Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2008 Aug 15;9(6):777–786. doi: 10.1111/j.1364-3703.2008.00499.x

Different pathotypes of the sunflower downy mildew pathogen Plasmopara halstedii all contain isometric virions†

MARION HELLER‐DOHMEN 1,2,✉, JENS C GÖPFERT 1, RAY HAMMERSCHMIDT 2, OTMAR SPRING 1
PMCID: PMC6640286  PMID: 19019006

SUMMARY

Eight pathotypes of Plasmopara halstedii were screened to investigate the occurrence of virions and the potential viral influence on the pathogenicity of the sunflower downy mildew pathogen. In 23 of 26 P. halstedii isolates derived from eight countries in Europe, North America and South America, virions were detected by transmission electron microscopy. By contrast, there were no ultrastructural indications of virus‐like particles in eight other related Oomycetes. The virions of representative P. halstedii isolates were morphologically and biochemically characterized and compared among each other. Regardless of their host's pathotypes, the geographical origin of the isolate and the sensitivity towards the fungicide metalaxyl, the viral characters obtained were uniform. The virions were isometric and measured approximately 37 nm in diameter. One polypeptide of c. 36 kDa and two segments of single‐stranded RNA (3.0 and 1.6 kb) were detected. Both viral RNA segments were detected by capillary electrophoresis in the three remaining P. halstedii isolates where virions were undetectable by transmission electron microscopy. Virus‐specific primers for the 1.6 kb‐segment were synthesized and used to determine and compare a partial sequence of the viral coat protein among virions of different P. halstedii pathotypes. In all tested isolates, fragments of 0.7 kb were amplified which were directly sequenced. Sequence variation was insignificant. As both less aggressive and more aggressive P. halstedii isolates contained virions, the presence or absence of virions could not explain the diverse aggressiveness of the downy mildew pathogen towards sunflower. Moreover, the results indicated that pathogenicity of P. halstedii was not related to variation in morphological or biochemical characters of the virions.

INTRODUCTION

Very few species within the Oomycetes are known to host virus‐like elements such as virus‐like particles (VLPs), double‐stranded RNA (dsRNA) or single‐stranded RNA (ssRNA). Some isolates of Albugo candida contained VLPs measuring 200 nm in diameter (Buck, 1986). In Phytophthora infestans, the potato late blight pathogen, bacilli‐shaped VLPs were observed (Styer and Corbett, 1978). Ph. infestans isolates which were hosts to viral dsRNA showed an increased virulence compared with virus‐free isolates (Tooley et al., 1989), indicating a phenomenon named hypervirulence. Later, Newhouse et al. (1992) detected several segments of linear dsRNA (11.10–1.35 kbp) in Ph. infestans. Intranuclear VLPs were found in an isolate of Phytophthora drechsleri, a pathogen of pepper plants (Roos and Shaw, 1985). In Phytophthora nicotianae, VLPs measuring 130 nm in width and 170 nm in length were found (Buck, 1986). dsRNA in a so far unnamed Phytophthora species, pathogenic to Douglas fir, was recently detected and sequenced (Hacker et al., 2005). An isolate of Pythium irregulare, associated with infected Canadian cucumber plants, harboured virions which measured 28 nm in diameter and contained dsRNA (Klassen et al., 1991). Associated with Australian wheat, another isolate of Pythium irregulare was found to hold dsRNA but these VLPs measured 45 nm in diameter (Gillings et al., 1993). dsRNA but no VLPs were reported to occur in Pythium butleri (Buck, 1986). Although some of these virus‐like elements have been known for more than 20 years, no further characteristics have been reported. The only oomycotic viruses which have been studied more intensively are those occurring in Sclerophthora macrospora, the downy mildew pathogen of rice and other species within the Poaceae. In this oomycete, two distinguishable types of virions were found which were named SmV A and SmV B. Both virus types were isometric and used ssRNA to encode their viral genomes. Two coat proteins (43 and 39 kDa) and three segments of ssRNA (2928, 1981 and 977 nt) were found to set up SmV A (Honkura et al., 1983; Shirako and Ehara, 1985; Yokoi et al., 2003). SmV B featured one coat protein of 41 kDa and one ssRNA segment of 5533 nt (Honkura et al., 1983; Shirako and Ehara, 1985; Yokoi et al., 1999).

Possibly due to the difficult handling of most Oomycetes, the understanding of the influence of virus‐like elements is still insufficient. Even for S. macrospora viruses, there has not been any report on observations regarding viral influence on the pathogenicity of the oomycete.

Plasmopara halstedii is a biotrophic pathogen of sunflower causing downy mildew infections. It is another oomycete which is known to contain virions. Gulya et al. (1990) described isometric virions which were found in a single North American pathotype of P. halstedii. The putative coat protein was determined to consist of a 37.5 kDa‐polypeptide and RNA was determined to encode the viral genome (Gulya et al., 1992; Mayhew et al., 1992). P. halstedii is distributed world‐wide and shows a broad spectrum of pathotypes (physiological races) as reported by Gulya (2007). However, no further data have yet been reported on virus occurrence in other P. halstedii pathotypes, the geographical distribution or the nucleic acid sequence of the virions or the viral influence on pathogenicity.

Here we report on the presence of virions in representative P. halstedii isolates. These isolates differed in their pathotypes, their geographical origin and their fungicide sensitivity towards metalaxyl. To investigate the potential viral influence on the pathogenicity of P. halstedii, P. halstedii virions were characterized and compared with respect to their morphology and biochemical composition. This also included a 0.7 kb‐nucleic acid region of the 1.6 kb‐segment which was amplified with virus‐specific primers and compared among viral isolates extracted from representative P. halstedii isolates. Additionally, this research provided first insight into the relationship between the oomycotic virus of P. halstedii and other viruses.

RESULTS AND DISCUSSION

Characterization by transmission electron microscopy

Transmission electron microscopy of ultrathin sporangia sections revealed the presence of isometric virions in the cytoplasm of P. halstedii regardless of its pathotype (Table 1). The same virions were also found in hyphae and haustoria (Fig. 1a). They mostly occurred in large quantities freely dispersed throughout the cytoplasm as well as in vesicles. The virions often formed a kind of crystalline structure, especially when enclosed by a membrane (Fig. 1b). Similar virions or other VLPs were never observed in sunflower cells of either infected or healthy plants. These results were in accordance with those reported for the North American race 2 isolates of P. halstedii (Gulya et al., 1992), which corresponds to pathotype 300 (Gulya, 2007).

Table 1.

P. halstedii isolates and the characteristics of their virions. The common sunflower, H. annuus, was host to all but one P. halstedii isolate (Ph5‐01, host H. × laetiflorus). Information and results about the isolates and their virions were provided as far as tested.

P. halstedii isolate/viral isolate Year of collection Geographical origin Characteristics of P. halstedii Examination of P. halstedii sporangia by TEM Viral protein analysis Viral RNA analysis GenBank accession number
Fungicide* Pathotype Samples with virions/sample total† Virion diameter (nm)† Virions in ultrathin sections‡ No. of protein bands§ Molecular mass (kDa) No. of segments Segment sizes (kb)
Ph4‐93 1993 Fargo, ND, USA 710 1/1 1 36 2 3.0, 1.6 EU126922
Ph3‐96 1996 Kitzingen, Germany 710 1/1 37  + 
Ph1‐97 1997 Groß Gerau, Germany 330 1/2
Ph6‐97 1997 Sinzheim, Germany R 1/1
Ph9‐97 1997 Fargo, ND, USA 710 1/1
Ph9‐98 1998 Leinfelden, Germany S 310 4/7 37  +  1 36 2 3.0, 1.6 EU126923
Ph14‐98 1998 Heidelberg, Germany 1/1
Ph5‐99 1999 Slovakia 720 1/1 37  + 
Ph6‐99 1999 Austria 1/1
Ph7‐99 1999 Austria 1/2
Ph8‐99 1999 Bléré, France R 730 2/2 37  +  1 36 2 3.0, 1.6 EU126925
Ph1‐00 2000 Clermont‐Ferrand, France S 703 2/2  +  1 36 2 3.0, 1.6 EU126924
Ph10‐00 2000 Poutoux, France R 710 1/1 37
Ph13‐00 2000 St. Christoph, France R 710 2/2
Ph21‐00 2000 Filderstadt‐Sielmingen, Germany 710 1/1
Ph5‐01 2001 Tübingen‐Lustnau, Germany 2/5 2 3.0, 1.6 EU126921
Ph8‐01 2001 Leinfelden‐Steinenbronn, Germany 300 1/1
Ph10‐01 2001 Stuttgart‐Plieningen, Germany S 730 0/1
Ph14‐01 2001 Gödöllö, Hungary 730 1/1 37
Ph19‐01 2001 Gödöllö, Hungary 100 1/1  +  1 36 2 3.0, 1.6 EU126920
Ph8‐03 2003 Herrenberg‐Kuppingen, Germany S 710 1/1
Ph10‐03 2003 Stuttgart‐Rotenberg, Germany S 710 1/2
#529 2003 Balcarce, Argentina 1/2
#530 2003 Balcarce, Argentina 0/2
#534 2001 Manitoba, Canada 1/1
#535 2002 Manitoba, Canada 0/1
Open in a new tab
*

P. halstedii isolate is either resistant (R) or sensitive (S) to fungicide treatment with metalaxyl (Spring et al., 1997).

†

As determined by randomly sampled viral isolates using negative staining (2% uranyl acetate solution).

‡

In all the tested ultrathin sections of sporangia (marked with +), isometric virions of very similar sizes were found.

§

Number of protein bands detected with Coomassie blue staining.

Although virions were undetectable by transmission electron microscopy, these P. halstedii isolates contained viral RNA as determined by capillary electrophoresis and/or RT‐PCR experiments (data not shown).

Figure 1.

Figure 1

Open in a new tab

Hyphae (hy) of P. halstedii projecting a haustorium (ha) in a sunflower parenchyma cell. Insert (b) shows virions dispersed in the haustorium cytoplasm and within vesicles, containing crystalline‐like aggregations of the virions. cw: cell wall; mi: mitochondrium; va: sunflower vacuole; ch: chloroplast. Scale bar: 2 µm.

The use of a negative staining technique allowed an extended screening of P. halstedii isolates varying in pathogenicity, geographical origin, fungicide sensitivity and host (Table 1). Virions were observed in 23 of 26 isolates of P. halstedii, representing a total of eight pathotypes from five European (Austria, France, Germany, Hungary and Slovakia) and three American (Argentina, Canada, USA) countries. The virions occurred in less aggressive P. halstedii pathotypes (e.g. 100 or 300) as well as in more aggressive ones (e.g. 703 and 730). Among these were isolates (e.g. Ph8‐99, Ph10‐00) showing resistance to high concentrations of the systemic fungicide metalaxyl (Rozynek and Spring, 2001). Another virion‐positive isolate (Ph5‐01) was collected from H. × laetiflorus, a perennial sunflower hybrid which has become established in Germany (Spring et al., 2003). No significant differences in viral morphology were observed among these 23 virion‐positive isolates. The negatively stained virions measured approximately 37 nm (n = 202; 37 ± 7.3 nm) in diameter and showed a granular surface (Fig. 2) as was previously reported for those of the single pathotype tested by Mayhew et al. (1992). The few cases in which the virions could not be observed were more probably due to low virus titres in combination with the insensitivity of transmission electron microscopy screenings rather than to the absence of virions. This assumption was confirmed by capillary electrophoresis in which both viral RNA segments were identified (data not shown). All 26 P. halstedii isolates tested were found to contain virions and/or viral RNA segments of identical sizes.

Figure 2.

Figure 2

Open in a new tab

Negatively stained virions of P. halstedii. (a) Isolate Ph14‐01: pathotype 730, Hungary, 2001; (b) isolate Ph10‐00: pathotype 710, France, 2000). Scale bar: 40 nm.

Within eight other taxa of Oomycetes representing related Plasmopara species (P. angustiterminalis, P. nivea, P. pusila and P. viticola) as well as Bremia lactucae, Peronospora tabacina, Ph. infestans and Pustula tragopogonis, no similar or other VLPs were observed by transmission electron microscopy. RT‐PCR experiments with virus‐specific primers (2‐f3 and 2‐r4) were conducted to verify these results. Products of 0.7 kb were never obtained with these oomycotic pathogens (data not shown).

Biochemical characterization

After the extraction and purification procedure, virions of five P. halstedii isolates (Ph4‐93, Ph9‐98, Ph8‐99, Ph1‐00, Ph19‐01; Table 1) were characterized biochemically. As verified by transmission electron microscopy, in all five samples the isometric virions were successfully purified and concentrated, whereas the control (healthy sunflower) lacked virions. Additionally, it was observed that the morphology of the virions was unaffected by chloroform treatment during the purification procedure, probably indicating non‐enveloped virions.

After the centrifugation steps, the suspensions of P. halstedii virions showed UV absorption spectra typical for viral nucleoproteins (Hull, 1985) and an absorbance ratio A 260/A 280 of 1.34–1.48. The coat protein was detected as a single polypeptide band with an estimated molecular mass of 36 kDa in SDS‐PAGE gels of all viral isolates tested (Fig. 3a). Some preparations occasionally contained minimal amounts of additional proteins. These polypeptides represented aggregated and/or partial viral coat proteins as identified by protein mass spectrometry (data not shown). The extracted viral nucleic acid samples showed an average A 260/A 280 ratio of 1.8. The nucleic acids of the viral samples were unaffected by DNase I treatment but were susceptible to RNAse A digestion in both low and high salt conditions, indicating an ssRNA genome (Supporting Information Fig. S1). This was verified by RT‐PCR experiments using either primer 2‐f3 or 2‐r4 for transcription and then both primers for PCR. A product was yielded only when transcribed with primer 2‐r4 (data not shown). Purity of viral RNA preparations was tested in RT‐PCR experiments using a universal primer set for eukaryotic 18S rDNA. Visible bands were never obtained, when transcribed either with the 18SR primer or with the 18SF primer (data not shown). However, extracted sunflower DNA as well as extracted P. halstedii sporangia DNA showed bands of expected sizes (Fig. 4; lanes 9 and 11). The presence of two viral RNA segments consisting of approximately 3.0 kb (RNA 1) and 1.6 kb (RNA 2), respectively (Fig. 3b), was revealed by agarose gel electrophoresis. The two viral segments were separated by agarose gel electrophoresis and individually isolated from the gel (Supporting Information Fig. S2a). As revealed by RT‐PCR experiments using virus‐specific primers for the coat protein gene, the coat protein was (at least partially) encoded by RNA 2 (Supporting Information Fig. S2b; lanes 4–7). Again, this assumption was verified by protein mass spectrometry (Fig. 5).

Figure 3.

Figure 3

Open in a new tab

Biochemical characters of virions from P. halstedii isolates of different pathotypes and geographical origin. (a) SDS‐PAGE of the viral polypeptides (Coomassie blue staining); (b) viral RNA on a native agarose gel using an ssRNA marker for sizing. Slight differences in the motility of the two RNA segments in lane 1 in comparison with lanes 2, 3, 5 and 4 are thought to be due to unequal sample quantity. 1: isolate Ph19‐01 (pathotype 100, Hungary, 2001); 2: isolate Ph9‐98 (pathotype 310, Germany, 1998, metalaxyl‐sensitive); 3: isolate Ph1‐00 (pathotpye 703, France, 2000, metalaxyl‐sensitive); 4, isolate Ph8‐99 (pathotype 730, France, 1999, metalaxyl‐resistant); 5: isolate Ph4‐93 (pathotype 710, USA, 1993). Additional polypeptide bands represented aggregated and/or partial viral coat proteins as analysed by protein mass spectrometry.

Figure 4.

Figure 4

Open in a new tab

DNA gel electrophoresis after PCR. In lanes 1–8 and 10, virus‐specific primers (2‐r4 and 2‐f3) were used. In lanes 9 and 11, universal eukaryotic primers (18SF and 18SR) were used. 1: isolate Ph5‐01 (host H. × laetiflorus, Germany, 2001); 2: isolate Ph19‐01 (pathotype 100, Hungary, 2001, metalaxyl‐sensitive); 3: isolate Ph9‐98 (pathotype 310, Germany, 1998, metalaxyl‐sensitive); 4: isolate Ph1‐00 (pathotype 703, France, 2000, metalaxyl‐sensitive); 5: isolate Ph4‐93 (pathotype 710, USA, 1993); 6: isolate Ph8‐99 (pathotype 730, France, 1999, metalaxyl‐resistant); 7: non‐template control (water); 8 and 9: P. halstedii DNA; 10 and 11: healthy sunflower (H. annuus) DNA.

Figure 5.

Figure 5

Open in a new tab

Comparison of the deduced amino acid sequences representing partial coat proteins. Six viral isolates of P. halstedii (Ph5‐01, Ph19‐01, Ph9‐98, Ph1‐00, Ph4‐93, Ph8‐99) were compared with the amino acid sequence 71–274 of SmV A RNA 2. In black are highlighted the only two amino acids which were different within the P. halstedii virus isolates (M instead of I in Ph19‐01; V instead of A in Ph8‐99). In grey are highlighted the amino acids which were different between the P. halstedii virus and SmV A. The framed sequence parts represented fragments of the c. 36 kDa‐coat protein as found by protein mass spectrometry.

Control experiments with samples of healthy sunflower identically treated during the extraction and purification procedure never contained the 36 kDa‐coat protein or the two RNA segments (data not shown).

Sequence data analysis

A sequence fragment coding for a part of the viral coat protein was considered as another characteristic to be compared among representative P. halstedii virus isolates. Viral isolates (Ph4‐93, Ph9‐98, Ph8‐99, Ph1‐00, Ph5‐01, Ph19‐01; Table 1) which were partially sequenced were chosen by their host's pathotypes, geographical origin and fungicide sensitivity. After RT‐PCR experiments with virus‐specific primers, for all six viral isolates a single band of approximately 0.7 kb resulted and this was directly sequenced (Fig. 4; lanes 1–6). Although the P. halstedii isolates covered a broad collection range, the viral nucleic acid as well as the deduced amino acid sequences only varied insignificantly. The viral amino acid sequences of Ph4‐93, Ph8‐98, Ph1‐00 and Ph5‐01 did not differ at all. In Ph19‐01, an isoleucine was replaced by a methionine and in Ph8‐99, an alanine substituted a valine.

As far as yet determined, but regardless of their host's pathotype, geographical origin and fungicide sensitivity, all viral characteristics of different P. halstedii isolates were identical to one another. Also in agreement with the result of this study were the morphological and biochemical characters which have been previously reported for virions occurring in a single North American pathotype (Gulya et al., 1992; Mayhew et al., 1992). In contrast to S. macrospora, in which two isometric viruses showed clear differences in many characters (Honkura et al., 1983; Shirako and Ehara, 1985; Yokoi et al., 1999, 2003), the results of our study suggested the presence of a single virus in P. halstedii.

Relationship of the P. halstedii virus to other viruses

Some characteristics between the P. halstedii virus and SmV A (Honkura et al., 1983; Shirako and Ehara, 1985; Yokoi et al., 2003), one of the two viruses occurring in S. macrospora, were obvious but both virus types are clearly distinguishable. Both viruses were isometric and showed a granular surface. P. halstedii virus measured c. 37 nm in diameter, whereas SmV A was slightly larger (c. 40 nm in diameter) when negatively stained with 2% uranyl acetate solution. Both viral genomes were encoded in ssRNA. In SmV A, three RNA segments were detected, whereas P. halstedii virus only contained two segments. RNA 2 of SmV A with a length of 1981 nt coded for the two coat proteins (43 and 39 kDa). In P. halstedii virus, a similar sized segment (RNA 2, 1.6 kb) was found to code for the single coat protein (36 kDa). SmV A RNA 1 with 2928 nt coded for the RNA‐dependent RNA polymerase (RdRp). In P. halstedii virus, RNA 1 with its size of 3 kb might analogously code for the RdRp. The nucleic acid sequence of P. halstedii virus, which has been sequenced so far, has not shown any similarity to any known sequences. However, partial amino acid sequences revealed similarities of approximately 58% to a part of the coat protein of SmV A (Fig. 5). To a much lesser extent, P. halstedii as well as SmV A showed similarities to amino acid sequences of coat proteins of members within the family Tombusviridae. As only 15% of the P. halstedii virus genome has been sequenced so far, more studies are necessary before any concluding remarks can be made regarding the relationship of this virus to others.

Viral influence on pathogenicity

Little is known on the effects of eumycotic viruses on the infection process of fungal plant pathogens (Ghabrial, 1980; McCabe et al., 1999; Nuss, 2005; Varga et al., 2003) and even less is known about the influence of oomycotic viruses on virulence and infectivity. Only dsRNA of Ph. infestans is known to have an influence on its host by enhancing the growth of the oomycete (Tooley et al., 1989). As both less aggressive and more aggressive P. halstedii isolates contained virions, the presence or absence of virions could not explain the diverse aggressiveness of the downy mildew pathogen towards sunflower. It was also impossible to correlate a certain virion composition or nucleotide sequence or deduced amino acid sequence to a more aggressive or less aggressive pathotype of P. halstedii. Based on data obtained in this study, the uniformity of virions found in different P. halstedii pathotypes led to the assumption that pathogenicity of P. halstedii was unrelated to characteristics of viral components.

EXPERIMENTAL PROCEDURES

Origin and culturing of fungal isolates

As P. halstedii is a biotrophic oomycete, it cannot be cultivated on synthetic media. Therefore, a generally susceptible cultivar (Helianthus annuus cv. Giganteus) was used to culture all P. halstedii isolates (Spring et al., 1997). Virulence studies for P. halstedii pathotype characterization were performed using a set of sunflower differential lines (Tourvieille et al., 2000), with a whole seedling inoculation technique (Spring et al., 2003). Downy mildew symptoms were assessed 12–14 days after inoculation and the pathogen was harvested as previously described (Rozynek and Spring, 2001) for subsequent ultrastructural examination and biochemical analysis or for intermediate storage at −18 °C. Isolates of P. halstedii used in this study are listed in Table 1. Sporangium samples are deposited in the Oomycetes collection of O. Spring, University of Hohenheim, and stored at −70 °C. Healthy sunflower leaf and hypocotyl tissue of the same H. annuus cultivar served as controls in numerous experiments.

Several other oomycotic isolates were screened for VLP occurrence using the negative staining technique. These were P. angustiterminalis (host Xanthium strumarium; voucher #508: Austria, 2000; #509: Austria, 2001), P. nivea (host Aegopodium podagraria; #463: Germany, 2002), P. pusila (host Geranium pratense; #409: Germany, 2001), P. viticola (host Vitis vinifera; #456: Germany, 2002), Bremia lactucae (host Lactuca sativa; Haas #20: Germany, 2001), Peronospora tabacina (host Nicotiana tabacum; #489: Germany, 2002), Ph. infestans (host Solanum tuberosum; #522 and #524: Germany, 2002) and Pustula tragopogonis (syn. Albugo tragopogonis, host: Helianthus annuus; #567: Germany, 2003). Vouchers of infected plant material are deposited in the Hohenheim herbarium (HUH).

Ultrathin sections for TEM

P. halstedii sporangia were suspended in 0.1 m phosphate buffer, pH 7.2. A double volume of a 2% (w/v) agarose solution was then added to the sporangia suspension. This mixture was cooled on ice. After solidification of the agarose, samples were cut into small cubes, fixed in 2.5% glutaraldehyde in 0.1 m phosphate buffer, pH 7.2, for 1 h at room temperature, and then postfixed for 1 h in 1% osmium tetroxide in 0.1 m phosphate buffer, pH 7.2. Samples were then dehydrated in ethanol and finally embedded in LR‐White for ultrathin sectioning. Sections were stained with 2% uranyl acetate solution (pH 4) for 10 min and subsequently transferred to lead citrate solution for 1 min (Reynolds, 1963). Healthy sunflower material, which served as a control, and P. halstedii‐infected sunflower leaf and hypocotyl tissue was cut into small pieces and fixed, dehydrated and stained in the same way.

Negative staining for TEM

Sporangia of P. halstedii and other Oomycetes were ground at full speed in a tissue homogenizer (Ultra‐Turrax, IKA, Staufen, Germany) in 0.1 m phosphate buffer, pH 7.2, for 1 min. A drop of the resulting solution was placed on Parafilm M (Pechiney, VWE, Darmstadt, Germany) and covered with a grid. After 30 min of adsorption the grids were stained with 2% uranyl acetate solution (pH 4) for 40 min. Leaf tissue of healthy sunflower plants was treated in the same way and served as a control.

Transmission electron microscopy

Ultrathin sections and negatively stained samples were examined at 80 kV (EM 10, Zeiss, Oberkochen, Germany).

Virus extraction and purification

In total, 120–175 g of primary foliage leaves as well as hypocotyl and cotyledon tissue infected with different pathotypes of P. halstedii were ground in 0.05 m sodium phosphate buffer, pH 7.0, containing 0.1% (w/v) sodium sulfite and then filtered through cheesecloth. The homogenate was centrifuged at low speed (4000 g, 10 min, 4 °C). The aqueous supernatant was then subjected to ultracentrifugation (75 000 g, 3 h, 4 °C). The resulting pellet was suspended in 0.05 m phosphate buffer with 0.1% (w/v) sulfite and extracted twice with chloroform (1 mL chloroform per 4 mL buffer) to remove contaminants such as RuBisCO and ribosomes (Hull, 1985). The aqueous phase was layered on a 40–10% (w/v) linear sucrose density gradient and centrifuged at 103 900 g for 3 h (4 °C). The virion‐containing fraction was extracted with a syringe, added to 0.05 m phosphate buffer with 0.1% (w/v) sulfite and again centrifuged (75 000 g, 3 h, 4 °C). The pellet was re‐suspended in 0.025 m sodium phosphate buffer, pH 7.0, and the suspension was stored at 4 °C until further analyses. Leaf and hypocotyl tissue of healthy sunflower plants was treated in the same way and used as control. Sample quality was checked spectroscopically (A 260/A 280 ratio) and by RT‐PCR experiments using a universal primer set (18SF, 5′‐TACCTGGTTGATCCTGCCAGT‐3′; 18SR, 5′‐TTGATCCTTCTGCAGGTTCACCTAC‐3′; White et al., 1990) for eukaryotic organisms to exclude ribosomal RNA contamination. Healthy sunflower DNA, P. halstedii DNA and total RNA extracted from P. halstedii sporangia served as controls. Control DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA).

Protein extraction and characterization

The purified virions were dissociated by heating the samples twice to 95 °C for 5 min in 25 mm Tris buffer, pH 7.5, with 10 mm DTT and 2.5 µL PAGE loading buffer (Roti‐Load, Carl Roth, Karlsruhe, Germany) per 25 µL sample volume. Protein electrophoresis was performed on 13% polyacrylamide gels (60 V, 2.5 h, aqueous running buffer: 50 mm Tris, 384 mm glycine and 0.1% SDS, pH 8.3; Coomassie blue staining). Molecular markers (Precision Plus Protein Standards All Blue, Bio‐Rad, Hercules, CA) were used for sizing. In order to examine the identity and origin of the proteins, the resulting polypeptide bands were analysed after tryptic in‐gel digestion by MALDI‐TOF/TOF (Autoflex III, Bruker Daltonics) and UPLC‐ESI‐MS/MS (nano Acquity Ultra Performance Liquid Chromatography, Waters; coupled to an LTQ Orbitrap XL Fourier Transform Mass Spectrometer, Thermo Fisher Scientific) at the Core Facility of the Life Science Center at the University of Hohenheim.

Nucleic acid extraction, electrophoresis and characterization

Nucleic acid was extracted from purified virions using the Aurum Total RNA Mini Kit (Bio‐Rad, Hercules, CA) according to the manufacturer's instructions. RNA sample quality was checked spectroscopically (A 260/A 280 ratio). The size of the extracted RNA was determined by electrophoresis on native 1% agarose gels (1× TBE buffer; ethidium bromide staining). Before loading onto the gels, the samples were kept for 10 min at 70 °C with the loading dye (2× RNA Loading Dye; Fermentas, St. Leon‐Rot, Germany). ssRNA molecular markers (RNA ladder, high range, ready‐to‐use, Fermentas) were used as size standards and heated in the same way as the samples. The nucleic acid type was determined enzymatically (Hull, 1985) within 15 min at room temperature using 5 µg/mL RNase A (Ribonuclease A, Fermentas, Hanover, MO) in 2× SSC and 0.1× SSC, respectively (2× SSC: 0.3 m sodium chloride and 0.03 m sodium citrate in DEPC‐treated water, GIBCO, Invitrogen, Grand Island, NY; pH 7.0). Prior to gel electrophoresis, the RNA samples were desalted using the Aurum Total RNA Mini Kit. Except for the DNA digestion, which was omitted, all steps were carried out according to the manufacturer's instructions. Additionally, RT‐PCR experiments using virus‐specific primers (2‐r4 and 2‐f3) were conducted to confirm the nucleic acid type. Capillary electrophoresis was performed on an Agilent 2100 Bioanalyzer using the RNA 6000 Pico LabChip Kit (Agilent Technologies, Böblingen, Germany).

Primers, cDNA synthesis, PCR and sequencing

A ligation procedure was conducted which had the objective to elongate the viral RNA with known sequences. Adaptors (LiPB, 5′‐ACTAGGATCCAAGCTTGGAATTCGTACGTCTAGAGATATC‐3′ with a fluorescein blocked 3′ end; LiPC, 5′‐CTATAGAGATCTGCATGCTTAAGGTTCGAACCTAGGATCA‐3′ with an amino blocked 5′ end) as well as complementary primers were designed and synthesized. The experiment was carried out according to Weng and Xiong (1995). cDNA synthesis was conducted using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, St. Leon‐Rot, Germany) according to the manufacturer's instructions and n1LiPB primer (5′‐GATATCTCTAGACGTACGAATTC‐3′) and n1LiPC primer (5′‐ATAGAGATCTGCATGCTTAAG‐3′). cDNA was amplified by PCR (first denaturing: 94 °C, 3 min; 35 cycles of denaturing: 94 °C, 30 s, annealing: 56 °C for 45 s, elongation: 72 °C for 3.30 min; finale elongation: 72 °C for 6 min) using the primers n1LiPB and n1LiPC. As the first amplification did not result in visible bands on agarose gels (1% agarose gel; 1× TBE buffer; ethidium bromide staining), a nested PCR was conducted using the primers n2LiPB (5′‐CGTACGAATTCCAAGCTT‐3′) and n2LiPC (5′‐CTTAAGGTTCGAACCTAGGA‐3′). A single fragment, most likely a one‐primer product, was obtained which was cut out, cloned and amplified in Escherichia coli and sequenced in both directions using standard M13 primers. The deduced amino acid sequence from this PCR fragment was identical with amino acid sequences found by protein mass spectrometry of the purified viral coat protein (Fig. 5, framed parts). Virus‐specific primers (2‐r4 and 2‐f3) were designed based on this nucleic acid sequence. Viral RNA of six isolates was transcribed into cDNA using the primer 2‐r4 (5′‐CGAGACAGTTGCGTTGGA‐3′) and a First Strand cDNA Synthesis Kit (Fermentas, Hanover, MO). PCR was conducted using primer 2‐f3 (5′‐CTGGGTAGTGGAGACTACACA‐3′) and primer 2‐r4 (first denaturing: 94 °C, 1 min; 30 cycles of denaturing: 94 °C, 30 s, annealing: 50 °C for 1 min, elongation: 72 °C for 1 min; finale elongation: 72 °C for 10 min). After submitting the PCR product to agarose gel electrophoresis, a single fragment of 0.7 kb resulted which was cut off and directly sequenced using the primers 2‐f3 and 2‐r4, respectively. Thus, both strands were sequenced.

Sequence analysis

Sequence data were subjected to BLAST analysis and aligned using the software BioEdit (version 7.0.5.3; Hall, 1999). The GenBank accession number for SmV A RNA 2 is AB083061.

Supporting information

Fig. S1 RNA gel electrophoresis of enzymatic determination of RNA strandedness. An ssRNA marker (6000–200 nt) was used. 1: RNA in 2× SSC solution; 2: RNA in 2× SSC solution with RNase A; 3: RNA in 0.1× SSC solution; 4: RNA in 0.1× SSC solution with RNase A.

Fig. S2 (a) RNA gel electrophoresis after separation of RNA 1 and the RNA 2. An ssRNA marker (6000–200 nt) was used. 1: viral RNA 2; 2: viral RNA 1. (b) Reverse transcription followed by PCR using the primers RNA 2‐r4 and RNA 2‐f3. 3: non‐template control (water); 4: DNA product of RNA 2; 5: DNA product of RNA 2 (diluted 1 : 2); 6: DNA product of RNA 2 (diluted 1 : 4); 7: DNA product of RNA 2 (diluted 1 : 10); 8: DNA product of RNA 2; 9: DNA product of RNA 1 (diluted 1 : 2); 10: DNA product of RNA 1 (diluted 1 : 4); 11: DNA product of RNA 1 (diluted 1 : 10).

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (407.5KB, doc)

ACKNOWLEDGEMENTS

We thank Gladys E. Clemente, Balcarce, Argentina, and Dr Khalid Y. Rashid, Morden, Canada, for supplying the Argentinean and Canadian isolates, respectively. The advice and technical support of Dr Annerose Heller and Dr Artur J. P. Pfitzner, Stuttgart‐Hohenheim, Germany, is gratefully acknowledged. We thank Iris Klaiber and Dr Jens Pfannstiel, Stuttgart‐Hohenheim, Germany, for protein mass spectrometry. We also wish to thank Reinhard Zipper and Bärbel Rassow, Stuttgart‐Hohenheim, Germany, for their assistance.

†

The GenBank/EMBL/DDBJ accession numbers of the sequences reported in this paper are EU12690, EU12691, EU12692, EU12693, EU12694 and EU12695.

REFERENCES

  1. Buck, K.W. (1986) Fungal virology—an overview In: Fungal Viruses (Buck K.W., ed.), pp. 1–84. Boca Raton, FL: CRC Press Inc. [Google Scholar]
  2. Ghabrial, S.A. (1980) Effects of fungal viruses on their hosts. Annu. Rev. Phytopathol. 18, 441–461. [Google Scholar]
  3. Gillings, M.R. , Tesoriero, L.A. and Gunn, L.V. (1993) Detection of double‐stranded RNA and virus‐like particles in Australian isolates of Pythium irregulare . Plant Pathol. 42, 6–15. [Google Scholar]
  4. Gulya, T.J. (2007) Distribution of Plasmopara halstedii races from sunflower around the world. In: Advances in Downy Mildew Research, vol. 3, (Lebeda A. and Spencer‐Phillips P.T.N., eds), pp. 121–134. Czech Republic: Palacky University Ollomouc and JOLA, v.o.s., Kostelec na Hane. [Google Scholar]
  5. Gulya, T.J. , Freeman, T.P. and Mayhew, D.E. (1990) Virus‐like particles in Plasmopara halstedii, sunflower downy mildew. Phytopathology, 80, 1032. [Google Scholar]
  6. Gulya, T.J. , Freeman, T.P. and Mayhew, D.E. (1992) Ultrastructure of virus‐like particles in Plasmopara halstedii . Can. J. Bot. 70, 334–339. [Google Scholar]
  7. Hacker, C.V. , Brasier, C.M. and Buck, K.W. (2005) A double‐stranded RNA from a Phytophthora species is related to the plant endornaviruses and contains a putative UDP glycosyltransferase gene. J. Gen. Virol. 86, 1561–1579. [DOI] [PubMed] [Google Scholar]
  8. Hall, T.A. (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98. [Google Scholar]
  9. Honkura, R. , Shirako, Y. , Ehara, Y. and Yamanaka, S. (1983) Two types of virus‐like particles isolated from downy mildew diseased rice plants. Ann. Phytopath Soc. Jpn. 49, 653–658. [Google Scholar]
  10. Hull, R. (1985) Purification, biophysical and biochemical characterization of viruses with especial reference to plant viruses In: Virology—A Practical Approach (Mahy B.W.J., ed.), pp. 1–24. Oxford: IRL Press Ltd. [Google Scholar]
  11. Klassen, G.R. , Kim, W.K. , Barr, D.J.S. and Desaulniers, N.L. (1991) Presence of double‐stranded RNA in isolates of Pythium irregulare . Mycologia, 83, 657–661. [Google Scholar]
  12. Mayhew, D.E. , Cook, A.L. and Gulya, T.J. (1992) Isolation and characterization of a mycovirus from Plasmopara halstedii . Can. J. Bot. 70, 1734–1737. [Google Scholar]
  13. McCabe, P.M. , Pfeiffer, P. and Van Alfen, N.K. (1999) The influence of dsRNA viruses on the biology of plant pathogenic fungi. Trends Microbiol. 7, 377–381 [DOI] [PubMed] [Google Scholar]
  14. Newhouse, J.R. , Tooley, P.W. , Smith, O.P. and Fishel, R.A. (1992) Characterization of double‐stranded RNA in isolates of Phytophthora infestans from Mexico, the Netherlands and Peru. Phytopathology, 82, 164–169. [Google Scholar]
  15. Nuss, D.L. (2005) Hypovirulence: mycoviruses at the fungal‐plant interface. Nat. Rev. Microbiol. 3, 632–642. [DOI] [PubMed] [Google Scholar]
  16. Reynolds, E.S. (1963) The use of lead citrate at high pH as an electron‐opaque stain in electron microscopy. J. Cell Biol. 17, 208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Roos, U.P. and Shaw, D.S. (1985) Intranuclear virus‐like particles in a laboratory strain of Phytophthora drechsleri . Trans. Br. Mycol. Soc. 84, 340–344. [Google Scholar]
  18. Rozynek, B. and Spring, O. (2001) Leaf disk inoculation, a fast and precise test for the screening of metalaxyl tolerance in sunflower downy mildew. J. Phytopathol. 149, 1–4. [Google Scholar]
  19. Shirako, Y. and Ehara, Y. (1985) Composition of viruses isolated from Sclerophthora macrospora‐infected rice plants. Ann. Phytopath. Soc. Jpn. 51, 459–464. [Google Scholar]
  20. Spring, O. , Rozynek, B. and Zipper, R. (1997) Leaf disk inoculation—a useful tool for selecting infections of sunflower downy mildew at low inoculum concentration but inappropriate to pathotype characterization. J. Phytopathol. 145, 189–191. [Google Scholar]
  21. Spring, O. , Voglmayr, H. , Riethmüller, A. and Oberwinkler, F. (2003) Characterization of a Plasmopara isolate from Helianthus × laetiflorus based on cross infection, morphology, fatty acids and molecular phylogenetic data. Mycol. Prog. 2, 163–170. [Google Scholar]
  22. Styer, E.L. and Corbett, M.K. (1978) Intranuclear virus‐like particles of Phytophthora infestans and P. parasitica var. parasitica . Mycovirus Newslett. 6, 16–18. [Google Scholar]
  23. Tooley, P.W. , Hewings, A.D. and Falkenstein, K.F. (1989) Detection of double‐stranded RNA in Phytophthora infestans . Phytopathology, 79, 470–474. [Google Scholar]
  24. Tourvieille, L.D. , Gulya, T.J. , Masirevic, S. , Penaud, A. , Rashid, K.Y. and Viranyi, F. (2000) New nomenclature of races of Plasmopara halstedii (sunflower downy mildew). In: Proceedings of the 15th International Sunflower Conference, vol. 2(I), pp. 61–65. Toulouse: France. [Google Scholar]
  25. Varga, J. , Toth, B. and Vagvölgyi, C. (2003) Recent advances in mycovirus research. Acta Microbiol. Immunol. Hungarica, 50, 77–94. [DOI] [PubMed] [Google Scholar]
  26. Weng, Z. and Xiong, Z. (1995) A method for accurate determination of terminal sequences of viral genomic RNA. Genome Res. 5, 202–207. [DOI] [PubMed] [Google Scholar]
  27. White, T.J. , Bruns, S. , Lee, S. and Taylor, J.W. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics In: PCR Protocols: A Guide to Methods and Applications (Innis M.A., Gelfand D.H., Sninsky J.J. and White T.J., eds), pp. 315–322. New York: Academic Press. [Google Scholar]
  28. Yokoi, T. , Takemoto, Y. , Suzuki, M. , Yamashita, S. and Hibi, T. (1999) The nucleotide sequence and genome organization of Sclerophthora macrospora Virus B. Virology, 264, 344–349. [DOI] [PubMed] [Google Scholar]
  29. Yokoi, T. , Yamashita, S. and Hibi, T. (2003) The nucleotide sequence and genome organization of Sclerophthora macrospora Virus A. Virology, 311, 394–399. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 RNA gel electrophoresis of enzymatic determination of RNA strandedness. An ssRNA marker (6000–200 nt) was used. 1: RNA in 2× SSC solution; 2: RNA in 2× SSC solution with RNase A; 3: RNA in 0.1× SSC solution; 4: RNA in 0.1× SSC solution with RNase A.

Fig. S2 (a) RNA gel electrophoresis after separation of RNA 1 and the RNA 2. An ssRNA marker (6000–200 nt) was used. 1: viral RNA 2; 2: viral RNA 1. (b) Reverse transcription followed by PCR using the primers RNA 2‐r4 and RNA 2‐f3. 3: non‐template control (water); 4: DNA product of RNA 2; 5: DNA product of RNA 2 (diluted 1 : 2); 6: DNA product of RNA 2 (diluted 1 : 4); 7: DNA product of RNA 2 (diluted 1 : 10); 8: DNA product of RNA 2; 9: DNA product of RNA 1 (diluted 1 : 2); 10: DNA product of RNA 1 (diluted 1 : 4); 11: DNA product of RNA 1 (diluted 1 : 10).

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (407.5KB, doc)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES