Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2008 Feb 5;9(3):281–291. doi: 10.1111/j.1364-3703.2007.00462.x

Multi‐factor regulation of pectate lyase secretion by Colletotrichum gloeosporioides pathogenic on avocado fruits

I MIYARA 1,3, H SHAFRAN 2,3, H KRAMER HAIMOVICH 1,3, J ROLLINS 4, A SHERMAN 2, D PRUSKY 1,✉
PMCID: PMC6640356  PMID: 18705870

SUMMARY

Tissue alkalinization during Colletotrichum gloeosporioides attack enhances the expression of PELB, which encodes pectate lyase (PL), and PL secretion, which is considered essential for full virulence. We studied the regulation of PL secretion by manipulation of C. gloeosporioides PELB. PELB was down‐regulated by knocking out PAC1, which encodes the PacC transcription factor that regulates gene products with pH‐sensitive activities. We functionally characterized a PACC gene homologue, PAC1, from C. gloeosporioides wild‐type (WT) Cg‐14 and two independent deletion strains, Δpac1372and Δpac1761. Loss‐of‐function PAC1 mutants showed 85% reduction of PELB transcript expression, delayed PL secretion and dramatically reduced virulence, as detected in infection assays with avocado fruits. In contrast, PELB was up‐regulated in the presence of carbon sources such as glucose. When glucose was used as a carbon source in the medium for the WT strain and the Δpac1 mutant at pH 6.0, PELB transcript expression and PL secretion were activated. Other sugars, such as sucrose and fructose (but not galactose), also activated PELB expression. These results suggest that the pH‐regulated response is only part of a multi‐factor regulation of PELB, and that sugars are also needed to promote the transition from quiescent to active necrotrophic development by the pathogen.

INTRODUCTION

Colletotrichum gloeosporioides is a broad‐host‐range plant‐pathogenic fungus that secretes ammonia to alkalinize the host tissue (Drori et al., 2003). This alkalinization process strongly activates the expression of PELB, which encodes pectate lyase (PL), and the secretion of PL, which has been implicated as a virulence factor of C. gloeosporioides in avocado fruit (Drori et al., 2003; Wattad et al., 1997; Yakoby et al., 2001). Drori et al. (2003) have suggested that PL secretion is also influenced by nutritional signals, such as the presence of nitrogen. The regulation of nitrogen assimilation is complex, and is important for disease development (Marzluf, 1997). In several Colletotrichum species, nitrogen starvation stimulates synchronous pre‐infection development (Horowitz et al., 2006) and the expression of genes that affect appressorium differentiation and formation (Donofrio and Dean, 2005; Soanes et al., 2002). For C. gloeosporioides, the presence of a nitrogen source seems to be an important regulator of the expression of virulence factors. Nutritional deprivation of primary nitrogen sources has demonstrated that they are critical for PL secretion and fungal pathogenicity (Kramer‐Haimovich et al., 2006): PL secretion was observed only when there was a suitable environment (pH 6.0) as well as ammonia production. Increasing the amount of ammonia or glutamate added to the growth medium also increased PELB expression and PL secretion. Ammonia may therefore have two key functions: (1) tissue alkalinization, and (2) activation of PELB expression and PL secretion (Kramer‐Haimovich et al., 2006; Prusky et al., 2001; Yakoby et al., 2000).

Host alkalinization, which has been observed in avocado, apple, tomato and other infected fruit hosts (Prusky et al., 2001), represents the basic signal for activation of the pH‐dependent transcriptional regulator Pac1, which could modulate the activation of PELB and the secretion of PL. In the Aspergillus nidulans model system, the expression of genes encoding extracellular enzymes with differing pH optima has been shown to be governed by an ambient‐pH‐sensing signal‐transduction pathway consisting of at least six PAL gene products (Negrete‐Urtasun et al., 1999). The target for regulation by this pathway is the zinc finger transcription factor PacC. This system has been thoroughly reviewed recently (Peñalva and Arst, 2004). Within this regulatory circuit, PacC is positively regulated under alkaline pH conditions, to promote transcription of alkaline‐expressed genes and simultaneously repress the expression of acid‐expressed genes (Tilburn et al., 1995). The promoter regions of alkaline‐expressed genes contain multiple copies of the 5′‐GCCARG 3′ consensus site that are recognized by PacC (Espeso et al., 1997). Under acidic ambient pH, PacC is not activated. This system of gene regulation ensures that enzymes with pH‐sensitive activity are produced under environmental pH conditions that favour their effective functioning.

Loss‐of‐function mutants of PACC in A. nidulans produce a constitutive acid‐expressing phenotype that is characterized by increased acid phosphatase and decreased alkaline phosphatase activities, decreased sensitivity to aminoglycoside antibiotics, increased sensitivity to molybdate and lack of growth at alkaline pH (Arst et al., 1994; Caddick et al., 1986; Díez et al., 2002; Espeso et al., 2000; Orejas et al., 1995). Dominant activating mutations of PACC reverse these effects (Caddick et al., 1986; Espeso et al., 1993; Shah et al., 1991). Homologues of PACC have been isolated and characterized from ascomycete fungi closely related to A. nidulans, including Aspergillus niger and Penicillium chrysogenum (MacCabe et al., 1996; Suárez and Peñalva, 1996) and from the cephalosporin‐producing ascomycete, Acremonium chrysogenum (Schmitt et al., 2001). A PACC homologue has been identified in Sclerotinia sclerotiorum, based on sequence homology and functional complementation of an A. nidulans PACC‐null strain (Rollins and Dickman 2001).

As PL secretion is transcriptionally regulated by pH in C. gloeosporioides, it has been suggested that Pac1, which mediates the expression of the pH‐regulated gene, is present in this fungus and that it modulates PELB (Denison, 2000; Drori et al., 2003; Ramon et al., 1999, Shah et al., 1991). Drori et al. (2003) showed that five repeats of the sequence GCCAAG, the core binding site for PACC, are found in the PELB promoter sequence. These repeats are situated at positions –547, –493, –410, –368 and –262, relative to the translation‐initiation codon (ATG).

The goals of the present study were to elucidate the different factors modulating PL secretion and C. gloeosporioides pathogenicity. Our results suggest that the C. gloeosporioides loss‐of‐function PAC1 mutant exhibits diminished PL secretion, limiting the colonization of avocado fruits. In addition to ammonia, the importance of which has been discussed previously (Kramer‐Haimovich et al., 2006), the sugars that become available during ripening of the attacked host fruit are key factors in promoting C. gloeosporioides pathogenicity. We hypothesize that pH, sugar and nitrogen are independent signals for the transcriptional regulation of genes required for the pathogenicity process of C. gloeosporioides and for the transition from the quiescent‐biotrophic to necrotrophic stage of Colletotrichum colonization.

RESULTS

Characterization of Δpac1 mutants

Out of 140 transformants, only two independent hygromycin‐resistant mutants (Δpac1372 and Δpac1761) showed correct integration into the PAC1 gene (Shafran et al., 2007b; Fig. 1). A series of mutants that included those with the ectopic integration construct (a control for PAC1 integration) or the PAC1 overexpression construct (that positively modulates the PAC1‐affected genes) (for details see Experimental procedures) were used for further tests. When the fungus was grown on M3S medium, no differences in mycelial growth were evident between the wild‐type (WT; isolate Cg‐14) and the Δpac1372or Δpac1761 gene‐deletion mutants. Spore germination and appressorium formation did not differ between the WT progenitor and mutant strains. To determine whether the Δpac1 mutation affects the growth response to external pH, the radial growth rates of the WT and two Δpac1 mutants were examined on buffered potato–dextrose agar (PDA) media. The radial growth rates of the WT and Δpac1372 strain were similar at pH 4.0 (Fig. 2), but at pH 6.0 and 8.0, that of the mutant was inhibited by 32 and 44%, respectively, compared with the WT. Similar inhibition at pH 6.0 and 8.0 (31.5 and 45%, respectively) was observed with the Δpac1761mutant. Transformants with the ectopic integration or the PAC1 overexpression construct exhibited growth similar to that of the WT throughout the pH range. In addition, the Δpac1372and Δpac1761 transformants showed 63% (0.041 ± 0.01 U/mg protein) and 65% (0.038 ± 0.01 U/mg protein) inhibition in the secretion of alkaline phosphatase into the culture media at pH 6.0 relative to the WT (0.108 ± 0.03 U/mg protein). The ectopic‐integration transformant showed alkaline phosphatase activity similar to that of the control (0.096 ± 0.04 U/mg protein) while the PAC1‐overexpressing transformant showed an increase of 39% (0.151 ± 0.01 U/mg protein) in alkaline phosphatase secretion. The WT and the Δpac1372and Δpac1761 transformants did not differ in the amounts of ammonia they secreted into the medium, or in their alkalinization process.

Figure 1.

Figure 1

Open in a new tab

Schematic representation of homologous recombination events with replacement of the full‐length (13 bases upstream of the ATG to the stop codon) PAC1 gene (position 925–2778) of C. gloeosporioides with the hygromycin‐resistance gene cassette HygR flanked by 5′ (position 108–924) and 3′ (position 2779–3485) PAC1 genomic fragments. The HygR gene cassette includes the promoter and terminator of the TRPC gene of Aspergillus nidulans flanking the coding region of the hphB gene of Escherichia coli.

Figure 2.

Figure 2

Open in a new tab

Radial growth of wild‐type and Δpac1372 mutant strains on PDA‐citrate phosphate buffer (0.1 m) at pH values ranging from 4 to 8. Colony diameters were measured 3 days after inoculation. Each point represents the mean diameter ± the standard deviation of three independent colonies.

The mesocarp and pericarp of avocado fruit were inoculated to determine the effect of PAC1 loss‐of‐function on pathogenicity. By 3 days post‐inoculation, the WT strain had induced decay on the avocado mesocarp, whereas almost none had been induced by the Δpac1372 or Δpac1761 mutants (Fig. 3A), and by 7 days post‐inoculation the diameter of the lesion induced by the Δpac1372 and Δpac1761 mutants had grown to 5 and 6 mm, respectively, compared with 21.5 mm for that induced by the WT strain (Fig. 3B) and the ectopic364 integrated‐construct strain. A similar pattern of decay inhibition was observed when the WT, ectopic364, Δpac1372 and Δpac1761 mutants strains were applied to intact fruits and observed 7 days after inoculation (Fig. 3A). Strong transcript expression levels of PELB and PAC1 were found in the decayed mesocarp tissue inoculated by the WT and ectopic364 strains, compared with their minor expression with the Δpac1372 mutant (Fig. 3C). No PELB or PAC1 was detected in uninoculated fruits.

Figure 3.

Figure 3

Open in a new tab

Pathogenicity assays of C. gloeosporioides wild‐type, ectopic and Δpac1 mutant strains. (A) Decay development of wild‐type, ectopic‐integrated construct and mutant strains after inoculation of peeled (on the mesocarp) or unpeeled (on the pericarp) freshly harvested avocado fruits. (B) Decay development on avocado fruit mesocarp tissue infected by wild‐type, ectopic364, Δpac1372 and Δpac1761 strains. (C) Relative expressions of PELB and PAC1 in the decayed mesocarp of infected avocado fruit tissue. For decay development assessment, spores of the four strains were inoculated in holes (1 mm deep and 5 mm diameter) in the peeled fruits or placed directly on the pericarp, and the inoculated fruits were incubated at 25 °C under high humidity. Pictures were taken 3 and 7 days after inoculation of the mesocarp and pericarp, respectively. The average data for ten infected fruits are reported. For PELB and PAC1 expression, the relative expression values obtained by quantitative RT‐PCR normalized against 18S rRNA are the averages ± standard deviations, obtained from three replications of the treatment.

Previous studies have shown that accumulation of PELB transcript is promoted by an alkaline growth environment (Yakoby et al., 2001; Drori et al., 2003). When the levels of PAC1 transcript were compared with PL accumulation by the WT, the Δpac1 strains, an ectopic strain and a PAC1‐overexpressing strain, a direct relationship was found between the level of PAC1 transcript in each strain and the molecular phenotypic fungal response of PL accumulation (Fig. 4). To determine more specifically the effect of the PAC1 loss‐of‐function mutation on PELB transcription and PL accumulation, the transcript and PL accumulation levels were compared between WT and Δpac1372strains after 7 and 15 h of incubation at pH 6.0. Seven hours after transfer of the Δpac1 hyphae from the primary to the secondary inducing media, no PELB expression or PL secretion were detected, whereas PL was already being secreted by the WT strain (Fig. 5). Eight hours later, the Δpac1372mutant still showed a significantly lower level of PELB expression than the WT, but PL secretion by the mutant was detected (Fig. 5).

Figure 4.

Figure 4

Open in a new tab

Relative expression of PAC1 and PL secretion by the wild‐type, Δpac1372 and Δpac1761 mutants, an ectopic integrated‐construct strain (Ectopic364) and a PAC1‐overexpressing strain overexpress7 of C. gloeosporioides at pH 6.0, 16 h after transfer of the growing hyphae from the primary medium to the secondary inducing medium. The relative expression values obtained by quantitative RT‐PCR normalized against 18S rRNA are the averages ± standard deviations from three replications of the treatment. Western blot analyses were repeated three times and quantified by TINA 2.0 software (raytest Isotopenmeβgerate GmbH); results of a representative experiment are presented (bottom).

Figure 5.

Figure 5

Open in a new tab

Relative expression of PAC1 and PELB and PL secretion by the wild‐type and Δpac1372 mutant strains of C. gloeosporioides at pH 6.0. (A) Expression of PAC1. (B) Expression of PELB. (C) PL secretion. Relative expression was detected by RT‐PCR 7 and 15 h after transfer of the growing hyphae from the primary medium to the secondary inducing medium. The relative expression values normalized against 18S rRNA are the averages ± standard deviations of three replications of the treatment. Western blot analyses were repeated three times, and results from a representative experiment are presented.

Effect of glucose on up‐regulation of PELB gene expression at pH 6.0

To determine whether the effect of carbon source on PELB transcript levels was independent of PAC1 regulation, PL secretion levels were compared in the presence of 1% avocado cell wall or 50 mm glucose, in the WT strain and in the Δpac1372 mutant strain. The presence of glucose enhanced PL secretion in both the Δpac1 mutant and WT strains (Fig. 6). Growth of the Δpac1372 mutant at glucose concentrations of 0, 25, 50 and 100 mm enhanced PELB transcript expression by 6‐, 8‐ and 26‐fold, respectively, and also increased PL secretion (Fig. 7).

Figure 6.

Figure 6

Open in a new tab

Effect of carbon sources in the culture media on PL secretion by C. gloeosporioides wild‐type and Δpac1372 mutant strains. Avocado cell wall (1%, w/v) or 50 mm glucose was added to the inductive secondary medium as the carbon source. PL accumulation was detected 15 h after transfer of the growing hyphae from the primary medium to the secondary inducing medium. Western blot analyses were repeated three times, and results from a representative experiment are presented.

Figure 7.

Figure 7

Open in a new tab

Effect of glucose concentration on the induction of PL secretion and PELB expression by the C. gloeosporioidesΔpac1372 mutant strain. Relative gene expression was determined by RT‐PCR, and PL secretion was detected 15 h after transfer of the growing hyphae from the primary medium to the secondary inducing medium at pH 6.0. The relative expression values normalized against 18S rRNA are the averages ± standard deviations of three replications of the treatment. Western blot analyses were repeated three times; results from a representative experiment are presented.

Glucose enhanced PL secretion when added to several other less efficient carbon sources for C. gloeosporioides growth. Secretion of PL was always enhanced by the addition of 50 mm glucose when the WT strain was grown in the presence of galacturonic acid (GA), polygalacturonic acid (PGA) or pectin (Fig. 8A). Levels of PELB transcripts and PL secretion were also enhanced in the presence of single sugars such as fructose, but not by galactose (Fig. 8B).

Figure 8.

Figure 8

Open in a new tab

Relative expression of PELB and PL secretion by C. gloeosporioides in the presence of different carbon sources added to the secondary inducing medium at pH 6.0. (A) Effect on PL secretion of galacturonic acid (GA, 1%), polygalacturonic acid (PGA, 1%) or pectin (1%), with or without glucose. (B) Effect of glucose, fructose or galactose on PELB expression and PL secretion. The relative expression values are the averages ± standard deviations of three replications of the treatment. Western blot analyses were repeated three times; results from a representative experiment are presented.

Multiple signals regulate PL secretion

When the WT strain was grown in the presence of glucose, a nitrogen source (NO3) or both at pH 4.0, no secretion of PL was detected (Fig. 9). PL was not detected if the fungus was grown at pH 6.0 with the addition of glucose or KNO3; it was secreted only when the fungus was grown at pH 6.0 in the presence of both glucose and a nitrogen source (Fig. 9).

Figure 9.

Figure 9

Open in a new tab

Effect of the combination of pH, nitrogen and glucose on the secretion of PL by C. gloeosporioides. PL secretion was assayed 15 h after transfer of the growing hyphae from the primary medium to the secondary inducing medium in the presence of various combinations of pH, and nitrogen and carbon sources. Western blot analyses were repeated three times; results of a representative experiment are presented.

DISCUSSION

PAC1 deletion in C. gloeosporioides and its effect on pathogenicity

Previous studies (Drori et al., 2003) have shown that the expression of PELB, which encodes PL, a key factor for pathogenicity of C. gloeosporioides in avocado, is up‐regulated under alkaline conditions and during pathogenicity, in parallel to the expression of PAC1. As a first step in analysing the functional regulation of PELB by the transcription factor PACC, the encoding gene, PAC1 from C. gloeosporioides, was cloned (Kramer‐Haimovich et al., 2006). Targeted gene deletion in WT C. gloeosporioides resulted in two independent PAC1 loss‐of‐function mutants; these mutations showed no effect on germination or appressorium formation, but at pH 6.0 and 8.0, the growth of the mutants was reduced by 32 and 44%, respectively, compared with that of the WT. The Δpac1 372 and Δpac1761mutants also showed an average 64% inhibition of alkaline phosphatase activity compared with the WT. This differential physiological response of PACC mutants was similar to those found for S. sclerotiorum (Rollins, 2003), Fusarium oxysporum (Caracuel et al., 2003) and Colletotrichum acutatum (You et al., 2007).

The attenuated virulence of the two Δpac1 mutants clearly suggests that the pH‐responsive gene expression acts as a significant molecular regulator of pathogenicity in this pathogen. A comparison of the decreases in virulence of the ΔpelB (Yakoby et al., 2001) and the Δpac1 mutants relative to that of the WT (c. 40 and 72%, respectively) suggests that deletion of PAC1 further reduces fungal colonization by about 32%. These results suggest that other genes, in addition to PELB, that are regulated by PAC1 contribute to the development of C. gloeosporioides decay in avocado fruit. The full range of genes and processes regulated by PAC1 in C. gloesporioides is unknown, but the possibility of significant roles of other factors in C. gloeosporioides virulence, in addition to those revealed by Δpac1 deletion, cannot be discounted (Caddick et al., 1986; Flaherty et al., 2003; Lahey et al., 2004; Li and Mitchell 1997; Li et al., 2003; You et al., 2007). Our results are consistent with a decrease in PL production accounting for virulence attenuation.

PELB gene regulation in C. gloeosporioides

The role of Pac1 as a regulator of the response of C. gloeosporioides gene expression to ambient pH is supported by the observation that PL accumulation at pH 6.0 is reduced in the Δpac1 loss‐of‐function mutants. However, two observations add to the perceived complexity of PELB regulation, and indicate that PAC1 is not the only regulator of PELB expression and PL production in C. gloeosporioides (Peñalva and Arst, 2002). The first is that although accumulation of PELB transcripts was greatly reduced in the Δpac1372loss‐of‐function mutant, PL secretion increased in the mutant and in the WT strain at pH 6.0, when grown in the presence of glucose as a carbon source. Second, glucose induced PELB expression and PL secretion in the Δpac1372mutant, whereas no PAC1 expression was observed. These results suggest that although Pac1 is an important factor for pathogenicity under alkaline pH, a combination of environmental factors, including sugar sources, might be of great importance for the activation of pathogenicity genes.

The investigation of pathogenicity regulation by carbon nutrition has primarily focused on repression of cell‐wall‐degrading enzymes by carbon catabolites (Dean and Timberlake, 1989; Gómez‐Gómez et al., 2002; Reymond‐Cotton et al., 1996; Tonukari et al., 2000; Wubben et al., 2000). CREA is a major regulatory gene of carbon catabolites in filamentous fungi, and is functionally homologous to MIG1 from yeast. Transcriptional regulators belonging to this class function in the presence of glucose, to repress genes required for the uptake and catabolism of more complex carbon sources. In the above studies, analysis of the PELB promoter could not detect the presence of a CREA‐binding sequence. In the present study, glucose not only did not repress PELB, it significantly enhanced PELB expression and PL secretion, indicating that the ability to sense and respond properly to ambient carbon can modulate virulence in phytopathogenic fungi. Moreover, in C. gloeosporioides f. sp. malvae, the gene PNL1, encoding pectin lyase, was induced by pectin and glucose, whereas PNL2 was induced mainly by mallow cell‐wall extracts (Wei et al., 2002). The basis for this differential gene activation by glucose in C. gloeosporioides has not been elucidated. Glucose behaves as a positive regulator of genes in general and of fungal pathogenicity genes in particular. In Saccharomyces cerevisiae, a glucose‐activated transcription factor, AZF1, was found to be a positive regulator of CLN3 G1 cyclin; this activation involved a set of DNA elements with the sequence AAGAAAAA (A2GA5) (Newcomb et al., 2002). In the present study, we found the specific antisense sequence T2CT5 in the C. gloeosporioides PELB promoter at –57 bp from the ATG. In addition, the yeast protein Azf1 functions as a glucose‐dependent transcriptional activator in yeast (Newcomb et al., 2002), which could account for the specific activation of PELB and PNL1.

Why is glucose activation important for Colletotrichum pathogenicity? Clear differences in gene expression levels of cell‐wall‐degrading enzymes have been observed among members of the BCPG gene family of Botrytis cinerea (Wubben et al., 1999, 2000): expression of some members of the gene family (BCPG3 and 5) was predominantly exhibited in the presence of glucose. Coordinated regulation of gene expression can be envisaged to occur during infection of plants and fruits: endoPGs from constitutively expressed genes might release pectin‐degradation products, which could induce the expression of other endoPG‐encoding genes. This may be the case in several host fruits when attacked by pathogens such as Colletotrichum; during ripening of these fruits, the complex carbohydrates are transformed to simpler sugars such as sucrose, glucose and fructose, which induce PELB expression and PL secretion.

The regulation of pathogenicity in Colletotrichum, however, is even more complex, because it is also affected by nitrogen availability. Previous analyses of global, environment‐responsive pathogenicity regulators in Colletotrichum have also focused on signalling pathways and regulatory factors involved in nitrogen uptake and utilization (Drori et al., 2003; Pellier, et al., 2003). The dynamic ambient pH environment induced by several Colletotrichum species, which, during host infection, secrete sufficient ammonia to raise the ambient pH, also induces PELB expression and PL secretion (Kramer‐Haimovich et al., 2006). In Magnaporthe grisea, NPR1 and NPR2, which are involved in nitrogen utilization, are also required for expression of the pathogenicity‐related hydrophobin gene MPG1 (Lau and Hamer 1996). The loss‐of‐function mutation in NPR1 or NPR2 results in severely attenuated pathogenicity. These findings, together with those of Drori et al. (2003) and Kramer‐Haimovitch et al. (2006), suggest that global nitrogen‐regulating genes are also important for the regulation of virulence factors and pathogenicity (Pérez‐Garcia et al., 2001).

The finding of joint or multi‐factor regulation of a single pathogenicity gene by several different environmental factors is not new, but most reported examples involve complex combinations of positive and negative regulation. Expression and secretion of Acp1 protease by S. sclerotiorum, and secretion of PepA and PepB by A. niger are induced under glucose and nitrogen starvation, but are inhibited under alkaline conditions (Jarai and Buxton, 1994; Poussereau et al., 2001). Espeso et al. (1993) has shown that although transcription of the A. nidulans gene encoding isopenicillin N synthase during the synthesis of penicillin is under the control of the pH regulatory system mediated by the PacC protein, external alkaline pH overrides carbon regulation. In contrast to penicillin synthesis, aflatoxin production by A. nidulans increases in glucose‐ and ammonium‐based media and decreases in nitrate‐based media, but in this case, too, an external alkaline pH overrides carbon regulation (Keller et al., 1997). In contrast, PELB regulation, as observed in the present study, is unique in its joint involvement with alkaline pH, glucose and nitrogen in the activation of PELB transcription.

What is the significance of this joint regulation of PELB? The involvement of several different factors in PL regulation and secretion is indicative of the wide range of tools used by the fungus to exert its pathogenicity in the fruit. The active accumulation of ammonia at the leading edge of the infection court is the first factor contributing to the activation of fungal pathogenicity by providing optimal pH. This early process, together with local enhancement of fruit ripening, could contribute to the availability of the sugar and nutritional conditions that lead to the enhanced activation of PELB expression. Alteration of ammonia secretion and pH‐regulated processes could form the basis for a viable strategy to delay the transformation from the quiescent‐biotrophic to necrotrophic stage of fungal colonization (Eshel et al., 2002; Prusky et al., 2001), and thereby reduce or prevent disease development by this plant‐pathogenic fungus.

EXPERIMENTAL PROCEDURES

Construction of plasmids

The full sequence of PAC1 was obtained from Dr Jeffrey Rollins (Gainesville, FL; accession no. EF585491). Full deletion of PAC1 from 13 bases upstream of the ATG (position 925) to the stop codon (position 2879) was created by using hphB driven by the TRPC promoter and terminator from plasmid pGEM:hyg (Horowitz et al., 2006) as a selectable marker. The hygromycin marker (HygR) was flanked by an upstream sequence (108–925) and a downstream sequence (2879–3486) of the PAC1 gene (Fig. 1). The construct was assembled with the Multi Site Gateway Three‐Fragment Vector Construction Kit (Invitrogen, Carlsbad, CA). Full details of the development of this method are described elsewhere (Shafran et al., 2007a,b). The construct was transformed into C. gloeosporioides by electroporation (Yakoby et al., 2001). The transformants were regrown as single colonies on M3S agar with hygromycin B (70 mg/L), and DNA was extracted with the Master Pure Yeast Purification Kit (Epicenter Biotechnologies, Madison, WI). Two colonies out of 140 transformants were found to be positive by PCR and were identified as positive for PAC1 deletion: Δpac1 372 and Δpac1761. Single colonies of these deletion candidates were grown, and DNA was extracted from them. Southern analyses of these colonies revealed full deletion of PAC1, and this was confirmed by sequencing of the deletion area in the genome (Shafran et al., 2007a,b).

To create an overexpression construct, we used the pSilent1 plasmid (Nakayashiki et al., 2005), obtained from the Fungal Genetic Stock Center. In the first stage, a Gateway conversion cassette A (Invitrogen 11828‐029, Carlsbad, CA) was inserted into the XhoI site of Silent1, which was blunted by Klenow reaction. In the next stage, we deleted the intron that exists in pSilent1 by cutting the plasmid with SphI and BglII, and blunting the ends by Klenow reaction and self‐ligation. The new overexpression plasmid (FGOE1) can express fungal proteins under the TRPC promoter. A dominant truncated PAC1 that mimics the pac481 mutation (Caracuel et al., 2003) was created by using oligos, PAC1 attB1‐5′ GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTCCACCAAGCAAGAACAC and pac1 stop2520 attB2 3′ GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTCGTTGCTGTCGAAGCTGGGTCC. The PCR product was cloned into FGOE1 using standard Gateway protocols (Invitrogen). When the fungus was grown on M3S medium, no differences in mycelial growth were evident between the WT (isolate Cg‐14) and two overexpressing mutants (overexpress7, overexpress2).

Fungal isolates, media and growth conditions

Single‐spore cultures of a Cg‐14 isolate of C. gloeosporioides, obtained from a decayed avocado fruit (Persea americana cv. Fuerte) in Israel, were routinely cultured on M3S agar (Tu, 1985) containing 250 mg/L chloramphenicol. To determine sensitivity to pH, the fungus was grown on PDA medium (Difco, Detroit, MI) buffered to the desired pH level with 0.1 m citrate‐phosphate buffer. The fungus was also grown in 40 mL M3S liquid medium at pH 5.0, at an inoculation density of 1 × 106 spores per flask. The M3S medium contains the following reagents (per litre): 2.5 g MgSO4.7H2O, 2.7 g KH2PO4, 1.5 g Bacto peptone, 1.5 g Bacto yeast extract (Difco), 15 g sucrose and 250 mg chloramphenicol (primary medium). The cultures were incubated at 22–24 °C in a shaking incubator at 150 r.p.m. for 4 days, and were harvested by filtration through a sterile Büchner funnel fitted with filter paper. The hyphal mat was washed twice with 40 mL of sterile distilled water. To determine the amount of PL protein accumulation, the washed mycelia were resuspended in 40 mL of fresh medium (secondary inducing medium) containing the following reagents (per litre): 4 g K2HPO4, 2 g MgSO4·7H2O, 5 g KNO3, 0.3 g CaCl2·2H2O, 10 mg FeCl3 and a carbon source [50 mm glucose, fructose or galactose, or 1% avocado cell wall, galacturonic acid (GA), PGA or pectin]. The medium was buffered with 50 mm phthalate‐hydroxide buffer (Sigma, St Louis, MO) to obtain an initial pH between 4.0 and 7.0. The initial pH for each flask was determined after the medium had been autoclaved, but prior to inoculation. For alkaline phosphatase detection, the washed mycelia were resuspended in 40 mL limiting‐phosphate medium (Dorn, 1965) containing (per litre): 6 g NaNO3, 0.52 g MgSO4·7H2O, 0.52 g KCl, 10 g dextrose, 1 g trishydroxymethyl‐aminomethane, 0.03% (w/v) Difco casamino acids, zinc and iron traces, adjusted to pH 7.4 with 4 n HCl. The experiments were repeated at least three times, and the results of a single representative experiment are shown here. Differences between experiments in the average values for each treatment did not exceed 2–3%.

pH measurement and ammonia detection

The pH was measured in 0.5‐mL aliquots that were sampled at various times after fungal inoculation, with a Termo‐Orion Model 9810BN microcombination pH electrode (Thermo Fisher Scientific, Inc. Waltham, MA). Ammonia was detected with an ammonium test kit (Merck, Darmstadt, Germany), by means of a colorimetric reaction. Samples (0.5 mL) of the culture media were diluted with 4.5 mL double‐distilled water, and the concentration of ammonia was determined according to the manufacturer's instructions. In brief, the sample containing ammonium was adjusted to pH 13 so that the ammonium was transformed to ammonia, which could be detected in the colorimetric reaction. Concentrations were reported as millimole ammonia.

Fruits, ripening parameters and fruit treatments

Freshly harvested avocado fruits, cv. ‘Fuerte’, from an orchard at Kibbutz Givat Brenner, Israel, were used for treatment and inoculations. When fruits were inoculated on the peel, 7 µL of a conidial suspension (106 conidia/mL) was placed on each of five longitudinally spaced inoculation spots on each side of each of ten different fruits per treatment, i.e. 100 inoculation replicates per treatment. When fruits were inoculated on the mesocarp, a 1‐ to 2‐mm strip of peel tissue was removed from the fruit and an amount of suspension similar to that used for the peel inoculation was placed on each of three small holes (1 mm deep and 5 mm wide) in the underlying tissue, on each side of each of ten different fruits per treatment, i.e. 60 inoculation replicates per treatment. Following inoculation, the fruits were incubated at 22 °C and 95% relative humidity for 24 h in covered plastic containers containing wet paper towels. They were then transferred to ambient (70–80%) relative humidity at 22 °C until they ripened, and symptom development was monitored (Prusky et al., 2001). The average decay diameter for ten fruits is reported. The inoculation experiments were repeated three times.

Detection of PL and alkaline phosphatases in liquid medium

Hyphae grown on secondary media were separated by filtration (see above), washed twice with sterile water, frozen with liquid N2, lyophilized and stored at –80 °C pending extraction of RNA or protein. The culture medium filtrate was concentrated to 5 mL at 30 °C on a Rotavapor (BÜCHI Labortechnik AG, Switzerland), dialysed for 24 h against 5 L of 50 mm Tris‐HCl, pH 8.5, with a SnakeSkin pleated dialysis tube (Pierce Biotechnology, Rockford, IL) with a cutoff at a molecular weight of 10 000, reconcentrated to 1 mL, lyophilized and resuspended in 150 µL of sterile water. Protein samples were quantified by the Bradford reagent (Bio‐Rad, Munich, Germany) protein assay, with bovine serum albumin (Sigma) as the standard. A Mini‐Protean II 12.5% sodium dodecyl sulphate‐polyacrylamide gel (Bio‐Rad) was loaded with 2.5‐µg aliquots of secreted proteins and run for 1.5 h at a constant 100 V. Western blot analysis was performed with PL antiserum as described elsewhere (Bradford, 1976; Yakoby et al., 2000, 2001). The blot analyses were repeated three times with similar results; the results from one representative experiment are presented here.

Alkaline phosphatase activity was detected by staining with nitro blue tetrazolium‐5‐bromo‐4‐chloro‐3‐indolyl phosphate (NBT‐BCIP) (Promega, Madison, WI). Concentrated culture medium was dialysed and concentrated as described above, and 10 µg of total protein, included in 1 mL of the reaction mixture containing 3.3 µL BCIP and 6.6 µL NBT in alkaline phosphatase buffer (100 mM Tris, pH 9.5, 100 mM NaCl and 5 mM MgCl2) was used. The colour change caused by the alkaline phosphatase activity was measured at 660 nm, and the alkaline phosphate activity was determined by comparing the activity of the sample with that produced by the pure enzyme (Promega), as determined by means of a calibration curve. Units were expressed as alkaline phosphatase activity per milligram of total protein.

RNA extraction and real‐time PCR analysis

RNA was extracted from 80 mg (dry weight) of mycelium or dry infected avocado mesocarp with an RNeasy Plant mini kit (QIAGEN Sciences, Hilden, Germany) and further purified by treatment with TURBO DNA free (Ambion, Austin, TX). The reverse‐transcription reaction was performed on 10 µg of total RNA with the Reverse‐It first‐strand synthesis kit (ABgene, Surrey, UK). Samples of cDNA were diluted 1 : 10 (v/v) to the final template concentration for real‐time PCR. Real‐time quantitative PCR was performed with the RotorGene 3000 system (Corbett Research, Sydney, Australia). PCR amplification was performed with 3.5 µL of cDNA template in 10 µL of a reaction mixture containing 5 µL Syber‐Green Amplification Kit (ABgene, Surrey, UK) and 300 nm of primers. PCR conditions were: initial denaturation for 15 min at 94 °C, 40 denaturation cycles of 10 s at 94 °C, annealing at 60 °C for 15 s, extension at 72 °C for 20 s, and melting at 72–95 °C. The samples were subjected to melting‐curve analysis with the RotorGene program. All samples were normalized to 18S rRNA gene levels in the same real‐time quantitative PCR, and the values were expressed as the increase/decrease of the levels relative to a calibrator sample. The forward and reverse primers for PELB were, respectively, 5′‐CCGTCTTCTCCGACACCAA‐3′ and 5′‐CGAGGTCGACGTCATTGACA‐3′, those for PAC1 were, respectively, 5′‐CACGTCGCTCACACTCCTAGAC‐3′ and 5′‐AGCCGTTCATCCCCTGGT‐3′, those for 18S rRNA were, respectively, 5′‐AGCATTCTGGCGGGCAT‐3′ and 5′‐AGCTGTAGGGCCCCAACAC‐3′; each experiment was repeated three times with similar results; the results of one experiment are presented.

REFERENCES

  1. Arst, H.N. Jr , Bignell, E. and Tilburn, J. (1994) Two new genes involved in signaling ambient pH in Aspergillus nidulans . Mol. Gen. Genet. 245, 787–790. [DOI] [PubMed] [Google Scholar]
  2. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein‐dye binding. Anal. Biochem. 72, 248–254. [DOI] [PubMed] [Google Scholar]
  3. Caddick, M.X. , Brownlee A.G. and Arst, H.N. Jr. (1986) Regulation of gene expression by pH of the growth medium in Aspergillus nidulans . Mol. Gen. Genet. 203, 346–353. [DOI] [PubMed] [Google Scholar]
  4. Caracuel, Z. , Roncero, M.I.G. , Espeso, E.A. , González‐Verdejo, C.I. , García‐Maceira, F.I. and Di Pietro, A. (2003) The pH signalling transcription factor PacC controls virulence in the plant pathogen Fusarium oxysporum . Mol. Microbiol. 48, 765–779. [DOI] [PubMed] [Google Scholar]
  5. Dean, R.A. and Timberlake, W.E. (1989) Regulation of the Aspergillus nidulans pectate lyase gene (pelA ). Plant Cell, 1, 275–284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Denison, S.H. (2000) pH regulation of gene expression in fungi. Fungal Genet. Biol. 29, 61–71. [DOI] [PubMed] [Google Scholar]
  7. Díez, E. , Álvaro, J. , Espeso, E.A. , Rainbow, L. , Suárez, T. , Tilburn, J. , Arst, H.N. Jr and Peñalva, M.A. (2002) Activation of the Aspergillus PacC zinc‐finger transcription factor requires two proteolytic steps. EMBO J. 21, 1350–1359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Donofrio, N. and Dean, R.A. (2005) Gene regulation during nitrogen stress and invasive plant growth in the rice blast pathosystem. Presented at the 23rd Fungal Genetics International Conference, Asilomar, Calif.
  9. Dorn, G. (1965) Genetic analysis of the phosphatases in Aspergillus nidulans . Genet. Res. 6, 13–26. [DOI] [PubMed] [Google Scholar]
  10. Drori, N. , Kramer‐Haimovich, H. , Rollins, J. , Dinoor, A. , Okon, Y. , Pines, O. and Prusky, D. (2003) A combination of external pH and nitrogen assimilation affects secretion of the virulence factor pectate lyase by Colletotrichum gloeosporioides. Appl. Environ. Microbiol. 69, 3258–3262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Eshel, D. , Miyara, I. , Ailing, T. , Dinoor, A. and Prusky, D. (2002) pH regulates endopolyglucanase expression and virulence of Alternaria alternata in persimmon fruit. Mol. Plant–Microbe Interact. 15, 774–779. [DOI] [PubMed] [Google Scholar]
  12. Espeso, E.A. , Tilburn, J. , Arst, H.N. Jr and Peñalva, M.A. (1993) pH regulation is a major determinant in expression of a fungal penicillin biosynthetic gene. EMBO J. 12, 3947–3956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Espeso, E.A. , Tilburn, J. , Sánchez‐Pulido, L. , Brown, C.V. , Valencia, A. , Arst, H.N. Jr and Peñalva, M.A. (1997) Specific recognition by the Aspergillus nidulans three zinc‐finger transcription factor PacC. J. Mol. Biol. 274, 466–480. [DOI] [PubMed] [Google Scholar]
  14. Espeso, E.A. , Roncal, T. , Díez, E. , Rainbow, L. , Bignell, E. , Álvaro, J. , Suárez, T. , Denison, S.H. , Tilburn, J. , Arst, H.N. Jr and Peñalva, M.A. (2000) On how a transcription factor can avoid its proteolytic activation in the absence of signal transduction. EMBO J. 19, 719–728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Flaherty, J.E. , Pirttilä, A.M. , Bluhm, B.H. and Woloshuk, C.P. (2003) PAC1, a pH‐regulatory gene from Fusarium verticillioides . Appl. Environ. Microbiol. 69, 5222–5227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gómez‐Gómez, E. , Ruíz‐Roldán, M.C. , Di Pietro, A. , Roncero, M.I.G. and Hera, C. (2002) Role in pathogenesis of two Endo‐β‐1,4‐xylanase genes from the vascular wilt fungus Fusarium oxysporum . Fungal Genet. Biol. 35, 213–222. [DOI] [PubMed] [Google Scholar]
  17. Horowitz, S. , Freeman, S. , Zveibil, A. and Yarden, O. (2006) A defect in nir1, a nirA‐like transcription factor, confers morphological abnormalities and loss of pathogenicity in Colletotrichum acutatum . Mol. Plant Pathol. 7, 341–354. [DOI] [PubMed] [Google Scholar]
  18. Jarai, G. and Buxton, F. (1994) Nitrogen, carbon, and pH regulation of extracellular acidic proteases of Aspergillus niger . Curr. Genet. 26, 238–244. [DOI] [PubMed] [Google Scholar]
  19. Keller, N.P. , Nesbitt, C. , Sarr, B. , Phillips, T.D. and Burow, G.B. (1997) pH regulation of sterigmatocystin and aflatoxin biosynthesis in Aspergillus spp. Phytopathology, 87, 643–648. [DOI] [PubMed] [Google Scholar]
  20. Kramer‐Haimovich H., Servi E., Katan T., Rollins J., Okon Y. and Prusky, D. (2006) Effect of ammonia production by Colletotrichum gloeosporioides on pelB activation, pectate lyase secretion, and fruit pathogenicity. Appl. Environ. Microbiol. 72, 1034–1039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lahey, K.A. , Yuan, R. , Burns, J.K. , Ueng, P.P. , Timmer, L.W. and Chung, K.‐R. (2004) Induction of phytohormones and differential gene expression in citrus flowers infected by the fungus Colletotrichum acutatum . Mol. Plant–Microbe Interact. 17, 1394–1401. [DOI] [PubMed] [Google Scholar]
  22. Lau, G. and Hamer, J.E. (1996) Regulatory gene controlling MPG1 expression and pathogenicity in the rice blast fungus Magnaporthe grisea . Plant Cell, 8, 771–781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li, W. , Yuan, R. , Burns, J.K. , Timmer, L.W. and Chung, K.‐R. (2003) Genes for hormone biosynthesis and regulation are highly expressed in citrus flowers infected with the fungus Colletotrichum acutatum, causal agent of postbloom fruit drop. J. Amer. Soc. Hort. Sci. 128, 578–583. [Google Scholar]
  24. Li, W.S. and Mitchell, A.P. (1997) Proteolytic activation of Rim1p, a positive 21 regulator of yeast sporulation and invasive growth. Genetics, 145, 63–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. MacCabe, A.P. , Van Den Hombergh, J.P.T.W. , Tilburn, J. , Arst., H.N. Jr and Visser, J. (1996) Identification, cloning and analysis of the Aspergillus niger gene pacC, a wide domain regulatory gene responsive to ambient pH. Mol. Gen. Genet. 250, 367–374. [DOI] [PubMed] [Google Scholar]
  26. Marzluf, G.A. (1997) Genetic regulation of nitrogen metabolism in the fungi. Microbiol. Mol. Biol. Rev. 61, 17–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nakayashiki, H. , Hanada. S. , Nguyen, B.Q. , Kadotani, N. , Tosa, Y. and Mayama, S. (2005) RNA silencing as a tool for exploring gene function in ascomycete fungi. Fungal Genet. Biol. 42, 275–283. [DOI] [PubMed] [Google Scholar]
  28. Negrete‐Urtasun, S. , Reiter, W. , Diez, E. , Denison, S.H. , Tilburn, J. , Espeso, E.A. , Peñalva, M.A. and Arst., H.N. Jr. (1999) Ambient pH signal transduction in Aspergillus: completion of gene characterization. Mol. Microbiol. 33, 994–1003. [DOI] [PubMed] [Google Scholar]
  29. Newcomb, L.L. , Hall, D.D. and Heideman, W. (2002) AZF1 is a glucose‐dependent positive regulator of CLN3 transcription in Saccharomyces cerevisiae . Mol. Cell Biol. 22, 1607–1614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Orejas, M. , Espeso, E. , Tilburn, J. , Sarkar, S. , Arst, H.N. Jr and Peñalva, M.A. (1995) Activation of the Aspergillus PacC transcription factor in response to alkaline ambient pH requires proteolysis of the carboxy‐terminal moiety. Genes Devel. 9, 1622–1632. [DOI] [PubMed] [Google Scholar]
  31. Pellier, A.‐L. , Lauge, R. , Veneault‐Fourrey, C. and Langin, T. (2003) CLNR1, the AREA/NIT2‐like global nitrogen regulator of the plant fungal pathogen Colletotrichum lindemuthianum is required for the infection cycle. Mol. Microbiol. 48, 639–655. [DOI] [PubMed] [Google Scholar]
  32. Peñalva, M.A. and Arst, H.N. Jr. (2002) Regulation of gene expression by ambient pH in filamentous fungi and yeasts. Microbiol. Mol. Biol. Rev. 66, 426–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Peñalva, M.A. and Arst, H.N. Jr. (2004) Recent advances in the characterization of ambient pH regulation of gene expression in filamentous fungi and yeasts. Annu. Rev. Microbiol. 58, 425–451. [DOI] [PubMed] [Google Scholar]
  34. Pérez‐García, A. , Snoeijers, S.S. , Joosten, M.H.A.J. , Goosen, T. and De Wit, P.J.G.M. (2001) Expression of the avirulence gene Avr9 of the fungal tomato pathogen Cladosporium fulvum is regulated by the global nitrogen response factor NRF1. Mol. Plant–Microbe Interact. 14, 316–325. [DOI] [PubMed] [Google Scholar]
  35. Poussereau, N. , Creton, S. , Billon‐Grand, G. , Rascle, C. and Fevre, M. (2001) Regulation of acp1, encoding a non‐aspartyl acid protease expressed during pathogenesis of Sclerotinia sclerotiorum. Microbiology 147, 717–726. [DOI] [PubMed] [Google Scholar]
  36. Prusky, D. , McEvoy, J.L. , Leverentz, B. and Conway, W.S. (2001) Local modulation of host pH by Colletotrichum species as a mechanism to increase virulence. Mol. Plant–Microbe Interact. 14, 1105–1113. [DOI] [PubMed] [Google Scholar]
  37. Ramon, A.M. , Porta, A. and Fonzi, W.A. (1999) Effect of environmental pH on morphological development of Candida albicans is mediated via the PacC‐related transcription factor encoded by PRR2. J. Bacteriol. 181, 7524–7530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Reymond‐Cotton, P. , Fraissinet‐Tachet, L. and Fèvre, M. (1996) Expression of the Sclerotinia sclerotiorum polygalacturonase pg1 gene: possible involvement of CREA in glucose catabolite repression. Curr. Genet. 30, 240–245. [DOI] [PubMed] [Google Scholar]
  39. Rollins, J. (2003) The Sclerotinia sclerotiorum pac1 gene is required for sclerotial development and virulence. Mol. Plant–Microbe Interact. 16, 785–795. [DOI] [PubMed] [Google Scholar]
  40. Rollins, J.A. and Dickman, M.B. (2001) pH signaling in Sclerotinia sclerotiorum: identification of a pacC/RIM1 homolog. Appl. Environ. Microbiol. 67, 75–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schmitt, E. , Kempken, R. , and Kück, U. (2001) Functional analysis of promoter sequences of cephalosporin biosynthesis from Acremonium chrysogenum: specific DNA‐protein interactions and characterization of the transcription factor PACC. Mol. Genet. Genomics 265, 508–518. [DOI] [PubMed] [Google Scholar]
  42. Shafran, H. , Miyara, I. , Rollins, J. , Prusky, D. and Sherman, S. (2007a) Functional genomic tools for fungi based on the Gateway system. In: Frontiers in Genetics IV Tel Aviv Israel, abstract 61.
  43. Shah, A.J. , Tilburn, J. , Adlard, M.W. and Arst, H.N. Jr. (1991) pH regulation of penicillin production in Aspergillus nidulans . FEMS Lett. 77, 209–212. [DOI] [PubMed] [Google Scholar]
  44. Soanes, D.M. , Kershaw, M.J. , Cooley, R.N. and Talbot, N.J. (2002) Regulation of the MPG1 hydrophobin gene in the rice blast fungus Magnaporthe grisea. Mol. Plant–Microbe Interact. 15, 1253–1267. [DOI] [PubMed] [Google Scholar]
  45. Suárez, T. and Peñalva, M.A. (1996) Characterization of a Penicillium chrysogenum gene encoding a PacC transcription factor and its binding sites in the divergent pcbAB‐pcbC promoter of the penicillin biosynthetic cluster. Mol. Microbiol. 20, 529–540. [DOI] [PubMed] [Google Scholar]
  46. Tilburn, J. , Sarkar, S. , Widdick, D.A. , Espeso, E.A. , Orejas, M. , Mungroo, J. , Peñalva, M.A. and Arst, H.N. Jr. (1995) The Aspergillus PacC zinc finger transcription factor mediates regulation of both acidic‐ and alkaline‐expressed genes by ambient pH. EMBO J. 14, 779–790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tonukari, N.J. , Scott‐Craig, J.S. and Walton, J.D. (2000) The Cochliobolus carbonum SNF1 gene is required for cell wall‐degrading enzyme expression and virulence on maize. Plant Cell, 12, 237–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Tu, J.C. (1985) An improved Mathur's medium for growth, sporulation and germination of spores of Colletotrichum lindemuthianum. Microbiosis, 44, 87–93. [Google Scholar]
  49. Wattad, C. , Kobiler, D. , Dinoor, A. and Prusky, D. (1997) Pectate lyase of Colletotrichum gloeosporioides attacking avocado fruits: cDNA cloning and involvement in pathogenicity. Physiol. Mol. Plant Pathol. 50, 197–212. [Google Scholar]
  50. Wei, Y. , Shih, J. , Li, J. and Goodwin, P.H. (2002) Two pectin lyase genes, pnl‐1 and pnl‐2, from Colletotrichum gloeosporioides f. sp. malvae differ in a cellulose‐binding domain and in their expression during infection of Malva pusilla . Microbiology, 148, 2149–2157. [DOI] [PubMed] [Google Scholar]
  51. Wubben, J.P. , Mulder, W. , Ten Have, A. , Van Kan, J.A.L. and Visser, J. (1999) Cloning and partial characterization of endopolygalacturonase genes from Botrytis cinerea. Appl. Environ. Microbiol. 65, 1596–1602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wubben, J.P. , Ten Have, A. , Van Kan, J.A.L. and Visser, J. (2000) Regulation of endopolygalacturonase gene expression in Botrytis cinerea by galacturonic acid, ambient pH and carbon catabolite repression. Curr. Genet. 37, 152–157. [DOI] [PubMed] [Google Scholar]
  53. Yakoby, N. , Kobiler, I. , Dinoor, A. and Prusky, D. (2000) pH regulation of pectate lyase secretion modulates the attack of Colletotrichum gloeosporioides on avocado fruits. Appl. Environ. Microbiol. 66, 1026–1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yakoby, N. , Beno‐Moualem, D. , Keen, N.T. , Dinoor, A. , Pines, O. and Prusky, D. (2001) Colletotrichum gloeosporioides pelB is an important virulence factor in avocado fruit–fungus interaction. Mol. Plant–Microbe Interact. 14, 988–995. [DOI] [PubMed] [Google Scholar]
  55. You, B. Choquer, M. and Chung, K. (2007) The Colletotrichum acutatum gene encoding a putative pH‐responsive transcription regulator is a key virulence determinant during fungal pathogenesis on citrus. Mol. Plant–Microbe Interact. 20, 1149–1160. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES