lepère, G. and Silar, P. (2004) Two NADPH oxidase isoforms are required for sexual reproduction and ascospore germination in the filamentous fungus Podospora anserina . Fungal Genet. Biol. 41, 982–997. [DOI] [PubMed] [Google Scholar]
  26. Martyn, K.D. , Kim, M.‐J. , Quinn, M.T. , Dinauer, M.C. and Knaus, U.G. (2005) p21‐activated kinase (Pak) regulates NADPH oxidase activation in human neutrophils. Blood, 106, 3962–3969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nerud, F. , Baldrian, P. , Gabriel, J. and Ogbeifun, D. (2001) Decolorization of synthetic dyes by the Fenton reagent and the Cu/pyridine/H2O2 system. Chemosphere, 44, 957–961. [DOI] [PubMed] [Google Scholar]
  28. Nourooz‐Zadeh, J. , Tajaddini‐Sarmadi, J. and Wolff, S.P. (1994) Measurement of plasma hydroxyperoxide concentration by the ferrous oxidation–xylenol orange assay. Anal. Biochem. 220, 403–409. [DOI] [PubMed] [Google Scholar]
  29. Rolke, Y. and Tudzynski, P. (2008) The small GTPase Rac and the p21‐activated kinase Cla4 in Claviceps purpurea: interaction and impact on polarity, development and pathogenicity. Mol. Microbiol. 68, 405–423. [DOI] [PubMed] [Google Scholar]
  30. Scott, B. and Eaton, C.J. (2008) Role of reactive oxygen species in fungal cellular differentiations. Curr. Opin. Microbiol. 11, 488–493. [DOI] [PubMed] [Google Scholar]
  31. Scott, B. , Takemoto, D. and Tanaka, A. (2007) Fungal endophyte production of reactive oxygen species is critical for maintaining the mutualistic symbiotic interaction between Epichloë festucae and perennial ryegrass. Plant Signal. Behav. 2, 171–173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Segmüller, N. , Kokkelink, L. , Giesbert, S. , Odinius, D. , van Kan, J. and Tudzynski, P. (2008) NADPH oxidases are involved in differentiation and pathogenicity in Botrytis cinerea . Mol. Plant–Microbe Interact. 21, 808–819. [DOI] [PubMed] [Google Scholar]
  33. Semighini, C.P. and Harris, S.D. (2008) Regulation of apical dominance in Aspergillus nidulans hyphae by reactive oxygen species. Genetics, 179, 1919–1932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shinogi, T. , Suzuki, T. , Kurihara, T. , Narusaka, Y. and Park, P. (2003) Microscopic detection of reactive oxygen species generation in the compatible and incompatible interactions of Alternaria alternata Japanese pear pathotype and host plant. J. Gen. Plant Pathol. 69, 7–16. [Google Scholar]
  35. Takemoto, D. , Tanaka, A. and Scott, B. (2006) A p67Phox‐like regulator is recruited to control hyphal branching in a fungal–grass mutualistic symbiosis. Plant Cell, 18, 2807–2821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Takemoto, D. , Tanaka, A. and Scott, B. (2007) NADPH oxidase in fungi: diverse roles of reactive oxygen species in fungal cellular differentiation. Fungal Genet. Biol. 44, 1065–1076. [DOI] [PubMed] [Google Scholar]
  37. Tanaka, A. , Christensen, M.J. , Takemoto, D. , Park, P. and Scott, B. (2006) Reactive oxygen species play a role in regulating a fungus–perennial ryegrass mutualistic interaction. Plant Cell, 18, 1052–1066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tanaka, A. , Takemoto, D. , Hyon, G.‐S. , Park, P. and Scott, B. (2008) NoxA activation by the small GTPase RacA is required to maintain a mutualistic symbiotic association between Epichloë festucae and perennial ryegrass. Mol. Microbiol. 68, 1165–1178. [DOI] [PubMed] [Google Scholar]
  39. Torres, M.A. , Dangl, J.L. and Jones, J.D. (2002) Arabidopsis gp91phox homologs AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response. Proc. Natl. Acad. Sci. USA, 99, 517–522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tsurumi, S. and Ohwaki, Y. (1978) Transport of 14C‐labelled indoleacetic acid in Vicia root segments. Plant Cell Physiol. 39, 1111–1118. [Google Scholar]
  41. Wang, N.‐Y. , Lin, C.‐H. and Chung, K.‐R. (2010) A Gα subunit gene is essential for conidiation and potassium efflux but dispensable for pathogenicity of Alternaria alternata in citrus. Curr. Genet. 56, 43–51. [DOI] [PubMed] [Google Scholar]
  42. Watanabe, T. , Koller, K. and Messner, K. (1998) Copper‐dependent depolymerisation of lignin in the presence of fungal metabolite, pyridine. J. Biotechnol. 62, 221–230. [DOI] [PubMed] [Google Scholar]
  43. Yago, J.I. , Lin, C.‐H. and Chung, K.‐R. (2011) The SLT2 mitogen‐activated protein kinase‐mediated signalling pathway governs conidiation, morphorgenesis, fungal virulence and production of toxin and melanin in the tangerine pathotype of Alternaria alternata . Mol. Plant Pathol. 12, 653–665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yang, S.L. , Lin, C.‐H. and Chung, K.‐R. (2009) Coordinate control of oxidative stress, vegetative growth and fungal pathogenicity via the AP1‐mediated pathway in the rough lemon pathotype of Alternaria alternata . Physiol. Mol. Plant Pathol. 74, 100–110. [Google Scholar]
  45. You, B.‐J. , Lee, M.‐H. and Chung, K.‐R. (2009) Gene‐specific disruption in the filamentous fungus Cercospora nicotianae using a split‐marker approach. Arch. Microbiol. 191, 615–622. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 Alignment of amino acids among fungal NADPH oxidases NOXA and NOX1.

Fig. S2 Targeted disruption of AaNoxA in Alternaria alternata using a split marker approach. (A) Schematic depiction of the generation of truncated, but overlapping, hygromycin phosphotransferase gene (HYG) under the control of the Aspergillus nidulans trpC promoter, and gene disruption within AaNoxA. Oligonucleotide primers used to amplify each fragment are also indicated. (B) Image of DNA fragments amplified from genomic DNA prepared from wild‐type (WT) and two putative disruptants (DN2 and DN6) with the primers Nox‐atg and Hyg3, or the primers Nox‐taa and hyg4, electrophoresed in agarose gel and stained with ethidium bromide. (C) RNA gel blotting. Fungal RNA was electrophoresed in a formaldehyde‐containing denaturing gel, blotted and washed at high stringency after hybridization with an AaNoxA probe.

Fig. S3 Assays for sensitivity of the wild‐type (WT), the AaNoxA mutant (ΔN) and the AaAP1 mutant (ΔY) strains , and their complementation strains (Cp) of Alternaria alternata. Fungal strains were grown on potato dextrose agar (PDA) or PDA amended with test compounds as indicated for 4–7 days. Radial growth was measured. Only certain representative replicates are shown. MND, menadione; t‐BHP, tert‐butyl‐hydroxyperoxide.

Fig. S4 (A) Development of necrotic lesions on detached calamondin leaves after 3 days of treatment with ethyl acetate extracts prepared from cell‐free culture filtrates of Alternaria alternata wild‐type (WT), noxA deletion mutants DN2 and DN6, and noxA DN2/AaNoxA complementation strains (NCp1 and NCp7) grown in Richard's medium for 24 days. The mock controls were treated with ethyl acetate only. (B) Thin layer chromatography analysis of the ethyl acetate extract separated with benzene–ethyl acetate–acetic acid, indicating that the noxA null mutants are able to produce ACT toxin (indicated by an arrow) at levels similar to the wild‐type.

Supporting info item

Click here for additional data file. (648KB, doc)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES