Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jul 1.
Published in final edited form as: Mol Cell Neurosci. 2019 Jun 15;98:121–130. doi: 10.1016/j.mcn.2019.06.007

A novel bungarotoxin binding site-tagged construct reveals MAPK-dependent Kv4.2 trafficking

G Travis Tabor 1,3,5, Jung M Park 1,4,5, Jonathan G Murphy 1,2, Jia-Hua Hu 1,*, Dax A Hoffman 1,*
PMCID: PMC6639039  NIHMSID: NIHMS1533056  PMID: 31212013

Abstract

Kv4.2 voltage-gated K+ channel subunits, the primary source of the somatodendritic A-type K+ current in CA1 pyramidal neurons of the hippocampus, play important roles in regulating dendritic excitability and plasticity. To better study the trafficking and subcellular distribution of Kv4.2, we created and characterized a novel Kv4.2 construct encoding a bungarotoxin binding site in the extracellular S3-S4 linker region of the α-subunit. When expressed, this construct can be visualized in living cells after staining with rhodamine-conjugated bungarotoxin. We validated the utility of this construct by visualizing the spontaneous internalization and insertion of Kv4.2 in HEK 293T cells. We further report that Kv4.2 colocalized with several endosome markers in HEK 293T cells. In addition, Kv4.2 internalization is significantly impaired by mitogen-activated protein kinase (MAPK) inhibitors in transfected primary hippocampal neurons. Therefore, this newly developed BBS-Kv4.2 construct provides a novel and powerful tool for studying surface Kv4.2 channel localization and trafficking.

Keywords: Kv4.2, DPP6, KChIP, MAPK, bungarotoxin binding site, ion channel trafficking

1. Introduction

Neuronal dendrites are post-synaptic sites of information processing, where thousands of excitatory and inhibitory inputs are integrated to provide a final output. Excitable dendrites express voltage-gated channels that allow for synaptic boosting or attenuation as well as dendritic spike initiation and propagation (Johnston et al., 2000). The summed activities of these ion channels shape the dendritic response to synaptic stimulation which governs both the ultimate firing pattern of the neuron and can mediate long term changes in synaptic strength (synaptic plasticity). One of these ion channels, the voltage-gated potassium channel Kv4.2 (encoded by the KCND2 gene), is highly expressed in hippocampal CA1 pyramidal neuron dendrites. There, it has been shown to play important roles in regulating dendritic excitability to influence synaptic integration and plasticity (Kim and Hoffman, 2008). Aberrant dendritic excitability associated with deficits in Kv4.2 has been implicated in a number of neuronal diseases. In rodent models of temporal lobe epilepsy, increased excitability of CA1 pyramidal neuron dendrites occurs after decreased Kv4.2 availability via transcriptional and posttranslational mechanisms (Bernard et al., 2004; Monaghan et al., 2008). Epileptic events in a common mouse model of Alzheimer disease result in decreased Kv4.2 expression and associated dendritic hyperexcitability (Hall et al., 2015). More recently, a de novo mutation in the KCND2 gene has been identified in human patients with intractable, infant-onset epilepsy and autism (Lin et al., 2018) and altered translation of Kv4.2 is observed in a mouse model of fragile X syndrome (Gross et al., 2011).

The physiological importance of Kv4.2 in normal neuronal function and disease calls for detailed examination of the molecular constituents and pathways involved in channel regulation and trafficking (Shah et al., 2010). One attractive method for studying the trafficking of surface-expressed Kv4.2 is fluorescence microscopy. There are several publications demonstrating the use of Kv4.2 antibodies and/or tagged constructs to visualize surface-expressed Kv4.2 (Gross et al., 2016; Kim et al., 2007; Moise et al., 2010; Prechtel et al., 2018; Rivera et al., 2003). However, these tools have proven unreliable in our experience or have limitations for live imaging and fixed staining conditions. In our hands, an extracellular epitope-targeting antibody of Kv4.2 (Gross et al., 2016) was not able to effectively stain surface Kv4.2 (Figure S1). In addition, we could not sufficiently stain an exofacial bungarotoxin binding site (BBS) within the S1-S2 loop of Kv4.2 (Moise et al., 2010) in live cells (Figure S2, Figure 2C). Finally, myc- (Rivera et al., 2003) and HA-tagged (Prechtel et al., 2018) constructs have not yet been optimized and verified for live imaging studies. Therefore, despite reports of extant tools, reliable and rigorously validated methods for the detection of functional Kv4.2 channels are needed.

Figure 2.

Figure 2.

Open in a new tab

Auxiliary subunits regulate BBS-Kv4.2 surface expression in HEK 293T cells. (A) Auxiliary subunits were shown to increase BBS-Kv4.2 membrane expression in HEK 293T cells via western blot analysis. Cells transfected with BBS-Kv4.2 alone or together with DPP6 or KChIP2 were processed for surface biotinylation. (B) Surface labeling experiments show that auxiliary subunits facilitate BBS-Kv4.2 membrane localization in HEK 293T cells. Cells transfected with BBS-Kv4.2 alone or together with DPP6 and KChIP2 were incubated with RhBTX at 17°C for 30 min. Cells were fixed, permeabilized and stained with anti-Myc antibody. Co-transfection with DPP6 and KChIP2 increased surface BBS-Kv4.2 expression. Scale bar: 10 μm. (C) Graphical representation of (B) and Figure S2. The surface stain intensity of S3-S4 BBS-Kv4.2 (BBS-Kv4.2–285) is significantly higher than that of S1-S2 BBS-Kv4.2 (BBS-Kv4.2–220). n = 15 cells for each group. ***p < 0.001 vs alone, #p < 0.05, ###p < 0.001 vs BBS-Kv4.2–220. (D) KChIP2 and DPP6 auxiliary subunits increase Kv4.2 and BBS-Kv4.2 current density. Left, Kv4.2 and BBS-Kv4.2 current traces. Vertical and horizontal scale bars correspond to 100 pA/pF and 100 ms respectively. Right, current density for each construct co-expressed with DPP6 or KChIP2. BBS-Kv4.2 alone exhibits a decreased current density compared to that of Kv4.2 but the current densities of both constructs are similarly increased by auxiliary subunits.

BBS tags are particularly attractive because they are small (13 amino acids) and demonstrate high affinity binding to bungarotoxin (IC50 of 10−9 molar) (Harel et al., 2001). When the BBS is inserted properly, bungarotoxin (BTX) binding does not affect channel function which makes this strategy a powerful tool for live imaging studies. However, after much optimization and testing of a variety of BBS insert locations in the extracellular S1-S2 loop of Kv4.2, we were unable to find a construct that could be consistently stained above background levels when overexpressed in HEK 293T cells. Therefore, we tested Kv4.2 constructs with BBS inserts in the extracellular S3-S4 linker region even though this could prove problematic as it is closer the voltage sensor. We present here a tagged Kv4.2 construct (BBS-Kv4.2) that can be stained in living cells and visualized after fixation. Critically, BBS-Kv4.2 demonstrates biophysical properties and auxiliary subunit-regulated trafficking similar to wildtype (WT) Kv4.2. We validated the utility of this construct by visualizing the spontaneous internalization and insertion of BBS-Kv4.2 in HEK 293T cells. In addition, we showed that internalized Kv4.2 colocalizes with several endosome markers which provides insight into the routes of Kv4.2 recycling and degradation. Interestingly, in surface labeling experiments, BBS-Kv4.2 internalization is significantly impaired by mitogen-activated protein kinase (MAPK) inhibitors in HEK 293T cells and cultured hippocampal neurons. Therefore, this BBS-Kv4.2 construct provides a novel method for studying Kv4.2 trafficking and serves as a template for tagging other ion channels.

2. Materials and methods

2.1. Constructs

The HAP1 bungarotoxin binding site (BBS), flanked by two glycine residues (GG-WRYYESSLLPYPD-GG), was inserted into various locations in the extracellular S1-S2 and S3-S4 linker regions of an existing pCMV6-hKv4.2-myc-DDK (FLAG) construct (Origene, RC215266) using the QuikChange Lightning Site Directed Mutagenesis Kit. During our initial search for a useful BBS-tagged Kv4.2 construct, we created many variants containing BBS insertions with and without flanking glycine residues in several sites within the S1-S2 and S3-S4 linker regions. Only the sequences of the primers used to create the constructs described in this manuscript are included as follows: hKv4.2-BBS-220: Forward: 5’-GCCCAGGTCACATTAAAGAACTGGGGGGGTGGAGATACTACGAGAGCTCCCTGCTG CCCTACCCTGACGGGGGGCCCTGTGGAGAGCGG-3’, Reverse: 5’-CCGCTCTCCACAGGGCCCCCCGTCAGGGTAGGGCAGCAGGGAGCTCTCGTAGTATCTCCACCCCCCCAGTTCTTTAATGTGACCTGGGC-3’; hKv4.2-BBS-285: Forward: 5’-GACAGACAATGAGGACGGCGGCTGGAGGTACTACGAGAGCAGCCTGCTGCCCTACCCCGACGGCGGCGTCAGCGGAGCCTTTG-3’, Reverse: 5’-CAAAGGCTCCGCTGACGCCGCCGTCGGGGTAGGGCAGCAGGCTGCTCTCGTAGTACCTCCAGCCGCCGTCCTCATTGTCTGTC-3’. Other constructs used in this paper are mKChIP2a (Origene MC211934), GFP-Rab5B (Addgene #61802), GFP-Rab7A (Addgene #61803), GFP-Rab11 (Addgene #12674), LAMP1-mGFP (Addgene #34831); rDPP6 (untagged) and Kv4.2-CT-GFP were used before in our lab (Kim et al., 2007; Lin et al., 2014); mKChIP2c (untagged; a generous gift of Henry Jerng and Karl Pfaffinger) has been characterized previously in the lab (Murphy and Hoffman, 2019). All constructs were verified by sequencing.

2.2. Antibodies

Kv4.2 (K57/1): Neuromab 75–016, 1:100 for staining, 1:2000 for western blot; Myc: Millipore, 05–419, 1:500 for staining, 1:5000 for western blot; DPP6: Abcam, ab41811, 1:1000 for western blot; KChIP2: pan KChIP, Neuromab, 75–006, 1:1000 for western blot; Actin: Sigma, A-1978, 1:10000 for western blot; Alexa Fluor 488 goat anti-mouse: Invitrogen, A-11029, 1:500; Alexa Fluor 680 goat anti-mouse: Invitrogen, A-21057, 1:10000; Alexa Fluor 680 goat anti-rabbit: Invitrogen, A-21076, 1:10000.

2.3. Cell line culture and transfection

HEK 293T cells for imaging and biochemistry experiments were obtained from Dr. Paul Worley’s lab (Hu et al., 2012). HEK 293FT cells (ThermoFisher; R70007) were used for electrophysiology experiments. HEK cell lines were cultured in DMEM medium with 10% FBS. Transfections were performed with X-tremeGENE 9 according to the manufacturer’s specifications. Plasmid quantities used for transfections: Kv4.2: 1.5 μg, DPP6: 0.5 μg, KChIP2: 0.5 μg. Cells were harvested approximately 40 h after transfection.

2.4. Primary hippocampal neuron culture and transfection

Neuronal hippocampal cultures from embryonic day 18 rat embryos were prepared as reported previously (Hu et al., 2010). 3 × 105 neurons were added to each well of a 12–well plate (Corning) containing cover slips coated with poly–L–lysine. Growth media consisted of Neurobasal medium (Invitrogen) supplemented with 5% FBS (Hyclone), 2% B27, 1% Glutamine (Invitrogen), 100 U/mL penicillin, and 100U/mL streptomycin (Invitrogen). Neurons were fed twice per week with glial conditioned growth media. Neurons were transfected at DIV9–10 using Lipofectamine 2000 reagent and the following DNA masses: Kv4.2: 3.5 μg, DPP6: 1 μg, KChIP2: 1 μg. Cells were harvested 20–24 h after transfection.

2.5. Bungarotoxin (BTX) labeling of HEK 293T Cells.

Living cells transfected with BBS-tagged constructs were labeled with 2 μg/ml rhodamine-conjugated bungarotoxin (Rh-BTX, Molecular Probes, T1175) in culture medium at 17°C for 30 min, washed with PBS on ice to eliminate free Rh-BTX, fixed with 4% PFA, and permeabilized with 0.2% Triton X-100 in PBS. Cells were then incubated with mouse anti-Myc antibody for 2 h at RT to label total Kv4.2. After washing, cells were incubated with anti-mouse-488 secondary antibody at RT for 1 h. Cells were then mounted on slides with anti-fade mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, P36962) and imaged using a Zeiss 710 laser scanning confocal microscope equipped with a 63x objective. The images were collected using ZEN analysis software (Zeiss) and analyzed with ImageJ (NIH) analysis software.

To observe the internalization of BBS-Kv4.2, live cells were first incubated with Rh-BTX at 17°C for 30 min to allow BBS labeling while limiting channel trafficking. The cells were then washed to eliminate free Rh-BTX and incubated at 37°C for various times. Control cells were incubated at 0°C after BTX-labeling to limit trafficking. To observe BBS-Kv4.2 insertion into the plasma membrane, live cells were first incubated with unlabeled BTX (Molecular probes, B1601, 10 μg/ml) at 17°C for 30 min to block all preexisting surface channels, and the cells were then washed and incubated with Rh-BTX (2 μg/ml) at 37°C for the indicated times. Incubation with Rh-BTX at 0°C for 30 min served as the control. The images were collected using ZEN analysis software (Zeiss) and analyzed with ImageJ (NIH) analysis software.

To observe the colocalization of BBS-Kv4.2 with endosome markers, transfected live cells were incubated with Rh-BTX at 37°C for 1.5 h. The cells were then washed to eliminate free Rh-BTX, fixed with 4% PFA, and permeabilized with 0.2% Triton X-100 in PBS. Cells were then incubated with mouse anti-GFP-488 antibody for 1 h at RT to enhance GFP signal. The images were collected using ZEN analysis software (Zeiss). Line scan analysis was analyzed with ImageJ (NIH) analysis software and colocalization correction was analyzed with ZEN analysis software (Zeiss).

2.6. BTX labeling of primary cultured neurons.

The transfected neurons were preincubated with the nicotinic receptor antagonist tubocurarine (Sigma, T2379, 2 μM) for 20 min at RT to block binding of BTX to the endogenous nicotinic receptors. The neurons were then incubated with 2 μg/ml Rh-BTX for 30 min at 17°C to label BBS-Kv4.2. Cells were incubated with vehicle, UO126 (Tocris, 1144), SB203580 (Tocris, 1202), or both inhibitors at 17°C for 5 min before incubating at 37°C for 15 min to allow internalization of the channel. Cells were then fixed, permeabilized, and incubated with mouse anti-Myc antibody at RT for 2 h to label total Kv4.2. After washing, cells were incubated with anti-mouse-488 secondary antibody at RT for 1 h. Cells were then mounted on slides with anti-fade mounting medium containing DAPI and imaged using a Zeiss 710 laser scanning confocal microscope equipped with a 63x objective. Confocal images were collected using ZEN analysis software and analyzed with ImageJ (NIH) analysis software.

2.7. Surface biotinylation

HEK 293T cells (3.5 × 105 cells per well) were plated into Corning 6-well dishes that had been coated with 1 ml of 0.5 mg/ml poly-L-ornithine (Sigma, P3655) in 0.1 M Trizma pH 8.5 (Sigma T1194) for approximately 4 h and then washed three times with 2 ml PBS immediately before use. For the traditional surface biotinylation assay, transfected cells were cooled on ice, washed twice with ice-cold PBS++ (PBS, 1 mM CaCl2, 0.5 mM MgCl2) and then incubated with PBS++ containing 1 mg/ml sulfo-NHS-SS-biotin (Pierce, 21331) for 30 min at 4 °C. Unreacted biotin was quenched by washing cells three times with PBS++ containing 100 mM glycine (pH 7.4) (briefly once and for 5 min twice). For the internalization assay, transfected cells were incubated with BTX-biotin (Molecular Probes, B1196) at 17°C for 30 min to label surface BBS-Kv4.2. After washing away free BTX-biotin, cells were incubated at 37°C for various times. For the insertion assay, transfected cells were first incubated with unlabeled BTX (10 μg/ml) at 17°C for 30 min. After washing, they were incubated with BTX-biotin at 37°C for various times to label inserted surface BBS-Kv4.2. Labeled cells were cooled on ice, washed twice with ice-cold PBS++. Unreacted biotin was quenched by washing cells three times with PBS++ containing 100 mM glycine (pH 7.4) (briefly once and twice for 5 min). Cultures were harvested in RIPA buffer (1% Triton X-100, 1% deoxycholate, 0.1% SDS in PBS, pH 7.4) and sonicated. Homogenates were centrifuged at 13,200 r.p.m. (16,100 g) for 20 min at 4°C. Fifteen percent of the supernatant was saved as the total protein. The remaining 85% of the homogenate was rotated with streptavidin beads (Pierce, 20347) for 2 h. Precipitates were washed with RIPA buffer three times (5 min each time). All procedures were performed at 4°C.

2.8. Western blotting

Samples were diluted with 2X SDS sample buffer and separated electrophoretically using NuPAGE 4–12% Bis-Tris gels (Invitrogen) and transferred to an Immobilon-P PVDF membrane (Millipore). The membrane was blocked with blocking buffer for 1 h at room temperature, followed by incubation with primary antibody in PBS overnight at 4°C. The membrane was then washed with PBST (PBS, pH 7.4, and 0.1% Tween-20) three times and incubated with secondary antibody in PBS for another hour. After three washes with PBS, the membrane was scanned using an Odyssey imaging system (LI-COR) according to the manufacturer’s protocol.

2.9. Electrophysiology

HEK 293FT cells were seeded onto 30 mm cell culture dishes at a concentration of 500 × 106 cells per dish in DMEM supplemented with 10% fetal bovine serum and 2% penicillin/streptomycin (ThermoFisher). After 16–24 h, cell culture dishes were transfected with human Kv4.2 (1 μg) or BBS-Kv4.2 (3 μg) and YFP (0.5 μg) plasmids. To each dish, DNA was first mixed with 300 μl Opti-MEM I (Invitrogen) reduced serum medium. Next, 6 μl X-tremeGENE 9 (Sigma) lipofection reagent was added and this mixture was incubated for 10 min at room temperature before dropwise addition to cultures. On the day of recording (24–48 h after transfection), transfected cultures were trypsinized for 2 min, seeded at low density onto glass coverslips, and allowed to adhere ≥ 1 h. Coverslips were then transferred to a recording chamber and superfused (2–3 ml min−1) in 95% O2, 5% CO2 saturated extracellular solution (in mM: 115 NaCl, 2.5 KCl,1.25 NaH2PO4, 25 NaHCO3, 2 CaCl2, 1 MgCl2, 25 glucose, pH 7.2–7.3; 300 mOsm/l) at 22–24°C. The patch electrodes were filled with (in mM): 115 KCl, 10 NaCl, 20 KOH, 10 Hepes, 10 EGTA, and 25 glucose (pH 7.3, 290 mOsm). Peak voltage-gated K+ currents were elicited by voltage steps from a holding potential (−70 mV) to −120mV for 400 ms to relieve channel inactivation and to +60 mV for 400 ms to achieve channel activation. Inactivation rates were measured by fitting the falling phase of macroscopic currents with a double exponential decay. Voltage dependence of activation (VDA) was performed using the same holding and hyperpolarizing steps as above but with a range of intermediate activation potentials (−100, −80, −60, −40, −30, −20, −10, 0, +10, +20, +30, +40, and +60 mV). Peak K+ current at each voltage step was normalized to the maximum at +60 mV and plotted against test potential. V1/2 of VDA was measured by fitting a Boltzman curve to the data points. Steady state inactivation (SSI) was performed using 400 ms conditioning steps from the holding potential to −140, −130, −120, −100, −80, −60, −40, −20, −10, and 0 mV immediately before a 400 ms step to the peak of current activation at +60 mV. Peak K+ current at each voltage step was normalized to the maximum at +60 mV and plotted against test potential. V1/2 of SSI was measured by fitting a Boltzman curve to the data points. Recovery from inactivation (RFI) was measured using two 400 ms voltage steps to +60mV from the holding potential separated by increasing time intervals (5, 10, 15, 20, 25, 50, 100, 200, and 500 ms). The peak K+ current at each interval was divided by the maximal current to yield a recovery ratio that was plotted against the interval duration. Time constants of recovery from inactivation were measured by fitting a single exponential curve to the recovery data points. Electrophysiological recordings were obtained using a Multiclamp 700B amplifier and PClamp 10 (Molecular, Devices, Sunnyvale, CA). Currents were normalized to cell size using whole cell capacitance upon cell break-in, liquid junction potential error was corrected online (−6.5 mV in the pipette), and leak currents were subtracted using a P/4 protocol. Data were analyzed using Microsoft Excel, GraphPad Prism 6 and IGOR Pro (WaveMetrics, Lake Oswego, OR). Pooled data are presented as either bar graphs ± SEM overlaid with individual data points or in tabular format ± SEM.

2.10. Statistical analysis

Biochemistry and cell biology data were analyzed by two-tailed Student’s t-test or one-way ANOVA followed by Tukey post-hoc testing using Origin 2018b. Electrophysiology results were analyzed with unpaired Student’s t-test by GraphPad Prism 6 and IGOR Pro. Values are presented as means ± SEM.

3. Results

3.1. Generation of a novel BBS-tagged Kv4.2 construct for live staining in HEK 293T cells

Previous strategies for studying the trafficking of surface-expressed Kv4.2 have relied on either an extracellular epitope-targeting antibody or tags such as Myc, HA, or a bungarotoxin binding site (BBS) inserted into the first extracellular loop of Kv4.2 (Gross et al., 2016; Moise et al., 2010; Prechtel et al., 2018; Rivera et al., 2003). However, these constructs often require large, repeated inserts that may affect protein folding and physiological properties (Maue, 2007), or they are nor appropriately labeled in HEK 293T cells and/or cultured neurons. An antibody targeting an extracellular Kv4.2 epitope (K57/1, Neuromab) effectively detected total Kv4.2 expression in permeabilized cells but inadequately stained Kv4.2 at the membrane of non-permeabilized cells (Figure S1). A BBS tag inserted in the Kv4.2 S1-S2 loop as previously described (Moise et al., 2010) showed only weak surface staining even when Kv4.2 was co-transfected with the auxiliary subunits DPP6 or KChIP2a, which are known to enhance Kv4.2 surface expression (Figure S2) (Amarillo et al., 2008; Jerng et al., 2005). In an attempt to improve surface labeling, we inserted BBS into a number of novel locations in the first and second extracellular loops of a previous Kv4.2 construct containing additional C-terminal myc and DDK (FLAG) tags. Of those putative constructs, we found that a BBS inserted in the S3-S4 linker region at position 285 (BBS-Kv4.2285, or BBS-Kv4.2) enabled particularly clear Kv4.2 surface labeling when expressed in HEK 293T cells (Figure 1A). Transfected BBS-Kv4.2 was detected with anti-Myc and anti-Kv4.2 antibodies via western blot to confirm expression of the tagged proteins (Figure 1B and 1C). Critically, BBS-Kv4.2 could be stained on the surface of live cells via incubation with 2 μg/ml Rhodamine-BTX (Rh-BTX) at 17°C for 30 min and visualization of the cells after fixation revealed a ringed pattern typical of extracellular labeling (Figure 1D). In contrast, cells expressing myc-Kv4.2-WT (Kv4.2), the construct from which BBS-Kv4.2 was derived, did not stain when incubated with Rh-BTX, demonstrating specificity of Rh-BTX for the BBS (Figure 1D). These data demonstrate that BBS-Kv4.2 construct localizes to the membrane and can be labeled and detected in live cells using fluorescence microscopy.

Figure 1.

Figure 1.

Open in a new tab

Expression of BBS-Kv4.2 in HEK 293T cells. (A) Design of the BBS-Kv4.2 construct. A BBS tag (red text) flanked by dual glycines was inserted into the 2nd extracellular loop of an existing wild-type human Kv4.2 construct (Kv4.2) containing C-terminal myc and DDK (FLAG) tags. (B and C) Western blots showing BBS-Kv4.2 expression in HEK 293T cells. Both the Kv4.2 and BBS-Kv4.2 constructs were detected with anti-Myc (B) and anti-Kv4.2 (C) antibodies. Actin is shown as a loading control. (D) Surface labeling of cells expressing Kv4.2 with or without the S3-S4 linker region BBS insert. Cells were stained with rhodamine-BTX (Rh-BTX) before permeabilization (to label surface BBS) and anti-Myc antibody after permeabilization (to label total Kv4.2). Both Kv4.2 and BBS-Kv4.2 constructs were visualized with the anti-Myc antibody, while only the BBS-Kv4.2 construct was labeled with Rh-BTX at the cell surface. Intensity plots along the white line were shown on the right. Scale bar: 10 μm.

3.2. BBS-Kv4.2 exhibits reduced basal surface expression but remains regulated by auxiliary subunits

In hippocampal CA1 pyramidal neurons, Kv4.2 membrane expression is augmented by two classes of auxiliary subunits, K+ channel-interacting proteins (KChIPs) and Dipeptidyl aminopeptidase-like proteins (DPPs) (Amarillo et al., 2008; Jerng et al., 2005). KChIP2 and DPP6 family members increase Kv4.2 channel expression and activity to regulate dendritic function (Kim et al., 2008). DPP6 has been shown to be necessary for the Kv4.2 expression gradient found in CA1 apical dendrites (Rhodes et al., 2004; Sun et al., 2011). Here, we show BBS-Kv4.2 is similarly regulated by KChIP2 and DPP6 in HEK 293T cells (Figure 2). BBS-Kv4.2 plasma membrane expression detected by surface biotinylation and western blot was notably enhanced by the co-expression of KChIP2 or DPP6 (Figure 2A) and surface labeling by Rh-BTX (Figure 2B and 2C). The quantification analysis revealed that the surface staining intensity of BBS-Kv4.2 (BBS-Kv4.2–285) construct with DPP6 and KChIP2 (Figure 2B) increased by about 3-fold compared to that of BBSKv4.2–220 construct with DPP6 and KChIP2 co-transfection (BBS-Kv4.2–220: 272.8 ± 44.7%; BBS-Kv4.2–285: 758.3 ± 106.4%, n = 15, P = 1.72E-5, Figure 2C). In both western blot and electrophysiology experiments we found BBS-Kv4.2 expressed alone has lower basal surface expression than Kv4.2 (Figure 2A and 2D). However, the KChIP2 and DPP6-dependent increase in current density observed for Kv4.2 was also evident in cells expressing BBS-Kv4.2 (Figure 2D). The expression and kinetic properties of BBS-Kv4.2 and Kv4.2 with and without KChIP2 or DPP6 co-expression was compared (Table 1). These results are consistent with published effects of KChIP2 and DPP6 subunits for both Kv4.2 and BBS-Kv4.2 constructs. We also measured statistically significant changes in rise time, inactivation rate, and voltage dependence of activation of BBS-Kv4.2 compared to Kv4.2. These differences are likely due to the proximity of the BBS to the voltage sensor of Kv4.2 in the S4 transmembrane domain (Table 1). Importantly, the above results suggest that the BBS-Kv4.2 construct approximates the biophysical and trafficking properties of the WT channel.

Table 1.

Biophysical properties of Kv4.2 and BBS-Kv4.2 voltage gated K+ currents.

Kv4.2 K+ current properties WT Kv4.2 WT Kv4.2 + KChIP2 WT Kv4.2 + DPP6 BBS-Kv4.2 BBS-Kv4.2 + KChIP2 BBS-Kv4.2 + DPP6
Current density (pA/pF) 408.8 +/− 30.25 n=24 1052 +/− 157.0 N=11 898.7 +/− 114.1 n=13 192.1 +/− 27.23* n=32 470.9 +/− 43.14* N=19 391.3 +/− 47.49* n=14
10–90% rise time (msec) 1.952 +/− 0.109 n=24 1.412 +/− 0.157 N=11 0.821 +/− 0.062 N=13 4.582 +/− 0.207* N=34 4.115 +/− 0.355* N=18 2.540 +/− 0.281* N=14
Inactivation tfast (msec) 28.00 +/− 1.871 N=24 94.72 +/− 8.858 N=9 27.71 +/− 3.944 N=13 33.58 +/− 1.765* N=32 96.11 +/− 6.119 N=19 30.07 +/− 2.151 N=14
VDA V1/2 (mV) −10.66 +/− 1.094 N=14 −13.96 +/− 1.259 N=8 −25.26 +/− 1.35 N=9 −0.472 +/− 0.996* N=15 −3.399* +/− 0.968 N=12 −5.904 +/− 2.252* N=6
VDI V1/2 (mV) −82.21 +/− 1.190 N=8 −36.26 +/− 0.811 N=9 −72.72 +/− 0.904 N=11 −82.03 +/− 3.691 N=13 −40.86 +/− 1.322* N=13 −66.23 +/− 1.043* N=8
RFI t (ms) 174.7 +/− 16.85 N=6 11.30 +/− 0.946 N=7 52.19 +/− 5.369 N=8 214.1 +/− 34.84 N=7 34.78 +/− 2.694* N=13 73.21 +/− 19.91 N=6
Open in a new tab

VDA: voltage dependence of activation; VDI: voltage dependence of inactivation; RFI: recovery from inactivation; All entries describe the mean +/− SEM.

*

represents statistical significance (0.05>p>0.0001) by unpaired t-test. Statistical comparisons were made between WT Kv4.2 alone vs. BBS-Kv4.2 alone, WT Kv4.2 + KChiP2 vs. BBS-Kv4.2 + KChIP2, or WT Kv4.2 + DPP6 vs. BBS-Kv4.2 + DPP6.

3.3. Visualization of BBS-Kv4.2 internalization and insertion

The molecular mechanisms involved in the basal trafficking and localization of voltage-gated channels are not well understood due to the lack of tools suitable for labeling exofacial epitopes in living cells. Here we show that BBS-Kv4.2 can be used to visualize Kv4.2 internalization and insertion in HEK 293T cells. Live cells were incubated with Rh-BTX for 30 min at 17°C, a temperature that permits BTX binding while limiting channel internalization. The cells were then washed to eliminate free Rh-BTX and incubated at 37°C for various times. Internalization of BTX-labeled BBS-Kv4.2 from the plasma membrane was observed after fixation (Figure 3A). The signal of the surface-labeled BBS-Kv4.2 fraction gradually declined over the incubation time suggesting that the internalized BBS-Kv4.2 underwent degradation (Figure 3A and 3B). In western blot studies, cells were incubated with BTX-biotin to selectively label surface BBS-Kv4.2. After washing off free BTX-biotin, cells were incubated at 37°C for various times. The time course of BBS-Kv4.2 internalization was constructed from densiometric analysis of the western blot (Figure 3C and 3D). The internalization of BBS-Kv4.2 reported by the imaging experiments paralleled the trend of the quantified western blot data as the time constants were 23.0 min (staining) and 33.6 min (western blot).

Figure 3.

Figure 3.

Open in a new tab

Detection of BBS-Kv4.2 internalization in HEK 293T cells. (A) Cells transfected with BBS-Kv4.2 were labeled with Rh-BTX, washed, and incubated at 37°C to allow internalization of the channel. Control cells were incubated at 4°C for 30 min after BTX-labeling. Cells were fixed at the indicated times and imaged with confocal microscopy. Kv4.2 surface fraction signal decreased over time when the cells were incubated at 37°C and remained strong when the cells were incubated at 4°C. (B) Graphical representation of (A), n = 15 for each group. (C) Cells transfected with BBS-Kv4.2 were labeled with biotin-BTX, washed, and incubated at 37°C to allow internalization of the channel. Control cells were incubated at 4°C for 30 min after BTX-biotin labeling. Cells were lysed at the indicated times, and the labeled Kv4.2 was pulled down with streptavidin beads. Western blots showed that the levels of surface labeled BBS-Kv4.2 decreased throughout the incubation period at 37°C. (D) Graphical representation of (C), n = 4 for each group. Ctl: Control.

Next, we measured plasma membrane insertion of BBS-Kv4.2 in HEK 293T cells. Live cells were first incubated with unlabeled BTX (10 μg/ml) at 17°C for 30 min to saturate all preexisting surface channels. Cells were then washed and incubated with Rh-BTX (2 μg/ml) at 37°C for the indicated times (Figure 4A). No surface labeling occurred after the addition of Rh-BTX at 0°C for 30 min, indicating that the preexisting receptors were efficiently blocked with unlabeled BTX (Figure 4A, control). However, specific BTX labeling appeared on the cell surface rapidly after 5 min of incubation at 37°C (Figure 4A). The newly inserted channels accumulated on the plasma membrane throughout the incubation time (Figure 4A and 4B). In western blot studies, cells were first incubated with unlabeled BTX (10 μg/ml) and then incubated with BTX-biotin to label surface BBS-Kv4.2 at 37°C for various time periods. The time course of BBS-Kv4.2 membrane insertion was constructed from densiometric analysis of the western blot (Figure 4C and 4D). The membrane insertion of BBS-Kv4.2 reported in the imaging experiments paralleled the trend of the quantified western blot data as the time constants were 14.9 min (staining) and 14.8 min (western blot).

Figure 4.

Figure 4.

Open in a new tab

Detection of BBS-Kv4.2 insertion in HEK 293T cells. (A) Cells transfected with BBS-Kv4.2 were preincubated with unlabeled BTX at 17°C followed by incubation with Rh-BTX at 37°C for the indicated times to visualize the insertion of new channels into the plasma membrane. Control cells were incubated with Rh-BTX at 4°C for 30 min. Rapid channel insertion within 5 min could be visualized with this method. Scale bar: 20 μm. (B) Graphical representation of (A), n = 15 for each group. (C) Cells transfected with BBS-Kv4.2 were preincubated with unlabeled BTX at 17°C followed by incubation with biotin-BTX at 37°C for the indicated times to visualize exocytosis. Control cells were incubated with biotin-BTX at 4°C for 30 min. Cells were lysed at the indicated times and the labeled BBS-Kv4.2 was pulled down with streptavidin beads. Western blots showed that the levels of surface labeled BBS-Kv4.2 increased throughout the incubation period at 37°C. (D) Graphical representation of (C), n = 3 for each group. Ctl: Control.

3.4. BBS-Kv4.2 co-localizes with endosome markers upon internalization

Upon internalization into endosomes, membrane proteins can undergo recycling back to the membrane or enter protein degradation pathways (Langemeyer et al., 2018). To visualize the fate of internalized Kv4.2, we co-transfected BBS-Kv4.2 with various endosome markers and incubated the cells in Rh-BTX at 37°C for 1.5 h. BBS-Kv4.2 largely colocalized with the early endosome marker Rab5 suggesting that surface BBS-Kv4.2 is continually endocytosed (Figure 5A, 5B). BBS-Kv4.2 also colocalized with both the late endosome marker Rab7 (Figure 5C, 5D) and the recycling endosome marker Rab11 (Figure 5E, 5F), indicating that some internalized BBS-Kv4.2 is recycled back to the plasma membrane. BBS-Kv4.2 also partly colocalized with the lysosome marker Lamp1 (Figure 5G, 5H) suggesting that only a fraction of internalized BBS-Kv4.2 undergoes degradation via the lysosome pathway, which is consistent with previous findings that Kv4.2 can also be degraded via the proteasome pathway (Varga et al., 2004). The correlation of BBS-Kv4.2 colocalization with different markers was as follows: Rab5: 0.263 ± 0.022; Rab7: 0.062 ± 0.028; Rab11: 0.160 ± 0.018; and Lamp1: −0.017 ± 0.046; n = 16 cells for each group. These data confirm that BBS-Kv4.2 undergoes a conventional trafficking pattern.

Figure 5.

Figure 5.

Open in a new tab

Colocalization of internalized BBS-Kv4.2 with endosome markers in HEK 293T cells. Cells transfected with BBS-Kv4.2 and the indicated endosome markers were incubated with Rh-BTX at 37°C for 1.5 h. (A, B) Internalized Kv4.2 strongly colocalized with the early endosome marker Rab5. Scale bar: 20 μm. (B) High magnification of Kv4.2 colocalization with Rab5. Scale bar: 5μm. (C, D) Some internalized Kv4.2 colocalized with the late endosome marker Rab7. (D) High magnification of Kv4.2 colocalization with Rab7. (E, F) A large proportion of internalized Kv4.2 colocalized with the recycling endosome marker Rab11. (F) High magnification of Kv4.2 colocalization with Rab11. (G, H) A portion of internalized Kv4.2 colocalized with the lysosome marker Lamp1. (H) High magnification of Kv4.2 colocalization with Lamp1. Intensity plots along the white line were shown on the right. The origin of the intensity plots coincides with the top end of each line in the fluorescent images.

3.5. Trafficking of BBS-Kv4.2 was impaired by both MEK and P38 MAPK inhibitors in HEK 293T cells

We previously showed that the PKA signaling pathway regulates Kv4.2 trafficking (Hammond et al., 2008; Lin et al., 2010). Here we used the newly generated BBS-Kv4.2 construct to determine if the MAPK pathway also contributes to Kv4.2 trafficking. HEK 293T cells transfected with BBSKv4.2 were labeled with Rh-BTX at 17°C for 20 min. Cells were incubated with vehicle or MAPK inhibitors UO126 (10 μM) or SB203580 (10 μM) at 17°C for 5 min before incubating at 37°C for 30 min to allow internalization of the channel. Cells then were fixed, permeabilized and stained for total BBS-Kv4.2 using a Myc antibody. Surface BBS-Kv4.2 signal was significantly reduced after 30 min of incubation (30.56 ± 2.40% total, n = 20 cells, P = 1E-10; Figure 6). Kv4.2 internalization was partially blocked by both UO126, a MEK inhibitor (62.97 ± 3.88% total, n = 20 cells, P = 4.66E-10), and SB203580, a P38 MAPK inhibitor (77.31 ± 2.25% total, n = 20 cells, P = 1E-10). A combination of UO126 and SB203580 (88.24 ± 3.00% total, n = 20 cells, P = 1.44E-17; Figure 6) accentuated the effect (P = 8.16E-6 vs UO126, P = 0.00598 vs SB203580), suggesting ERK and P38 may phosphorylate the same site(s) on Kv4.2.

Figure 6.

Figure 6.

Open in a new tab

Internalization of BBS-Kv4.2 was impaired by both MEK and P38 MAPK inhibitors in HEK 293T cells. (A) Cells transfected with BBS-Kv4.2 were labeled with Rh-BTX at 17°C, and then washed. Cells were incubated with vehicle, UO126 (10 μM), SB203580 (10 μM), or both inhibitors at 17°C for 5 min before incubating at 37°C for 30 min to allow internalization of the channel. Control cells (Total) were incubated at 4°C for 30 min after BTX labeling. Cells were fixed, permeabilized, and stained with anti-Myc antibody to visualize total Kv4.2 expression. Internalization of BBS-Kv4.2 is impaired by both MEK and P38 MAPK inhibitors. Scale bar: 20 μm. (B) Graphical representation of (A), n = 20 cells for each group. ***p < 0.001 vs total surface Kv4.2, ###p < 0.001 vs vehicle control.

3.6. Internalization of BBS-Kv4.2 was impaired by a combination of MEK and P38 MAPK inhibitors in cultured hippocampal neurons

To visualize channel trafficking in neurons, we transfected the BBS-Kv4.2 construct into primary cultured hippocampal neurons. Low expression of α7 nicotinic acetylcholine (ACh) receptors that can bind BTX has been reported in cultured neurons (Jensen et al., 1997). To avoid BTX binding to endogenous nicotinic ACh receptors, cells were preincubated with the nicotinic antagonist tubocurarine prior to the application of BTX, allowing us to specifically examine the trafficking of BBS-Kv4.2 in neurons (Sekine-Aizawa and Huganir, 2004). As with the HEK 293T cells, neurons were incubated with Rh-BTX at 17°C for 30 min to allow BTX binding while limiting internalization. Cells were incubated with vehicle, UO126 (10 μM), SB203580 (10 μM), or both inhibitors at 17°C for 5 min before incubating at 37°C for 15 min to allow internalization of the channel. Labeled surface BBS-Kv4.2 (Rh-BTX) colocalized with total BBS-Kv4.2 (anti-Myc) in cultured hippocampal neurons (Figure 7). The surface BBS-Kv4.2 signal was significantly reduced after 15 min (57.53 ± 4.20% total, n = 17 cells, P = 2.94E-6; Figure 7). This process was not significantly blocked by UO126 (73.39 ± 6.40%, n = 13 cells, P = 0.177) or SB203580 (65.33 ± 4.96%, n = 12 cells, P = 0.725; Figure 7). However, a combination of UO126 and SB203580 treatment significantly impaired BBS-Kv4.2 endocytosis (80.97 ± 6.33%, n = 11 cells, P = 0.0221; Figure 7). These findings not only verified that the novel construct BBS-Kv4.2 is suitable for live staining and trafficking analyses but also revealed that the spontaneous trafficking of BBS-Kv4.2 is dependent on the ERK/MAPK signaling pathway.

Figure 7.

Figure 7.

Open in a new tab

Internalization of BBS-Kv4.2 was impaired by a combination of MEK and P38 MAPK inhibitors in cultured hippocampal neurons. (A, B) Cells transfected with BBS-Kv4.2 were labeled with Rh-BTX, and then washed. Cells were incubated with vehicle, UO126 (10 μM), SB203580 (10 μM), or both inhibitors at 17°C for 5 min before incubating at 37°C for 15 min to allow internalization of the channel. Control cells (Total) were incubated at 4°C for 15 min after BTX labeling. Cells were fixed, permeabilized and stained with anti-Myc antibody to visualize total Kv4.2. Trafficking of BBS-Kv4.2 was impaired by the combination of the MEK and P38 MAPK inhibitors. Scale bar: 20 μm in (A), 5 μm in (B). (C) Graphical representation of (A), n = 17, 13, 12, 13, 11 cells respectively, ***p < 0.001 vs total surface Kv4.2, #p < 0.05 vs vehicle control.

4. Discussion

Optimal study of ion channel trafficking requires the use of an exofacially tagged construct to differentiate between the surface-expressed and intracellular populations of channels. Here, we introduce a construct useful for monitoring the trafficking of Kv4.2, the prominent somatodendritic A-type K+ channel in CA1 hippocampal neurons. A BBS inserted into the S3-S4 linker region of the Kv4.2 α-subunit allows for the visualization of this channel at the surface membrane. With this construct, we observed the spontaneous internalization and insertion of BBS-Kv4.2 in HEK 293T cells. Our results further suggest that Kv4.2 trafficking in transfected primary hippocampal neurons is significantly altered by mitogen-activated protein kinase inhibitors.

Recent studies of Kv4.2 membrane trafficking have used common cell biological techniques. GFP fusion proteins have been used to observe the trafficking of Kv4.2 (Kim et al., 2007). In addition, labeling live cells with antibodies against extracellular epitopes or tags has been employed to visualize the surface expression and internalization of the channel (Gross et al., 2016; Moise et al., 2010; Prechtel et al., 2018; Rivera et al., 2003). Although these approaches have successfully been used to study Kv4.2 trafficking and are widely applied in many systems, there are several drawbacks to these techniques. GFP-fusion proteins report the total population of expressed protein in the cell and the identification of different pools of GFP-tagged channels is difficult. Epitope tags rely on antibodies for detection. However, antibodies are large divalent proteins and therefore can promote the clustering or capping of surface antigens. These in turn may have significant effects on membrane trafficking (Mammen et al., 1997). The BBS-Kv4.2 system complements and enhances traditional techniques by introducing a surface epitope that can be used to study membrane protein localization, trafficking, and function.

Clued into the possible benefits of toxin-binding epitopes from Moise and colleagues who utilized a BBS tag in the S1-S2 loop (Moise et al., 2010), we attempted to use their approach. BTX, a high affinity ligand for muscle type and α7 nAChRs, has been extensively used more than 30 years to study the structure, function, distribution, and trafficking of membrane proteins (Couturier et al., 1990; Fambrough and Hartzell, 1972; Sekine-Aizawa and Huganir, 2004). Recent studies using the BTX binding sequence for ligand-gated ion channels and receptors have been very successful (Bogdanov et al., 2006; Cassidy et al., 2014; Dellis et al., 2006; Sekine-Aizawa and Huganir, 2004; Wilkins et al., 2008). Unfortunately, we were not able to obtain the previously reported BBS-tagged Kv4.2 construct (BBS-Kv4.2–220) described in Moise et al., and after recreating it from the provided methods, we could not satisfactorily visualize the channel under our desired conditions. Several attempts to insert single and multiple BBS tags in various regions of the S1-S2 linker region also failed (data not shown). We then turned to the S3-S4 linker region and two insertion sites were tested. Here we show that a single BBS insertion in the S3-S4 linker region enables strong surface staining. The quantification data showed that the surface staining intensity of BBS-Kv4.2 construct with DPP6 and KChIP2 increased by about 3-fold compared to that of BBS-Kv4.2–220 construct with DPP6 and KChIP2 co-transfection. It is interesting to know why our novel S3-S4 BBS construct gives better staining than the S1-S2 BBS construct despite their similar total expression. One possibility is that the S3-S4 BBS-Kv4.2 access plasma membrane easier than the S1-S2 BBS-Kv4.2. Functional measurements of BBS-Kv4.2 channels by whole cell electrophysiology demonstrated ostensibly normal K+ currents when compared to Kv4.2 with some notable differences. We measured a significant decrease in the K+ current density of BBS-Kv4.2 compared to the WT channel which was likely due to a reduction in surface expression caused by the introduction of the BBS tag (Figure 2A and 2C). In addition, the BBS-Kv4.2 K+ current rise-time and rate of inactivation were significantly slowed relative to WT. These changes can be explained by the proximity of the BBS insertion to the S4 transmembrane domain voltage sensor and should not affect the subcellular localization or trafficking of the channel. Importantly, coexpression of KChIP and DPP6 auxiliary subunits regulated BBS-Kv4.2 channel properties similarly to WT Kv4.2. BBS-Kv4.2 showed rapid trafficking kinetics (Figure 3 and 4), which is consistent with our previous findings that Kv4.2 underwent rapid internalization upon stimulation (Kim et al., 2007), and similar to other ion channels such as AMPA receptors (Sekine-Aizawa and Huganir, 2004) and GABAA receptors (Bogdanov et al., 2006). Such rapid surface dynamics may reflect the importance of precisely controlled surface channel expression for dendritic signal processing. Furthermore, using a set of fluorophore-tagged endosome marker plasmids, we found that internalized BBS-Kv4.2 colocalizes with the recycling marker Rab11, which suggests that the reuse of internalized Kv4.2 is an important aspect of basal Kv4.2 plasma membrane dynamics. Colocalization of internalized BBS-Kv4.2 with endosome markers also verified that Rh-BTX remains associated with BBS-Kv4.2 during several subsequent endocytic trafficking steps.

Protein phosphorylation is one of the most common post-translational modifications (PTMs) that regulates important physiological processes such as receptor/channel subcellular trafficking and synaptic plasticity (Lee et al., 2010; Malinow et al., 1989; Roche et al., 1996). Kv4.2 was reported to be phosphorylated by CamKII (Gardoni et al., 2007), PKA (Anderson et al., 2000; Hammond et al., 2008), PKC (Schrader et al., 2009), and ERK (Adams et al., 2000; Schrader et al., 2006). The MAPK cascade is considered to play an important role in hippocampal long-term potentiation (LTP) and learning and memory in the mammalian CNS (Impey et al., 1999). Three ERK phosphorylation sites have been identified in Kv4.2 (Thr602, Thr607, and Ser616) using an in vitro assay (Adams et al., 2000). Further phosphorylation mutant studies revealed a role for these phosphorylation sites in the regulation of A-type current, suggesting structure-function relationships for the MAPK-dependent regulation of membrane Kv4.2 (Schrader et al., 2006). However, it was unclear if MAPK regulates Kv4.2 trafficking. Our experiments indicate that either ERK or P38 MAPK pathways may be required for Kv4.2 trafficking in HEK 293T cells. In cultured hippocampal neurons, inhibiting the ERK or the P38 MAPK pathway only slightly impaired Kv4.2 trafficking and these trends did not reach statistical significance. However, inhibiting both pathways significantly blocked Kv4.2 trafficking under basal conditions. The difference in the responses to MAPK inhibitors in HEK 293T cells and primary hippocampal neurons might be due to the different and unknown mechanisms that distinct cells may adopt to regulate their own signaling. Considering that PKA mediates activity-dependent Kv4.2 channel trafficking (Hammond et al., 2008), our findings support the notion that basal state trafficking and activity-dependent trafficking may require different protein kinases.

In summary, we generated a novel BBS-tagged Kv4.2 construct that can be stained in living cells with Rh-BTX. This new tool allowed us to determine that BBS-Kv4.2 undergoes rapid trafficking in HEK 293T cells, and that this trafficking was modulated by inhibiting MAPK pathways in both HEK 293T cells and primary hippocampal neurons. The BBS-tagged system complements other methods and provides cell biologists with a novel tool for studying membrane protein function.

Supplementary Material

1

Highlights.

A novel bungarotoxin binding site-tagged Kv4.2 construct (BBS-Kv4.2) was generated and validated for use in surface staining experiments.

BBS-Kv4.2 is regulated by DPP6 and KChIPs in similar ways as wildtype Kv4.2.

Kv4.2 undergoes rapid internalization and insertion, and colocalizes with endosome markers under basal conditions.

Basal Kv4.2 internalization is partially blocked by a combination of MEK and P38 MAPK inhibitors in primary hippocampal neurons.

Acknowledgements

We thank Dr. Vincent Schram at NICHD imaging core facility for helping with imaging and quantification and members of the Hoffman lab for advice and suggestions. This work was supported by NIH Intramural Research Program.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Adams JP, Anderson AE, Varga AW, Dineley KT, Cook RG, Pfaffinger PJ, and Sweatt JD (2000). The A-type potassium channel Kv4.2 is a substrate for the mitogen-activated protein kinase ERK. Journal of neurochemistry 75, 2277–2287. [DOI] [PubMed] [Google Scholar]
  2. Amarillo Y, De Santiago-Castillo JA, Dougherty K, Maffie J, Kwon E, Covarrubias M, and Rudy B (2008). Ternary Kv4.2 channels recapitulate voltage-dependent inactivation kinetics of A-type K+ channels in cerebellar granule neurons. The Journal of physiology 586, 2093–2106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anderson AE, Adams JP, Qian Y, Cook RG, Pfaffinger PJ, and Sweatt JD (2000). Kv4.2 phosphorylation by cyclic AMP-dependent protein kinase. The Journal of biological chemistry 275, 5337–5346. [DOI] [PubMed] [Google Scholar]
  4. Bernard C, Anderson A, Becker A, Poolos NP, Beck H, and Johnston D (2004). Acquired dendritic channelopathy in temporal lobe epilepsy. Science 305, 532–535. [DOI] [PubMed] [Google Scholar]
  5. Bogdanov Y, Michels G, Armstrong-Gold C, Haydon PG, Lindstrom J, Pangalos M, and Moss SJ (2006). Synaptic GABAA receptors are directly recruited from their extrasynaptic counterparts. The EMBO journal 25, 4381–4389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cassidy JS, Ferron L, Kadurin I, Pratt WS, and Dolphin AC (2014). Functional exofacially tagged N-type calcium channels elucidate the interaction with auxiliary alpha2delta-1 subunits. Proceedings of the National Academy of Sciences of the United States of America 111, 8979–8984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Couturier S, Bertrand D, Matter JM, Hernandez MC, Bertrand S, Millar N, Valera S, Barkas T, and Ballivet M (1990). A neuronal nicotinic acetylcholine receptor subunit (alpha 7) is developmentally regulated and forms a homo-oligomeric channel blocked by alpha-BTX. Neuron 5, 847–856. [DOI] [PubMed] [Google Scholar]
  8. Dellis O, Dedos SG, Tovey SC, Taufiq Ur R, Dubel SJ, and Taylor CW (2006). Ca2+ entry through plasma membrane IP3 receptors. Science 313, 229–233. [DOI] [PubMed] [Google Scholar]
  9. Fambrough DM, and Hartzell HC (1972). Acetylcholine receptors: number and distribution at neuromuscular junctions in rat diaphragm. Science 176, 189–191. [DOI] [PubMed] [Google Scholar]
  10. Gardoni F, Mauceri D, Marcello E, Sala C, Di Luca M, and Jeromin A (2007). SAP97 directs the localization of Kv4.2 to spines in hippocampal neurons: regulation by CaMKII. The Journal of biological chemistry 282, 28691–28699. [DOI] [PubMed] [Google Scholar]
  11. Gross C, Yao X, Engel T, Tiwari D, Xing L, Rowley S, Danielson SW, Thomas KT, Jimenez-Mateos EM, Schroeder LM, et al. (2016). MicroRNA-Mediated Downregulation of the Potassium Channel Kv4.2 Contributes to Seizure Onset. Cell reports 17, 37–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gross C, Yao X, Pong DL, Jeromin A, and Bassell GJ (2011). Fragile X mental retardation protein regulates protein expression and mRNA translation of the potassium channel Kv4.2. The Journal of neuroscience : the official journal of the Society for Neuroscience 31, 5693–5698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hall AM, Throesch BT, Buckingham SC, Markwardt SJ, Peng Y, Wang Q, Hoffman DA, and Roberson ED (2015). Tau-dependent Kv4.2 depletion and dendritic hyperexcitability in a mouse model of Alzheimer’s disease. The Journal of neuroscience : the official journal of the Society for Neuroscience 35, 6221–6230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hammond RS, Lin L, Sidorov MS, Wikenheiser AM, and Hoffman DA (2008). Protein kinase a mediates activity-dependent Kv4.2 channel trafficking. The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 7513–7519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Harel M, Kasher R, Nicolas A, Guss JM, Balass M, Fridkin M, Smit AB, Brejc K, Sixma TK, Katchalski-Katzir E, et al. (2001). The binding site of acetylcholine receptor as visualized in the X-Ray structure of a complex between alpha-bungarotoxin and a mimotope peptide. Neuron 32, 265–275. [DOI] [PubMed] [Google Scholar]
  16. Hu JH, Park JM, Park S, Xiao B, Dehoff MH, Kim S, Hayashi T, Schwarz MK, Huganir RL, Seeburg PH, et al. (2010). Homeostatic scaling requires group I mGluR activation mediated by Homer1a. Neuron 68, 1128–1142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hu JH, Yang L, Kammermeier PJ, Moore CG, Brakeman PR, Tu J, Yu S, Petralia RS, Li Z, Zhang PW, et al. (2012). Preso1 dynamically regulates group I metabotropic glutamate receptors. Nature neuroscience 15, 836–844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Impey S, Obrietan K, and Storm DR (1999). Making new connections: role of ERK/MAP kinase signaling in neuronal plasticity. Neuron 23, 11–14. [DOI] [PubMed] [Google Scholar]
  19. Jensen JJ, Winzer-Serhan UH, and Leslie FM (1997). Glial regulation of alpha 7-type nicotinic acetylcholine receptor expression in cultured rat cortical neurons. Journal of neurochemistry 68, 112–120. [DOI] [PubMed] [Google Scholar]
  20. Jerng HH, Kunjilwar K, and Pfaffinger PJ (2005). Multiprotein assembly of Kv4.2, KChIP3 and DPP10 produces ternary channel complexes with ISA-like properties. The Journal of physiology 568, 767–788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Johnston D, Hoffman DA, Magee JC, Poolos NP, Watanabe S, Colbert CM, and Migliore M (2000). Dendritic potassium channels in hippocampal pyramidal neurons. The Journal of physiology 525 Pt 1, 75–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kim J, and Hoffman DA (2008). Potassium channels: newly found players in synaptic plasticity. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry 14, 276–286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kim J, Jung SC, Clemens AM, Petralia RS, and Hoffman DA (2007). Regulation of dendritic excitability by activity-dependent trafficking of the A-type K+ channel subunit Kv4.2 in hippocampal neurons. Neuron 54, 933–947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kim J, Nadal MS, Clemens AM, Baron M, Jung SC, Misumi Y, Rudy B, and Hoffman DA (2008). Kv4 accessory protein DPPX (DPP6) is a critical regulator of membrane excitability in hippocampal CA1 pyramidal neurons. Journal of neurophysiology 100, 1835–1847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Langemeyer L, Frohlich F, and Ungermann C (2018). Rab GTPase Function in Endosome and Lysosome Biogenesis. Trends in cell biology 28, 957–970. [DOI] [PubMed] [Google Scholar]
  26. Lee HK, Takamiya K, He K, Song L, and Huganir RL (2010). Specific roles of AMPA receptor subunit GluR1 (GluA1) phosphorylation sites in regulating synaptic plasticity in the CA1 region of hippocampus. Journal of neurophysiology 103, 479–489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lin L, Long LK, Hatch MM, and Hoffman DA (2014). DPP6 domains responsible for its localization and function. The Journal of biological chemistry 289, 32153–32165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lin L, Sun W, Wikenheiser AM, Kung F, and Hoffman DA (2010). KChIP4a regulates Kv4.2 channel trafficking through PKA phosphorylation. Molecular and cellular neurosciences 43, 315–325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lin MA, Cannon SC, and Papazian DM (2018). Kv4.2 autism and epilepsy mutation enhances inactivation of closed channels but impairs access to inactivated state after opening. Proceedings of the National Academy of Sciences of the United States of America 115, E3559–E3568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Malinow R, Schulman H, and Tsien RW (1989). Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP. Science 245, 862–866. [DOI] [PubMed] [Google Scholar]
  31. Mammen AL, Huganir RL, and O’Brien RJ (1997). Redistribution and stabilization of cell surface glutamate receptors during synapse formation. The Journal of neuroscience : the official journal of the Society for Neuroscience 17, 7351–7358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Maue RA (2007). Understanding ion channel biology using epitope tags: progress, pitfalls, and promise. Journal of cellular physiology 213, 618–625. [DOI] [PubMed] [Google Scholar]
  33. Moise L, Liu J, Pryazhnikov E, Khiroug L, Jeromin A, and Hawrot E (2010). K(V)4.2 channels tagged in the S1-S2 loop for alpha-bungarotoxin binding provide a new tool for studies of channel expression and localization. Channels 4, 115–123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Monaghan MM, Menegola M, Vacher H, Rhodes KJ, and Trimmer JS (2008). Altered expression and localization of hippocampal A-type potassium channel subunits in the pilocarpine-induced model of temporal lobe epilepsy. Neuroscience 156, 550–562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Murphy JG, and Hoffman DA (2019). A polybasic motif in alternatively spliced KChIP2 isoforms prevents Ca(2+ )regulation of Kv4 channels. The Journal of biological chemistry. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Prechtel H, Hartmann S, Minge D, and Bahring R (2018). Somatodendritic surface expression of epitope-tagged and KChIP binding-deficient Kv4.2 channels in hippocampal neurons. PloS one 13, e0191911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rhodes KJ, Carroll KI, Sung MA, Doliveira LC, Monaghan MM, Burke SL, Strassle BW, Buchwalder L, Menegola M, Cao J, et al. (2004). KChIPs and Kv4 alpha subunits as integral components of A-type potassium channels in mammalian brain. The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 7903–7915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rivera JF, Ahmad S, Quick MW, Liman ER, and Arnold DB (2003). An evolutionarily conserved dileucine motif in Shal K+ channels mediates dendritic targeting. Nature neuroscience 6, 243–250. [DOI] [PubMed] [Google Scholar]
  39. Roche KW, O’Brien RJ, Mammen AL, Bernhardt J, and Huganir RL (1996). Characterization of multiple phosphorylation sites on the AMPA receptor GluR1 subunit. Neuron 16, 1179–1188. [DOI] [PubMed] [Google Scholar]
  40. Schrader LA, Birnbaum SG, Nadin BM, Ren Y, Bui D, Anderson AE, and Sweatt JD (2006). ERK/MAPK regulates the Kv4.2 potassium channel by direct phosphorylation of the pore-forming subunit. American journal of physiology Cell physiology 290, C852–861. [DOI] [PubMed] [Google Scholar]
  41. Schrader LA, Ren Y, Cheng F, Bui D, Sweatt JD, and Anderson AE (2009). Kv4.2 is a locus for PKC and ERK/MAPK cross-talk. The Biochemical journal 417, 705–715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sekine-Aizawa Y, and Huganir RL (2004). Imaging of receptor trafficking by using alphabungarotoxin-binding-site-tagged receptors. Proceedings of the National Academy of Sciences of the United States of America 101, 17114–17119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Shah MM, Hammond RS, and Hoffman DA (2010). Dendritic ion channel trafficking and plasticity. Trends in neurosciences 33, 307–316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sun W, Maffie JK, Lin L, Petralia RS, Rudy B, and Hoffman DA (2011). DPP6 establishes the A-type K(+) current gradient critical for the regulation of dendritic excitability in CA1 hippocampal neurons. Neuron 71, 1102–1115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Varga AW, Yuan LL, Anderson AE, Schrader LA, Wu GY, Gatchel JR, Johnston D, and Sweatt JD (2004). Calcium-calmodulin-dependent kinase II modulates Kv4.2 channel expression and upregulates neuronal A-type potassium currents. The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 3643–3654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wilkins ME, Li X, and Smart TG (2008). Tracking cell surface GABAB receptors using an alpha-bungarotoxin tag. The Journal of biological chemistry 283, 34745–34752. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1533056-supplement-1.pdf (2MB, pdf)

RESOURCES