Virulence factor regulator (Vfr) controls virulence‐associated phenotypes in Pseudomonas syringae pv. tabaci 6605 by a quorum sensing‐independent mechanism

Summary

Virulence factor regulator (Vfr) is a member of the cyclic 3′,5′‐adenosine monophosphate (cAMP) receptor proteins that regulate the expression of many important virulence genes in Pseudomonas aeruginosa. The role of Vfr in pathogenicity has not been elucidated fully in phytopathogenic bacteria. To investigate the function of Vfr in Pseudomonas syringae pv. tabaci 6605, the vfr gene was disrupted. The virulence of the vfr mutant towards host tobacco plants was attenuated significantly, and the intracellular cAMP level was decreased. The vfr mutant reduced the expression of flagella‐, pili‐ and type III secretion system‐related genes and the defence response in nonhost Arabidopsis leaves. Furthermore, the expression levels of achromobactin‐related genes and the iron uptake ability were decreased, suggesting that Vfr regulates positively these virulence‐related genes. In contrast, the vfr mutant showed higher tolerance to antimicrobial compounds as a result of the enhanced expression of the resistance–nodulation–division family members, the mexA, mexB and oprM genes. We further demonstrated that the mutant strains of vfr and cyaA, an adenylate cyclase gene responsible for cAMP synthesis, showed a similar phenotype, suggesting that Vfr regulates virulence factors in a cAMP‐dependent manner. Because there was no significant difference in the production of acylhomoserine lactone (AHL) quorum sensing molecules in the wild‐type, vfr and cyaA mutant strains, Vfr might control important virulence factors by an AHL‐independent mechanism in an early stage of infection by this bacterium.

Introduction

It has been reported that intracellular cyclic 3′,5′‐adenosine monophosphate (cAMP) levels in the animal pathogen Pseudomonas aeruginosa modulate the expression of type III secretion system (T3SS) genes, and that a host cell contact signal mediates the expression of T3SS genes through the cAMP pathway (Wolfgang et al., 2003; Yahr and Wolfgang, 2006). Many virulence factors, including type IV pili (T4P), the type II secretion system, T3SS, quorum sensing and flagellar biogenesis, have been reported to be regulated by cAMP, and cAMP may control gene expression via the transcription factor Vfr (virulence factor regulator), which belongs to the cAMP receptor protein (Crp) family (Serate et al., 2011; Whitchurch et al., 2005). A recent article has reported that cAMP is required for DNA‐binding activity and for the Vfr‐dependent regulation of specific virulence genes (Fuchs et al., 2010). There are relationships between quorum sensing and Vfr‐mediated regulation. For example, Vfr in P. aeruginosa regulates directly rhlR transcription in the rhl quorum sensing system by binding to the Vfr‐binding sites in the rhlR promoter (Croda‐García et al., 2011). However, the Pseudomonas quinolone signal [2‐heptyl‐3‐hydroxy‐4(1H)‐quinolone: PQS] is regulated by the LasI and RhlI quorum sensing systems in P. aeruginosa (Diggle et al., 2003), and Vfr may regulate all quorum sensing systems in P. aeruginosa (Whitchurch et al., 2005). In P. aeruginosa, the Chp chemotaxis‐like chemosensory system, which has been reported to regulate T4P production and twitching motility, plays a global regulatory role in virulence by modulating the intracellular cAMP level and the expression of Vfr‐dependent virulence‐related genes (Fulcher et al., 2010).

The role of Vfr in pathogenicity has not been elucidated fully in phytopathogenic bacteria. In Pectobacterium chrysanthemi, pectinases that cleave pectin, a major component of the plant cell wall, are known to be important virulence factors. Previous studies have demonstrated that pectinase production is subjected to catabolite repression and that Crp is required for the expression of pectinase genes in this bacterium (Reverchon et al., 1997). Clp, a Crp orthologue in Xanthomonas campestris pv. campestris (Xcc), has high homology with Crp in Escherichia coli and Vfr in P. aeruginosa, which contains a conserved sequence of the cyclic nucleotide monophosphate (cNMP)‐binding domain (He et al., 2007). It has been reported that Clp binds to the target DNA promoter, and that this DNA‐binding ability is reduced by cyclic 3′,5′‐diguanosine monophosphate (c‐di‐GMP), indicating that Clp regulates negatively the expression of virulence genes by c‐di‐GMP in a dose‐dependent manner (Chin et al., 2010).

Previously, we have investigated the pathogenicity factors in Pseudomonas syringae pv. tabaci 6605 (Pta6605), a Gram‐negative bacterium responsible for wildfire disease in host tobacco plants. This phytopathogenic bacterium requires many pathogenicity factors to establish infection. For example, flagella‐ and T4P‐mediated motilities, T3SS, quorum sensing and Gac two‐component systems are required for the virulence of this pathogen on host tobacco (Ichinose et al., 2003; Marutani et al., 2005, 2008; Taguchi and Ichinose, 2011; Taguchi et al., 2006a). However, the mechanism that regulates the expression of virulence‐related genes has not yet been elucidated. Recently, we have found that the expression of the vfr gene is reduced significantly in T4P‐related mutants in Pta6605 (Taguchi and Ichinose, 2011). Thus, the expression and function of T4P and Vfr may interact with each other to regulate virulence. However, little is known about Vfr in Pta6605.

In this study, to clarify the role of Vfr in virulence, we generated the mutant strain of vfr and its complemented strain in Pta6605. Furthermore, we also generated the mutant strain of cyaA, an adenylate cyclase gene responsible for cAMP synthesis, and its complemented strain to compare the phenotypes of vfr and cyaA mutant strains, and to analyse the involvement of cAMP in virulence. The phenotype of the vfr and cyaA mutants resembled that of T4P‐defective mutants (Taguchi and Ichinose, 2011) as a result of the reduced surface motility, callose deposition in the nonhost plant and expression of T3SS genes, as well as the enhanced expression of the resistance–nodulation–division (RND) family members mexA, mexB and oprM (mexAB/oprM), which together are known as a major multidrug efflux system in P. syringae (Stoitsova et al., 2008). On the basis of the results obtained in this study and our previous investigation, we discuss the regulatory network for the expression of virulence factors mediated by Vfr with cAMP and quorum sensing in the control of T4P and flagella biogenesis, respectively.

Results

Cloning of vfr gene and similarity of Vfr and related proteins

Because many of the virulence factors have been shown to be regulated by Vfr in animal and plant pathogenic bacteria, we cloned vfr of Pta6605 by polymerase chain reaction (PCR) from genomic DNA as described in Experimental procedures. The deduced Vfr protein has 214 amino acid residues with a molecular mass of 24.0 kDa, and shows 99%, 96% and 92% identity with that of P. syringae pv. phaseolicola 1448A (Pph1448A), P. syringae pv. syringae B728a (PsyB728a) and P. syringae pv. tomato DC3000 (PtoDC3000), respectively (data not shown). The amino acid residues G71, E72, R82, S83, T127 and S128 of Crp in E. coli are indispensable sites in cAMP binding (He et al., 2007; Lee et al., 1994). All of these amino acids, except for S128, are conserved in the Vfr proteins in Pta6605 and P. aeruginosa (Fig. 1B, West et al., 1994). The Vfr in Pta6605 shows 88%, 71% and 46% amino acid identity with the Vfr in P. aeruginosa PAO1 (West et al., 1994), Crp in E. coli (Lee et al., 1994) and Clp in Xcc (He et al., 2007), respectively. The helix‐turn‐helix motif (R174 to K193 of Vfr in Pta6605), implicated in DNA binding (He et al., 2007), is also conserved in Pta6605. The vfr mutant was constructed as described in Experimental procedures, which lost the predicted cAMP‐binding sites (R86, S87, T131 and T132 of Vfr in Pta6605) and the DNA‐binding site as a result of the frame shift.

Figure 1.

(A) Schematic organization of vfr gene in Pseudomonas syringae pv. phaseolicola 1448A (Pph1448A) and construction of vfr mutant in the corresponding region of Pseudomonas syringae pv. tabaci 6605 (Pta6605). Locus IDs for Pph1448A are shown inside the respective arrows. Polymerase chain reaction (PCR) was carried out to isolate the vfr‐containing DNA fragment using primers (vfr‐F and vfr‐R), indicated by arrowheads; the internal region was then excised by digestion with BsmFI and NarI. (B) Multiple sequence alignment of the deduced amino acid sequence of the virulence factor regulator (Vfr) from Pta6605 (Vfr Pta6605) and P. aeruginosa PAO1 (Vfr PaPAO1, accession number: NC_002516.2), cyclic 3′,5′‐adenosine monophosphate (cAMP) receptor protein (Crp) from Escherichia coli K121655 (Crp Ec, NC_000913) and Clp from Xanthomonas campestris pv. campestris ATCC33913 (Clp Xcc, NC_003902). The cAMP‐binding sites G71, E72, R82, S83, T127 and S128 in Crp Ec and their corresponding amino acid residues in other proteins are indicated by blue letters, whereas the DNA‐binding domains as a helix‐turn‐helix motif in Clp Xcc and their corresponding regions are denoted by red letters.

Virulence of vfr mutant on host tobacco leaves

To investigate whether Vfr in Pta6605 is involved in the expression of virulence factors, as reported for P. aeruginosa (Whitchurch et al., 2005), an inoculation test of the wild‐type (WT), vfr mutant and its complemented strain on host tobacco leaves was performed. As illustrated in Fig. 2A, the vfr mutant showed attenuated virulence compared with the WT strain, and the complemented strain recovered the ability to cause disease symptoms at 11 days post‐inoculation (dpi). The bacterial population of the vfr mutant 3 and 6 dpi on host tobacco leaves was lower than that of the WT and complemented strains (Fig. 2B). Because the vfr mutant and complemented strain were able to grow at the same rate as the WT strain in Luria–Bertani (LB) medium with 10 mm MgCl₂ (data not shown), we concluded that vfr in Pta6605 contributes to virulence in its host tobacco plant.

Figure 2.

Inoculation of host tobacco leaves by a dip method. (A) Tobacco leaves were dip inoculated with each bacterial suspension [2 × 10⁸ colony‐forming units (cfu)/mL in 10 mm MgSO₄] for 20 min at 23 °C. Photographs taken 11 days after inoculation show representative results obtained from three independent experiments. (B) Bacterial population was calculated at 0, 3 and 6 days post inoculation. The bars represent standard deviations for three independent experiments. Symbols indicate a significant difference from the wild‐type (WT) or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Motility experiments and Western blotting of flagellin protein

It has been reported that Vfr is a negative regulator of the major flagellar transcriptional regulator fleQ in P. aeruginosa (Dasgupta et al., 2002). In contrast, Clp in Xcc has been reported to positively regulate the expression of the flagellin gene fliC (Lee et al., 2003). The vfr mutant in Pta6605 retained swimming motility in KB liquid medium (2% proteose peptone No.3, 8.6 mM K₂HPO₄, 1.6 mM MgSO₄, 1% glycerol) at the same level as the WT (data not shown). Therefore, the swimming motility of the vfr mutant on a 0.25% agar MMMF [50 mM potassium phosphate buffer, 7.6 mM (NH₄)₂SO₄, 1.7 mM MgCl₂ and 1.7 mM NaCl, pH 5.7, supplemented with mannitol and fructose] plate and the swarming motility on a 0.45% agar SWM (0.5% peptone, 0.3% yeast extract) plate were compared with those of the WT in Pta6605. As shown in Fig. 3A,B, both motilities of the mutant strain were remarkably reduced, and those of the complemented strain were almost, although not completely, restored. To compare the amount of flagellin protein in whole‐cell lysates and in the culture supernatant from each strain, immunoblot analysis probed with an anti‐flagellin antibody was performed (Fig. 3C,D). The quantitative analysis demonstrated that the WT and complemented strains produced a larger amount of flagellin protein than the vfr mutant. To investigate the reason for the reduced production of flagellin protein in the vfr mutant, microarray analysis was carried out according to the methods described in Experimental procedures (Table S1, see Supporting Information). The result showed that the expression of certain flagella‐related genes was reduced in the vfr mutant strain (Table 1), indicating that Vfr probably positively controls flagellar gene expression, in contrast with the regulation in P. aeruginosa (Dasgupta et al., 2002). Although the expression level of the fliC gene from microarray data was not changed remarkably in the vfr mutant (0.95‐fold expression), other flagellar biogenesis‐related genes showed lower expression than in the WT strain (Table 1). This might be the reason for the lower production of flagella filaments in the vfr mutant, although the mechanism is not yet clear (Fig. 3C,D).

Figure 3.

Surface motilities and flagellin production. Surface swimming motility on a 0.25% agar plate of MMMF medium (50 mM potassium phosphate buffer, 7.6 mM (NH₄)₂SO₄, 1.7 mM MgCl₂ and 1.7 mM NaCl, pH 5.7, supplemented with 10 mM each of mannitol and fructose) at 23 °C (A) and surface swarming motility on a 0.45% agar plate of SWM medium (0.5% peptone, 0.3% yeast extract) at 27 °C (B). Photographs show each plate after 48 h of incubation. Data shown in parentheses are the average of three independent replicates. Immunoblot analysis of flagellin protein in whole‐cell lysates (ppt, C) and supernatant (sup, D) from each strain using anti‐flagellin antibody (top panels). The signal intensity was quantified using ImageJ 1.45 software. The relative signal intensity in the wild‐type (WT) was set to ‘1’ (bottom panels). Symbols indicate a significant difference from the WT or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Table 1.

Gene expression profiles of vfr mutant strain compared with those of wild‐type (WT) strain by microarray analysis

Gene locus	Name	Δvfr/WT	Function of gene product	P value
			Multidrug resistance
PSPPH_4014	mexB	5.234	Multidrug/solvent transporter	1.19E‐10
PSPPH_4012	ttgR	4.472	Transcriptional regulator	8.91E‐03
PSPPH_4015	oprM	4.209	NodT family outer membrane efflux lipoprotein	8.05E‐08
PSPPH_4013	mexA	4.038	RND family efflux transporter MFP subunit	1.27E‐10
			Hrp type III secretion system
PSPPH_1265	shcM	0.426	Type III chaperone protein	5.95E‐07
PSPPH_1274	hrpB	0.501	Type III secretion component protein	1.88E‐05
PSPPH_1278	hrpF	0.501	Type III secretion component protein	3.98E‐05
PSPPH_1295	hrpK1	0.519	Type III effector	5.13E‐06
PSPPH_1272	hrpA2	0.567	Type III helper protein	1.29E‐05
			Iron uptake
PSPPH_2756	acsA	0.351	Achromobactin biosynthetic protein	3.14E‐06
PSPPH_2754	acsC	0.462	Achromobactin biosynthetic protein	1.65E‐03
			Flagellum biogenesis
PSPPH_3370	fliP	0.475	Flagellar biosynthesis protein	2.61E‐07
PSPPH_3390	fliD	0.531	Flagellar hook‐associated protein	1.61E‐07
PSPPH_3363	fliA	0.623	Flagellar biosynthesis sigma factor	2.11E‐06
PSPPH_3371	fliO	0.615	Flagellar protein	1.23E‐05
PSPPH_3399	flgI	0.634	Flagellar basal body P‐ring protein	1.45E‐06
			Type IV pilus biogenesis
PSPPH_0481	pilI	0.568	Type IV pilus biogenesis protein PilI	5.30E‐05
PSPPH_0480	pilH	0.633	Type IV pilus response regulator PilH	7.08E‐05
PSPPH_0730		0.653	Type IV pilus‐associated protein, putative	1.50E‐04
PSPPH_0479	pilG	0.657	Type IV pilus response regulator PilG	7.37E‐04
PSPPH_4436		0.730	General secretion pathway/type 4 pilus assembly protein	6.13E‐03
			Second messenger biosynthesis
PSPPH_0905		0.32	GGDEF domain‐containing putative diguanylate cyclase	1.91E‐08

A t‐test was applied to the signal intensities of the WT and each mutant, and P < 0.05 was considered to be statistically significant.

Microarray analysis also revealed that the expression of T4P‐related genes in the vfr mutant was weaker than in the WT strain (Table 1). Our previous results have demonstrated that T4P‐defective mutants in Pta6605 show impaired surface swimming and swarming motilities and reduced expression of the vfr gene (Taguchi and Ichinose, 2011). However, the amount of T4P from the vfr mutant strain was not significantly different from that of the WT strain in the lysate of whole cells incubated in LB with 10 mm MgCl₂ for 24 h (data not shown). We next prepared pilus‐containing surface fractions from each strain grown on a KB plate. The result of Western blotting revealed that the amount of pilin was not changed remarkably in the vfr mutant (Fig. S1A, see Supporting Information). There was no significant difference in the transcription levels of the pilA gene in the WT and vfr mutant (0.83‐fold expression, Table 1).

Antibiotic tolerance

Recently, we have reported that the T4P‐related mutant strains highly express mexAB/oprM genes, but show reduced expression of vfr and cyaA genes (Taguchi and Ichinose, 2011). It has been reported that the MexAB/OprM pump in P. aeruginosa and E. coli shows low specificity to substrates such as most of the common antibiotics, dyes, detergents and organic solvents (Nikaido, 2009). In the plant pathogens Pph1448A, PsyB728a and PtoDC3000, mutation of this RND pump reduces the tolerance to a wide range of antimicrobials, with the exception of the aminoglycosides, gentamicin, kanamycin and streptomycin (Stoitsova et al., 2008). Microarray analysis revealed that the expression of the mexAB/oprM genes was significantly up‐regulated in the vfr mutant strain (Table 1). The tolerance to antibiotics was compared by a growth inhibition test on a plate using chloramphenicol, spectinomycin, cefotaxim and crystal violet. The results displayed in Fig. 4A indicate that the vfr mutant shows a higher tolerance to these antibiotics, except for crystal violet. Enhanced expression of the mexA and oprM genes in the vfr mutant strain was also confirmed by real‐time quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) analysis [Figs 4B and S2 (Supporting Information)].

Figure 4.

Antibiotic tolerance. (A) The diameter of the growth inhibition zone by chloramphenicol (Cm, 175 μg), spectinomycin (Spe, 250 μg), cefotaxim (Cef, 250 μg) and crystal violet (CV, 50 μg) was measured after incubation for 24 h at 27 °C. The bars represent the standard deviations for three independent experiments. (B) Real‐time quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) analysis of mexA and oprM gene expression in the wild‐type (WT), vfr mutant and complemented strains. Expression levels were normalized to the rpoD gene, and the level of this gene expressed in WT was set to ‘1’. Data are the representative results obtained from three independent experiments. Symbols indicate a significant difference from the WT or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Hypersensitive response (HR)‐inducing activity in nonhost plant

Microarray analysis also showed that the expression of several hrp‐related genes, which encode for the Hrp type III secretion apparatus, Hrp effectors and Hrp chaperone proteins, was decreased by approximately one‐half in the vfr mutant strain compared with the WT strain (Table 1). It is known that the hrp gene cluster is required for HR in nonhost plants (Lindgren et al., 1986). Therefore, we compared the cell death and callose deposition‐inducing activity of each strain in the nonhost Arabidopsis thaliana. Trypan blue staining clearly demonstrated that the vfr mutant strain caused only weak cell death, and aniline blue staining indicated that the induction of callose deposition was three times lower in nonhost A. thaliana leaves (Fig. 5A,B). Real‐time qRT‐PCR analysis confirmed that the expression of the hrpA and hrpK genes was reduced in the vfr mutant strain (Figs 5C and S2).

Figure 5.

Defence response in nonhost Arabidopsis thaliana leaves and hrp gene expression. Arabidopsis leaves were infiltrated with each bacterial strain at a density of 2 × 10⁸ colony‐forming units (cfu)/mL, and cell death (A) and callose deposition (B) were observed 48 h after inoculation. The average number of callose deposits with standard deviation (SD) per 4‐mm² area from three independent experiments is shown in parentheses. Scale bar, 500 μm. (C) Real‐time quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) analysis of hrpK and hrpA gene expression in the wild‐type (WT), vfr mutant and complemented strains. Expression levels were normalized to the rpoD gene, and the level of this gene expressed in WT was set to ‘1’. Data are the representative results obtained from three independent experiments. Symbols indicate a significant difference from the WT or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Production of siderophores

Because iron is an indispensable growth factor for all organisms, including bacteria, an iron acquisition mechanism has developed using a chelator called a siderophore (Ravel and Cornelis, 2003; Smith et al., 2005). The fluorescent Pseudomonas group produces a major siderophore compound called pyoverdine. A second siderophore, achromobactin, has been reported in PsyB728a and Erwinia chrysanthemi (Berti and Thomas, 2009; Franza et al., 2005). A chrome azurol‐S (CAS) assay (Schwyn and Neilands, 1987) revealed that siderophore production of the vfr mutant was reduced (Fig. 6A). As there was no significant difference in the amount of pyoverdine in the culture supernatant of each strain (data not shown), reduced iron acquisition in the vfr mutant might be caused by decreased expression of achromobactin‐related genes. Our microarray analysis and qRT‐PCR revealed that the vfr mutant showed reduced expression of acsA and acsC genes for achromobactin biosynthetic enzymes (Table 1, Figs 6B and S2).

Figure 6.

Siderophore production. (A) Quantitative analysis of siderophore production. The bars represent the standard deviations for three independent experiments. CAS, chrome azurol‐S; OD ₆₃₀, optical density at 630 nm. (B) Real‐time quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) analysis of acsA and acsC gene expression in the wild‐type (WT), vfr mutant and complemented strains. Expression levels were normalized to the rpoD gene, and the level of this gene expressed in WT was set to ‘1’. Data are the representative results obtained from three independent experiments. Symbols indicate a significant difference from the WT or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Acylhomoserine lactone (AHL) production and biofilm formation

We compared the amounts of AHLs extracted from each bacterial culture with ethyl acetate using the biosensor Chromobacterium violaceum CV026; however, there was no significant difference in AHL production (Fig. S1B). To examine whether Vfr is involved in biofilm formation, biofilm formation on a polystyrene tube after 48 h of incubation was investigated. As shown in Fig. S1C, the ability of the vfr mutant strain to form a biofilm was similar to that of the WT. These results are different from those found in P. aeruginosa, where AHL production is controlled by Vfr (Whitchurch et al., 2005), and suggest that biofilm formation and AHL production are not under the regulation of Vfr in Pta6605.

Construction of cyaA mutant and measurement of cAMP

In P. aeruginosa, it has been reported that cAMP is required for Vfr‐dependent regulation, except for the LasR promoter (Fuchs et al., 2010). To examine the effect of cAMP on the control of the expression of virulence genes in Pta6605, a mutation was introduced into a gene for adenylate cyclase. Although two genes, cyaA and cyaB, for adenylate cyclase are known in P. aeruginosa (Wolfgang et al., 2003), we found only cyaA in the genome of Pph1448A. Therefore, cyaA in Pta6605 was disrupted (Fig. 7A). To analyse the effect of the vfr or cyaA mutation on the cAMP level, we extracted cAMP from the KB liquid culture of each bacterium. The cyaA mutant almost completely abolished cAMP production, and its complemented strain partially restored it (Fig. 7B). This result confirms that CyaA plays a major role in cAMP biosynthesis in Pta6605. The concentration of cAMP in the vfr mutant was also reduced compared with the WT and complemented strain (Fig. 7B), although the microarray analysis detected no significant difference in the transcription level of cyaA (1.08‐fold expression, Table S1).

Figure 7.

Generation of cyaA mutant in Pseudomonas syringae pv. tabaci 6605 (Pta6605) and quantification of cyclic 3′,5′‐adenosine monophosphate (cAMP). (A) Schematic organization of the cyaA gene in Pseudomonas syringae pv. phaseolicola 1448A (Pph1448A) and construction of the cyaA mutant in the corresponding region of P ta6605. Locus IDs for Pph1448A are shown inside the respective arrows. Polymerase chain reaction (PCR) was carried out to isolate the cyaA‐containing DNA fragment using primers (cyaA‐F and cyaA‐R), as indicated by arrowheads; the internal region was then excised by digestion with AgeI and StuI. (B) Quantification of cAMP. Each strain was grown in KB liquid medium (2% proteose peptone No.3, 8.6 mM K₂HPO₄, 1.6 mM MgSO₄, 1% glycerol) for 24 h at 27 °C, and the cAMP levels were measured using a cAMP enzyme immunoassay (EIA) kit. The bars represent standard deviations for three independent experiments. Symbols indicate a significant difference from the wild‐type (WT) or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Phenotype of cyaA mutant

The phenotype of the cyaA mutant was compared with that of the vfr mutant; the cyaA mutant showed reduced virulence on its host tobacco plant (Fig. 8A), decreased surface swimming and swarming motilities (Fig. 8B), reduced amount of flagellin protein (Fig. 8C), decreased sensitivity to chloramphenicol, spectinomycin and cefotaxim (Fig. 8D), reduced ability to induce defence responses, such as HR cell death (Fig. 8E), and decreased callose deposition (Fig. 8F) in nonhost A. thaliana leaves. The complemented strain recovered well the ability to induce defence responses (Fig. 8E,F) and partially restored virulence (Fig. 8A), surface motilities (Fig. 8B) and flagellin production (Fig. 8C), but did not recover the sensitivity to antimicrobial compounds (Fig. 8D). Furthermore, there was no significant difference in the production of AHL and pilin between the cyaA mutant and WT strain, as found in the vfr mutant (data not shown). Thus, this study shows that the phenotypes of cyaA and vfr mutants resemble each other, suggesting that Vfr regulates the expression of virulence genes with a cAMP‐dependent mechanism in Pta6605.

Figure 8.

Phenotypes of the cyaA mutant. (A) Tobacco leaves were dip inoculated with each bacterial suspension [2 × 10⁸ colony‐forming units (cfu)/mL in 10 mm MgSO ₄] for 20 min at 23 °C. Photographs taken 11 days after inoculation show representative results obtained from three independent experiments. (B) Surface swimming motility at 23 °C (top panel) and surface swarming motility at 27 °C (bottom panel). Photographs show each plate after 48 h of incubation. Data shown in parentheses are the average of three independent replicates. (C) Immunoblot analysis of flagellin protein in whole‐cell lysates using anti‐flagellin antibody (top panels). The relative signal intensity in the wild‐type (WT) was set to ‘1’ (bottom panels). (D) Antibiotic tolerance. The diameter of the growth inhibition zone by chloramphenicol (Cm, 175 μg), spectinomycin (Spe, 250 μg) and cefotaxim (Cef, 250 μg) was measured after incubation for 24 h at 27 °C. The bars represent standard deviations for three independent experiments. Arabidopsis leaves were infiltrated with each bacterial strain at a density of 2 × 10⁸ cfu/mL, and cell death (E) and callose deposition (F) were observed 48 h after inoculation. The average number of callose deposits with standard deviation (SD) per 4‐mm² area from three independent experiments is shown in parentheses. Symbols indicate a significant difference from the WT or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Discussion

In this study, we investigated the role of Vfr, a member of the Crp family, in the virulence of the phytopathogenic bacterium Pta6605. Although Crp is the best‐known transcriptional activator and regulates the transcription of about 100 genes in E. coli (Fic et al., 2009), the role of Crp in phytopathogenic bacteria is not clear. The binding signal to cAMP might be transduced from the N‐terminal cAMP‐binding domain to the C‐terminal domain with a conserved helix‐turn‐helix motif for DNA binding. The substitutional analysis of Crp mutants at amino acid positions 83, 127 and 128 confirmed the importance of these residues in cAMP‐mediated Crp activation (Lee et al., 1994). Sequence analysis of the vfr gene in Pta6605 revealed that both the predicted cAMP‐ and DNA‐binding sites are conserved, although T132 in Pta6605 replaces serine in the Crp of E. coli (Fig. 1B). Very recently, Cordes et al. (2011) have reported the crystal structure of full‐length Vfr and an N‐terminal‐truncated Vfr‐Ndel7 in P. aeruginosa. They demonstrated that Vfr is a winged‐helix DNA‐binding protein and that the N‐terminal region of Vfr plays a unique role as a second ligand‐binding site. The residues E57–M61 and Q175–R185 in the helix‐turn‐helix motif form the secondary ligand‐binding pocket in Vfr, but these regions are not well conserved in Crp. The equivalent residues, R59 and R179, in Pta6605 are also conserved, suggesting that the N‐terminal region and helix‐turn‐helix motif might also be important for a second ligand‐binding site in Pta6605.

Lee et al. (1994) suggested that T128 in Crp in E. coli might have an ability to bind to a cyclic guanosine monophosphate (cGMP). Furthermore, a recent study on Clp in Xcc has demonstrated that E99 (corresponding to residue S83 in Crp and Vfr) is essential for binding with the cyclic di‐GMP (Tao et al., 2010). Cyclic di‐GMP is a ubiquitous second messenger synthesized by diguanylate cyclase, and plays many roles, such as the regulation of cell aggregation, motility, biofilm formation, extracellular protease production and quorum sensing, in a wide variety of bacteria (Hengge, 2009). Very recently, it has been reported that the putative diguanylate cyclase XCC2731 in Xcc is involved in full virulence and is regulated positively by Clp (Hsiao et al., 2011). As Pta6605 Vfr conserves S83 and T128, we could not rule out the possibility that Vfr in Pta6605 binds to cGMP or cyclic di‐GMP. Indeed, our microarray analysis revealed that the expression of a PSPPH0905 orthologue (putative diguanylate cyclase gene) was down‐regulated significantly in the vfr mutant (0.32‐fold expression, Table 1), although the role of this protein has not yet been elucidated.

Similar to the clp mutant in Xcc (Lee et al., 2003), the vfr mutant in Pta6605 showed lower flagella biogenesis and surface motilities (Fig. 3). Previously, we have revealed that surface swimming and swarming motilities require flagella and T4P (Shimizu et al., 2003; Taguchi and Ichinose, 2011). Because the vfr mutant retained the swimming motility in liquid medium at the same level as the WT strain, and slowly recovered surface swimming motility with longer incubation on 0.25% agar MMMF plates (Fig. S3, see Supporting Information), reduced surface motility of the vfr mutant might be a result of the reduced expression of T4P‐related genes (Table 1).

It has been reported that Vfr in P. aeruginosa negatively regulates the expression of the fleQ gene, which encodes the master flagellar transcriptional activator (Dasgupta et al., 2002), whereas the expression of the fleQ gene is not changed remarkably in microarray analysis (1.37‐fold expression) of WT and the vfr mutant in Pta6605. Although consensus sequences for the Vfr‐binding sites (AnWWTGnGAWnYAGWTCACAT and CGTCGATAGTCCTGACACTAGG) have been proposed by Kanack et al. (2006) and Fuchs et al. (2010), respectively, there are no identical sequences in the promoter regions of mexA, acsC, hrpA2, fliD and pilG in Pph1448A, a strain closely related to Pta6605.

The vfr mutant showed reduced HR‐inducing ability in nonhost Arabidopsis leaves and enhanced expression of mexAB/oprM genes (Figs 4 and 5). Previously, we have demonstrated a similar phenotype in T4P‐defective mutants: T4P‐defective mutants showed reduced surface motility, decreased expression of T3SS‐related genes, reduced HR, decreased virulence towards the host tobacco plant and enhanced expression of mexAB/oprM. Furthermore, T4P‐defective mutants showed reduced expression of vfr and cyaA (Taguchi and Ichinose, 2011). Together with the results obtained in this study, our observations indicate that Vfr plays a crucial role as a global regulator of T3SS‐mediated HR, virulence and MexAB/OprM‐mediated tolerance to antimicrobial compounds. He et al. (2007) conducted microarray analysis using the clp mutant in Xcc to identify Clp‐regulated genes, and found that the genes for extracellular enzymes, the biosynthesis of extracellular polysaccharide (EPS), multidrug resistance, flagellar biogenesis, Hrp system, iron uptake and protein metabolism are regulated by Clp. However, in contrast with our results, the expression of Hrp‐related genes is negatively regulated by Clp and the mexAB/oprM genes are down‐regulated in the clp mutant strain, suggesting that there are striking differences in the regulation of Clp in Xcc and Vfr in Pta6605.

Iron is one of the essential factors for bacterial growth, and effective iron uptake systems using a siderophore as a high‐affinity iron chelator have therefore developed in pathogenic bacteria. In Pta6605, the siderophore pyoverdine is an intrinsic virulence factor in host tobacco infection (Taguchi et al., 2010a). Our previous study demonstrated that a pvdL‐defective mutant in Pta6605, which is unable to produce pyoverdine chromophores, shows a reduced ability to produce tabtoxin, EPS and AHL, and exhibits significantly reduced virulence on host tobacco leaves (Taguchi et al., 2010a). Moreover, the AHL synthase‐defective mutant ΔpsyI shows reduced ability to produce the siderophore pyoverdine (Taguchi et al., 2006a). Our microarray results in this study indicated that the vfr mutant in Pta6605 showed reduced ability to acquire iron as a result of the lower biosynthesis of achromobactin, a second siderophore found in PsyB728a (Berti and Thomas, 2009). Because the amount of AHL produced by the vfr mutant was similar to that of the WT strain, the production of achromobactin must be regulated under Vfr, not under a quorum sensing system (Figs 6 and S1B). In E. chrysanthemi, not only the catechol‐type siderophore chrysobactin, but also achromobactin, is necessary for full virulence in plant infection (Franza et al., 2005). Erwinia chrysanthemi might acquire iron by achromobactin at an early stage in infection when growing as an epiphyte, and then shift to using chrysobactin after infection has been established. Thus, E. chrysanthemi uses each siderophore at a different stage of infection. In PsyB728a, it has also been shown that pyoverdine is not produced in the epiphytic growing stage in plants (Berti and Thomas, 2009). Taking these results together, we speculate that AHL and Vfr provide independent regulatory systems for the production of the different siderophores, pyoverdine and achromobactin, involved in iron uptake in Pta6605.

Fulcher et al. (2010) reported that the concentration of intracellular cAMP was reduced in the vfr, pilG and pilH mutants of P. aeruginosa, although the protein level of the adenylate cyclase, CyaB, was not affected. PilG and PilH are members of the Chp chemotaxis‐like chemosensory system, and are known to regulate pilus function via a two‐component signalling system. These results suggest that the Chp system regulates the cAMP level by modulating CyaB activity. In Pta6605, we found that the cAMP level in the vfr mutant decreased (Fig. 7B), but the expression of cyaA did not change (1.08‐fold expression, Table S1). Furthermore, our microarray analysis revealed that the expression levels of pilG and pilH were reduced (0.66‐ and 0.63‐fold expression, respectively, Table 1). Although the role of the Chp system in Pta6605 has not yet been clarified, Vfr might also be a positive regulator of the Chp system and control cAMP biosynthesis in Pta6605.

In this study, we have demonstrated that Vfr is a crucial global regulator for motility, flagellar biogenesis, multidrug resistance, iron uptake and T3SS using the quorum sensing‐independent mechanism in Pta6605. These results, together with those obtained using T4P‐defective mutants (Taguchi and Ichinose, 2011), show that there is a global regulatory system of cAMP, Vfr and T4P in this bacterium (Fig. 9). Vfr is required for virulence, T3SS, production of achromobactin and induction of defence responses, and suppresses MexAB/OprM‐mediated multidrug resistance. The T4P‐defective mutant shows decreased expression of vfr and cyaA, and similar phenotypes, except for biofilm formation, to the vfr and cyaA mutants (Taguchi and Ichinose, 2011), suggesting that biofilm formation requires T4P, but not Vfr and CyaA. These results may indicate that T4P regulates the function of Vfr and CyaA. However, Vfr might affect the function of T4P because the expression of T4P‐related genes is lower in the vfr mutant. On the other hand, the results using flagella‐mediated motility‐defective mutants, AHL production‐defective mutants and pyoverdine synthesis‐defective mutants demonstrated another crucial regulatory network of virulence controlled by AHL (Taguchi et al., 2006a, 2010a, 2010b). Therefore, Pta6605 might have evolved intricate regulatory networks for virulence through two different surface appendages, flagella and T4P. To confirm this, we plan to analyse the promoters of Vfr target genes in a future study.

Figure 9.

Schematic depiction of virulence factor regulator (Vfr)‐ or quorum sensing (QS)‐mediated regulatory network of virulence expression in Pseudomonas syringae pv. tabaci 6605 (P ta6605). Dotted arrows are not yet confirmed. AHL, acylhomoserine lactone; cAMP, cyclic 3′,5′‐adenosine monophosphate; EPS, extracellular polysaccharide; MDR, multidrug resistance; T3SS, type III secretion system; T4P, type IV pili.

Experimental Procedures

Bacterial strains and growth conditions

All bacterial strains used in this study are listed in Table 2. The Pta6605 strains were maintained as described by Taguchi et al. (2006b). The E. coli strains were grown at 37 °C in LB medium. Chromobacterium violaceum CV026 was grown at 30 °C in LB medium with a final concentration of 50 μg/mL kanamycin (McClean et al., 1997).

Table 2.

Bacterial strains and plasmids

Bacterial strain/plasmid	Relevant characteristics	Reference or source
Escherichia coli
DH5α	F– λ–ø80dLacZ ΔM15 Δ(lacZYA‐argF)U169 recA1endA1 hsdR17(rK–mK+) supE44 thi‐1 gyrA relA1	Takara, Kyoto, Japan
S17‐1	thi pro hsdR hsdR hsdM+recA(chr::RP4‐2‐Tc::Mu‐Km::Tn7)	Schäfer et al. (1994)
Chromobacterium violaceum
CV026	Double mini‐Tn5 mutant from C. violaceum ATCC31532, AHL biosensor	McClean et al. (1997)
Pseudomonas syringae pv. tabaci
Isolate 6605	Wild‐type isolated from tobacco, Nalr	Shimizu et al. (2003)
6605‐vfr	Isolate 6605 vfr, Nalr	This study
6605‐cyaA	Isolate 6605 cyaA, Nalr	This study
6605‐vfr (pBSL118 vfr)	Isolate 6605 vfr, Nalr (pBSL‐vfr)	This study
6605‐cyaA (pBSL118 cyaA)	Isolate 6605 cyaA, Nalr (pBSL‐cyaA)	This study
Plasmids
pGEM‐T Easy	Cloning vector, Ampr	Promega, Tokyo, Japan
pGEM‐vfr	vfr‐containing 1984‐bp DNA fragment in pGEM‐TEasy	This study
pCR‐BluntII‐TOPO	Cloning vector, Kmr	Invitrogen, Carlsbad, CA, USA
pCR‐BluntII‐TOPO‐cyaA	cyaA‐containing 3415‐bp DNA fragment in pCR‐BluntII‐TOPO	This study
pK18mobSacB	Small mobilizable vector, Kmr, sucrose sensitive (sacB)	Schäfer et al. (1994)
pK18‐vfr	Defective vfr‐containing DNA fragment in pK18mobSacB	This study
pK18‐cyaA	Defective cyaA‐containing DNA fragment in pK18mobSacB	This study
pBSL118	Mini‐Tn5 derived plasmid vector for insertion mutagenesis, Ampr, Kmr	Alexeyev et al. (1995)
pBSL‐vfr	vfr‐containing 1984‐bp DNA fragment in pBSL118	This study
pBSL‐cyaA	cyaA‐containing 3415‐bp DNA fragment in pBSL118	This study

Amp^r, ampicillin resistant; Km^r, kanamycin resistant; Nal^r, nalidixic acid resistant.

Plant materials, inoculation procedure and bacterial growth

Tobacco plants (Nicotiana tabacum L. cv. Xanthi NC) were grown at 25 °C with a 12‐h photoperiod. The dip inoculation of host tobacco leaves was performed as described previously (Taguchi and Ichinose, 2011). The inoculated leaves were incubated under conditions of 100% humidity for 1 day and 85% humidity for 11 subsequent days at 23 °C with an 18‐h photoperiod. For the determination of bacterial multiplication, five leaf discs (diameter, 8 mm) were punched from tobacco leaves and soaked for 20 min in a suspension of bacteria in 10 mm MgSO₄ with 0.02% Silwet at a density of 2 × 10⁸ colony‐forming units (cfu)/mL. The inoculated leaf discs were incubated on 3 MM paper (Whatman Plc, Brentford, UK) with a distilled water supply. The bacterial population from inoculated leaves was determined as described by Taguchi and Ichinose (2011).

Arabidopsis thaliana ecotype Columbia‐0 was grown at 22 °C with a 16‐h photoperiod. To detect HR induction and callose deposition, Arabidopsis leaves (three leaves for each strain) were infiltrated with bacterial suspension in 10 mm MgSO₄ without Silwet at a density of 2 × 10⁸ cfu/mL.

Construction of mutant and its complemented strain

To generate the vfr‐defective mutant, the genetic region including vfr was isolated by a pGEM‐T‐Easy vector cloning system (Promega, Madison, WI, USA) using a set of PCR primers (vfr‐F and vfr‐R, Table 3) that were designed on the basis of the registered sequence of the vfr gene of Pph1448A (accession number, NC_005773, Fig. 1). For the construction of the cyaA‐defective mutant, the genetic region including cyaA was cloned in a pCR‐BluntII‐TOPO vector (Invitrogen, Carlsbad, CA, USA) using a set of PCR primers (cyaA‐F and cyaA‐R). The recombinant plasmids obtained were digested with NarI and BsmFI to delete the internal 53‐bp region for the generation of the vfr mutant plasmid, and with StuI and AgeI to delete the internal 1071‐bp region of the cyaA mutant plasmid. After digestion, purified DNA was treated with DNA polymerase (Pyrobest DNA polymerase; Takara, Kyoto, Japan) to generate blunt ends, and then self‐ligated by a T4 DNA ligase (Ligation‐Convenience Kit, Nippon Gene, Tokyo, Japan). Each mutated genetic region was introduced into a pK18mobsacB plasmid via an EcoRI site (Schäfer et al., 1994). Deletion mutant strains were obtained by conjugation and homologous recombination according to the methods reported previously (Taguchi et al., 2006b). To confirm whether the changed phenotype originated in the corresponding mutation, each vfr or cyaA mutant strain was complemented using the PCR product described above, because the predicted promoter and entire open reading frame were contained in this region. The resultant plasmid was ligated with pBSL118, a transposon vector (Alexeyev et al., 1995), at the ApaI site to generate pBSL‐vfr and at the EcoRI site to generate pBSL‐cyaA, and was introduced into the respective mutant by conjugation using the E. coli S17‐l λpir strain to generate the complemented strains vfr‐C and cyaA‐C. The primers used in this study are listed in Table 3. The DNA sequences of the isolated clone and deletion mutants were determined (ABI PRISM 310, Applied Biosystems, Chiba, Japan) using a BIG Dye terminator cycle sequencing kit.

Table 3.

Primer sequences used in this study

Primer name	Sequence (5'–3’)
vfr‐F	TGCAAGACTCGATCATCGAC
vfr‐R	CATAATCGTGAGTGATCTCC
cyaA‐F	TTATCTGACCAGCCTCGGGC
cyaA‐R	CAATGGGCTCGGCGTTGCTG
rpoD‐F	GATCGTCTCGATCATGTGCA
rpoD‐R	ATTGGTCGTCTGCAGCCTGA
proC‐F	GAGGCCACGCAATTTCAGTC
proC‐R	GATCAAGGGCGCAGATGTCG
hrpK‐F	AGCATCGTGAATCAACCCAC
hrpK‐R1	CTGCGAGTCAGCAGACTCAT
acsA‐F	ATGAACTTCACTTCACTCGC
acsA‐R	CCCTTTCATGAACTCTTCC
acsC‐F	GCTGAAACGCAACACCGTTT
acsC‐R	CTCAACGCCAGATGCAAATC
hrpA‐F	TGAGTTCTCTGACTAACGCG
hrpA‐R	GAAATCAGAACTGGACGACC
mexA‐F	TTGAGACAACAGGCTCCTGC
mexA‐R	GTCCACGTAGATTGGGTCGA
oprM‐F	GTCCACGTAGATTGGGTCGA
oprM‐R	GAAACACCGACTTCATTGCT

Motility assay

Motility experiments were performed as described previously (Taguchi et al., 2006b, 2010b). The surface swimming motility was observed in 0.25% agar MMMF plates after 48, 72 and 96 h of incubation at 23 °C, whereas the surface swarming motility was assessed in 0.45% agar SWM plates after 48 h of incubation at 27 °C. For the quantification of motilities, the diameters of the swimming and swarming areas were measured after inoculation for 48 h.

CAS assay

The siderophore production in each bacterial culture supernatant was determined by the methods of Schwyn and Neilands (1987), as described previously (Taguchi et al., 2006a).

Pyoverdine measurement

The concentration of pyoverdine was estimated spectrophotometrically as the absorbance at 405 nm using the supernatant of the MMMF culture medium of each strain after incubation for 24 h at 25 °C.

Preparation of pilus‐containing surface fraction

Pili were partially purified as described previously (Taguchi and Ichinose, 2011) with a minor modification. Each bacterium was grown on KB plates for 72 h at 27 °C. Cells were scraped off, resuspended in 50 mm sodium phosphate buffer (pH 7.0) and adjusted to an optical density at 600 nm (OD₆₀₀) of 1.0. Pili were sheared off the cells by stirring for 30 min, and the cells were removed by centrifugation at 10 000 g for 20 min. After filtration of the supernatant through a 0.45‐μm pore filter, polyethylene glycol (PEG6000) and NaCl were added to final concentrations of 4% and 0.5 m, respectively. Pili‐containing fractions were obtained as pellets by centrifugation at 100 000 g for 30 min, and were resolved in 500 μL of water.

Tolerance to antibiotics

Antibiotic tolerance was assessed using paper discs (3 MM paper) containing 10 μL of chloramphenicol (17.5 μg/μL), spectinomycin (25 μg/μL), cefotaxim (25 μg/μL) and crystal violet (0.5%), as described previously (Taguchi et al., 2006a).

Biofilm formation

The detection of biofilms was performed as described previously (Taguchi and Ichinose, 2011).

RNA preparation, microarray analysis and real‐time qRT‐PCR

Each bacterial strain was grown in LB medium with 10 mm MgCl₂ at 27 °C to an OD₆₀₀ of 0.3. After centrifugation, the cells were further incubated in MMMF medium for 1 h. Total RNA was then extracted using a High Pure RNA Isolation kit (Roche, Mannheim, Germany) according to the manufacturer's instructions. Total RNA (20 μg) was used for microarray analysis employing a Roche NimbleGen microarray system, as described previously (Taguchi and Ichinose, 2011).

For real‐time qRT‐PCR, 2 μg of total RNA were used to synthesize cDNA with AMV RTase in a total of 50 μL of reaction mixture, according to the manufacturer's instructions (Takara). Specific primer sets for mexA, oprM, hrpA, hrpK, acsC and acsA were designed on the basis of the sequence of Pph1448A. Real‐time qRT‐PCR was carried out using a Rotor‐Gene 300™ (Corbett Research, Sydney, Australia) and SYBR premix Ex Taq™ (Takara), with primers at a final concentration of 0.2 μm each and 1 μL of cDNA product as a template in a 25‐μL reaction mixture. PCR was performed with one denaturation cycle of 20 s at 95 °C and 45 cycles of 15 s at 55 °C, 15 s at 72 °C and 30 s at 95 °C. The expression of each gene was normalized by rpoD and proC, which encode RNA polymerase sigma factor and pyrroline‐5‐carboxylate reductase, respectively, as housekeeping genes (Kanda et al., 2011; Savli et al., 2003). Melting curve analysis confirmed that each PCR was a single product. The PCRs were performed with a high linearity. The E value as primer efficiency was calculated from the slope of each standard curve equation [E = 10(–1/slope) – 1] (Michán and Pueyo, 2009). Each primer pair showed optimal primer efficiency (data not shown). The data were analysed using the ΔΔC _T (cycle threshold) method.

Detection of AHLs

The extraction of AHLs and their detection using C. violaceum CV026 were performed as described previously (Taguchi et al., 2010b).

Detection of cell death and callose deposition assay

Cell death and callose deposition were detected by lactophenol trypan blue and aniline blue staining, respectively, as described previously (Naito et al., 2007; Taguchi and Ichinose, 2011). For quantitative analysis, the number of callose deposits per 4‐mm² area was counted, and its average was calculated.

Immunoblot analysis

Immunoblot analysis was carried out as described previously (Taguchi et al., 2006b). For the detection of flagellin protein in whole‐cell lysates, an overnight culture of each bacterium (equivalent to 100 μL of bacterial culture) in LB with 10 mm MgCl₂ at 27 °C was centrifuged. For the preparation of total protein, the bacterial suspensions cultured overnight in MMMF medium were precipitated by the addition of one‐fifth volume of 10% trichloroacetic acid and dissolved in a sample buffer. After separation on 12.5% sodium dodecylsulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE) gel, proteins were transferred to a poly(vinylidene difluoride) (PVDF) membrane (Amersham Pharmacia Biotech, Buckinghamshire, UK), and immunoblot analysis was carried out using a rabbit polyclonal anti‐flagellin‐specific antibody with a goat anti‐rabbit secondary antibody conjugated with alkaline phosphatase (Bio‐Rad, Hercules, CA, USA), and an alkaline phosphatase‐based chemiluminescent detection system (CDP‐Star Reagent, NEB, Ipswich, MA, USA), according to the manufacturer's instructions. The signal intensity from the gel image by immunoblot analysis was quantified using ImageJ 1.45 software (National Institutes of Health, Bethesda, MD, USA).

For the detection of pilin protein, immunoblot analysis was performed using a rabbit polyclonal anti‐PilA‐specific peptide antibody (peptide sequence: VAENYSNGSTQADVC), according to the method reported previously (Taguchi and Ichinose, 2011).

cAMP assay

Each bacterial strain was grown in KB liquid medium for 24 h, and the concentration was adjusted to a density of 6 × 10⁸ cfu/mL with 1 mL of PBS (137 mm NaCl, 8.1 mm Na₂HPO₄, 2.68 mm KCl, 1.47 mm KH₂PO₄, pH 7.4). Each bacterial solution was frozen at −80 °C, and then thawed at room temperature and sonicated for 5 min on ice. After centrifugation at 15 000 g for 5 min, 50 μL of supernatant were used to measure cAMP, according to the manufacturer's instructions (Cyclic AMP EIA Kit, Cayman Chemical Co., Ann Arbor, MI, USA).

Statistical analysis

The results of bacterial populations in host tobacco leaves, motilities, flagellin proteins detected by Western blot, growth inhibition assay, real‐time qRT‐PCR, callose deposition assay, CAS assay and cAMP assay are expressed as the mean with standard deviation (SD). One‐way analysis of variance (ANOVA) and Tukey's honestly significant difference (HSD) test were performed using KaleidaGraph version 4.02 (Synergy Software, Reading, PA, USA) for comparison between the quantitative measurements of the WT, mutant and complemented strains. P < 0.01 was considered to be statistically significant.

Nucleotide sequence accession numbers

The nucleotide sequences of the vfr and cyaA genes have been deposited in the DDBJ, EMBL and GenBank nucleotide sequence databases under the accession numbers AB674327 and AB733003, respectively.

Supporting information

Fig. S1 Detection of pilin protein and acylhomoserine lactones (AHLs) and biofilm formation in wild‐type (WT), vfr mutant and complemented strain. (A) Pilus‐containing surface fractions were analysed using an anti‐pilin‐specific antibody. (B) AHLs, as N‐hexanoyl‐l‐homoserine lactone (HHL) and N‐(3‐oxohexanoyl)‐l‐homoserine lactone (OHHL), were visualized using violacein production by Chromobacterium violaceum CV026. (C) Biofilm production. Each bacterium was grown in Luria–Bertani (LB) medium with 10 mm MgCl₂, transferred to fresh MMMF medium [50 mM potassium phosphate buffer, 7.6 mM (NH₄)₂SO₄, 1.7 mM MgCl₂ and 1.7 mM NaCl, pH 5.7, supplemented with 10 mM each of mannitol and fructose] and incubated for 48 h at 25 °C without agitation. Adherent bacteria were stained with 0.5% crystal violet, and washed with water. All photographs show representative results obtained from two or three independent experiments.

Fig. S2 Real‐time quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) analysis of hrpA, hrpK, acsA, acsC, mexA and oprM gene expression in the wild‐type (WT), vfr mutant and complemented strains. The expression level of each gene was normalized to that of the proC gene, and the relative value of WT expression was set to ‘1’ as a control. Data are representative results obtained from three independent experiments. Symbols indicate a significant difference from the WT or complemented strain (vs. WT, *P < 0.01; vs. complemented strain, †P < 0.01).

Fig. S3 Surface swimming motility on a 0.25% agar plate of MMMF medium [50 mM potassium phosphate buffer, 7.6 mM (NH₄)₂SO₄, 1.7 mM MgCl₂ and 1.7 mM NaCl, pH 5.7, supplemented with 10 mM each of mannitol and fructose] at 23 °C of wild‐type (WT), vfr mutant and complemented strain. Photographs show each plate after 72 and 96 h of incubation.

Table S1 Gene expression profiles of vfr mutant strain compared with the wild‐type (WT) strain by microarray analysis.