Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2010 Dec 1;12(1):21–30. doi: 10.1111/j.1364-3703.2010.00647.x

Affinity of Avr2 for tomato cysteine protease Rcr3 correlates with the Avr2‐triggered Cf‐2‐mediated hypersensitive response

JOHN W VAN'T KLOOSTER 1, MARC W VAN DER KAMP 2, JACQUES VERVOORT 2, JULES BEEKWILDER 3, SJEF BOEREN 2, MATTHIEU H A J JOOSTEN 1, BART P H J THOMMA 1, PIERRE J G M DE WIT 1,4,✉
PMCID: PMC6640376  PMID: 21118346

SUMMARY

The Cladosporium fulvum Avr2 effector is a novel type of cysteine protease inhibitor with eight cysteine residues that are all involved in disulphide bonds. We have produced wild‐type Avr2 protein in Pichia pastoris and determined its disulphide bond pattern. By site‐directed mutagenesis of all eight cysteine residues, we show that three of the four disulphide bonds are required for Avr2 stability. The six C‐terminal amino acid residues of Avr2 contain one disulphide bond that is not embedded in its overall structure. Avr2 is not processed by the tomato cysteine protease Rcr3 and is an uncompetitive inhibitor of Rcr3. We also produced mutant Avr2 proteins in which selected amino acid residues were individually replaced by alanine, and, in one mutant, all six C‐terminal amino acid residues were deleted. We determined the inhibitory constant (K i) of these mutants for Rcr3 and their ability to trigger a Cf‐2‐mediated hypersensitive response (HR) in tomato. We found that the two C‐terminal cysteine residues and the six amino acid C‐terminal tail of Avr2 are required for both Rcr3 inhibitory activity and the ability to trigger a Cf‐2‐mediated HR. Individual replacement of the lysine‐17, lysine‐20 or tyrosine‐21 residue by alanine did not affect significantly the biological activity of Avr2. Overall, our data suggest that the affinity of the Avr2 mutants for Rcr3 correlates with their ability to trigger a Cf‐2‐mediated HR.

INTRODUCTION

Cladosporium fulvum (Passalora fulva) is an asexual fungal pathogen causing leaf mould of tomato, a disease that complies with a gene‐for‐gene relationship (De Wit et al., 2009; Thomma et al., 2005). The runner hyphae produced by germinating spores enter tomato leaves through stomata and colonize the apoplastic space between mesophyll cells. During infection and subsequent colonization of tomato, the fungus secretes several small cysteine (Cys)‐rich effectors known as Avrs (avirulence proteins) and Ecps (extracellular proteins). Genes encoding these effectors have been cloned and, for a number of them, a role in fungal virulence has been demonstrated (Bolton et al., 2008; De Wit et al., 2008; Stergiopoulos and De Wit, 2009; Thomma et al., 2005; 2007, 2008). Resistant tomato plants contain Cf proteins that mediate the recognition of cognate effectors and subsequently trigger an array of defence responses culminating in the hypersensitive response (HR) (De Wit et al., 2008). The cognate Cf‐2, Cf‐4, Cf‐4E and Cf‐9 genes, whose encoded proteins mediate the recognition of Avr2, Avr4, Avr4E and Avr9, respectively, have also been cloned (Dixon et al., 1996; Jones et al., 1994; Takken et al., 1999; Thomas et al., 1997).

The Avr2 effector is a virulence factor of C. fulvum that inhibits tomato cysteine proteases, including Rcr3, Pip1, aleurain and TDI‐65, which are important for basal host defence (Krüger et al., 2002; Rooney et al., 2005; Shabab et al., 2008; Van Esse et al., 2008). Avr2 also increases the virulence of other fungal pathogens, such as Botrytis cinerea and Verticillium dahliae, as shown in tomato and Arabidopsis thaliana transgenic for the Avr2 gene (Van Esse et al., 2008). In the presence of Cf‐2, Avr2 behaves as an avirulence factor that triggers Cf‐2‐mediated HR, which also requires Rcr3pimp (required for C. fulvum resistance), a cysteine protease originating from Lycopersicon pimpinellifolium (Krüger et al., 2002; Rooney et al., 2005).

The Avr4 effector is a virulence factor of C. fulvum with a functional chitin‐binding domain that protects chitin present in fungal cell walls against plant chitinases (2003, 2004, 2006; Van Esse et al., 2007). In the presence of Cf‐4, Avr4 behaves as an avirulence factor that triggers Cf‐4‐mediated HR (Joosten et al., 1994).

The virulence function of the Avr4E effector is not yet known. In the presence of Cf‐4E, Avr4E behaves as an avirulence factor that triggers Cf‐4E‐mediated HR (Westerink et al., 2004).

The Avr9 effector contains a cystine knot with structural but, so far, no functional homology to carboxypeptidase inhibitor (Van den Ackerveken et al., 1993; Van den Hooven et al., 2001; Van Kan et al., 1991; Vervoort et al., 1997). Disruption of Avr9 in C. fulvum does not affect virulence on tomato plants, suggesting that it is not required for full virulence (Marmeisse et al., 1993).

All Avr effectors trigger Cf‐mediated HR, which could suggest a direct interaction between effector and cognate Cf receptor protein. Extensive studies have been performed to find evidence for interaction between C. fulvum effectors and their cognate Cf proteins (Luderer et al., 2001). However, using different biochemical approaches, direct interaction between the Cf‐9 protein and the Avr9 effector could not be shown (Luderer et al., 2001). Avr9 binds to a high‐affinity binding site (HABS) that could represent a virulence target that is guarded by the Cf‐9 protein (1996, 1998). Expression of the Avr4 gene in tomato plants without the Cf‐4 gene does not induce or suppress the expression of host genes, suggesting that Avr4 is a defensive virulence factor that protects the host colonizing fungus against deleterious effects of plant chitinases rather than attacking the host plant itself (2007, 2009). As plants containing the Cf‐4 resistance protein respond with a strong HR, a direct interaction between Avr4 and Cf‐4, mediating this response, is suggested. Recent studies have demonstrated that an Avr4 homologue (MfAvr4) from the C. fulvum‐related fungus Mycosphaerella fijiensis is recognized by the Cf‐4 protein of tomato, whereas it is only 42% homologous to C. fulvum Avr4 (Stergiopoulos et al., 2010). Further analysis has shown that the chitin‐binding domain of MfAvr4 is most homologous to C. fulvum Avr4, a suggestion that this domain most probably interacts with the Cf‐4 protein (Stergiopoulos et al., 2010).

As already mentioned above, the interaction between Avr2 and Rcr3 triggers a Cf‐2‐mediated HR which complies with the so‐called guard hypothesis (Van der Biezen and Jones, 1998), with Rcr3 as the guardee and Cf‐2 as the guard that is triggered by (modified) Rcr3 after binding to Avr2. We have shown previously that Avr2 binds to, and inhibits, the cysteine protease Rcr3, but the detailed mechanism of interaction between the Rcr3–Avr2 complex and the Cf‐2 protein is not yet understood (Rooney et al., 2005).

Cysteine proteases are endopeptidases that use a cysteinyl thiol group for their catalytic activity and belong to the C‐clan that harbours several protease families (Rawlings et al., 2004). The majority of the members of the CA‐1 subfamily of cysteine proteases are of plant origin and are referred to as papain‐like cysteine proteases (PLCPs) as they show similarity to papain, a well‐studied cysteine protease present in the latex of papaya (Carica papaya) (Van der Hoorn, 2008). All PLCPs are involved in important physiological and cellular processes, including organogenesis, the turnover of storage proteins, programmed cell death, tolerance to abiotic stress and defence against both herbivorous predators and microbial pathogens (Hatsugai et al., 2004; Kiyosaki et al., 2009; Van der Hoorn, 2008). PLCPs have similar folds and contain a Cys and a histidine (His) residue in their catalytic centre, which consists of seven subsites (S1–S4 and S1′–S3′), each accommodating a side‐chain of a corresponding amino acid residue (P1–P4 and P1′–P3′, respectively) present in the peptide substrate or peptide inhibitor (Turk et al., 1998).

It is difficult to classify protease inhibitors on the basis of sequence information, as the reactive site residues of inhibitor domains are often not conserved like the active site residues present in target proteases. Some protease inhibitors, such as phytocystatins, target plant proteases of the CA‐1 subfamily (Rawlings et al., 2004; MEROPS peptidase database, http://merops.sanger.ac.uk; Rawlings et al., 2008). Most phytocystatins have molecular masses between 12 and 16 kDa (Martinez and Diaz, 2008) and act as pseudosubstrates that form tight, reversible complexes with target enzymes by entering the active site cleft. Not many fungal and oomycete cysteine protease inhibitors have been described so far, but most show homology with phytocystatins.

The oomycete pathogen Phytophthora infestans secretes a number of protease inhibitors with similarity to phytocystatins, including Epic1 and Epic2B, which also interact with, and inhibit, Pip1 and Rcr3 (Shabab et al., 2008; Song et al., 2009; Tian et al., 2007; Van Esse et al., 2008), but do not trigger a Cf‐2‐mediated HR like the Rcr3 inhibitor Avr2 (Rooney et al., 2005).

Although we have no experimental evidence that Avr2 of C. fulvum shares functional homology with phytocystatins, we mention here a few motifs present in phytocystatins that have provided the basis for introducing amino acid substitutions into Avr2. They include the QXVXG motif [where Q, V and G stand for glutamine (Gln), valine (Val) and glycine (Gly), respectively; X stands for any amino acid residue], one or two Gly residues at the N‐terminus, and many lysine (Lys) residues scattered over the entire inhibitor protein.

By assuming that Avr2 enters the active site cleft of Rcr3, with a preference for aromatic amino acid residues in the P2 subsite of Avr2 to interact with the S2 subsite of Rcr3, we individually substituted the tyrosine‐21 (Tyr21) and phenylalanine‐54 (Phe54) residues by alanine (Ala) (Fig. 1). As Lys residues occur frequently in phytocystatins, we also individually substituted the Lys17 and Lys20 residues in Avr2 by Ala (Fig. 1). In addition, we individually substituted all eight Cys residues in Avr2 by Ala (Fig. 1).

Figure 1.

Figure 1

Open in a new tab

(A) Amino acid sequence of wild‐type Avr2 protein (residues 1–58) including the histidine (His) (HHHHHH) and the Flag (DYKDDDDK) tags at the N‐terminus. The enterokinase site is indicated by the filled triangle. Underlined amino acid residues were substituted by alanine in individual mutant Avr2 proteins. The constructs encoding mutant Avr2 proteins were produced in Pichia pastoris. One mutant Avr2 was produced lacking all six C‐terminal amino acid residues (indicated in bold), leading to a 52‐amino‐acid mutant Avr2 protein. (B) The disulphide bond pattern of wild‐type Avr2 as determined by disulphide mapping combined with matrix‐assisted laser desorption ionization‐time of flight mass spectrometry (MALDI‐TOF MS) analysis (see Experimental procedures for further details). The disulphide bonds between the cysteine residues (Cys7–Cys33, Cys12–Cys52, Cys29–Cys43 and Cys53–Cys57) are indicated as full lines.

In this article, we report the overall structure of Avr2 and show that it is a novel type of cysteine protease inhibitor with eight Cys residues that are all involved in disulphide bonds. We produced wild‐type Avr2 protein in Pichia pastoris and determined its disulphide bond pattern by mass spectrometry. By site‐directed mutagenesis, we show that three of the four disulphide bonds are required for Avr2 stability, whereas the C‐terminal disulphide bond is required for inhibitory activity and Cf‐2‐mediated HR‐inducing activity. Avr2 is not processed by Rcr3 and behaves as an uncompetitive inhibitor of Rcr3 cysteine protease. In addition, we produced mutant Avr2 proteins in which four selective amino acid residues were substituted by Ala, whereas, in another case, all six C‐terminal amino acid residues were deleted. We determined the inhibitory constant (K i) of these mutants for Rcr3 and their ability to trigger a Cf‐2‐mediated HR in tomato. Two C‐terminal Cys residues and the six C‐terminal amino acid residues of Avr2 are required for both Rcr3 inhibitory activity and the ability to trigger a Cf‐2‐mediated HR. Overall, our data suggest that the affinity of the Avr2 mutants for Rcr3 correlates with their ability to trigger a Cf‐2‐mediated HR.

RESULTS

Avr2 contains four disulphide bonds

Wild‐type Avr2 tagged at the N‐terminus with six His residues and Flag (His::Flag::Avr2) containing an enterokinase cleavage site behind the Flag signature was produced in a fermentor by P. pastoris, as described previously (Rooney et al., 2005; Van den Burg et al., 2001), and purified on an Ni2+‐nitrilotriacetate (Ni‐NTA) column (Fig. 1A). The His‐Flag tag was removed after treatment with enterokinase and the reaction products were separated by preparative reversed‐phase high‐performance liquid chromatography (RP‐HPLC) in order to obtain pure mature untagged Avr2. The molecular mass of purified wild‐type Avr2, as determined by matrix‐assisted laser desorption ionization‐time of flight mass spectrometry (MALDI‐TOF MS) analysis, was 6085 Da, which suggests that all Cys residues present in wild‐type Avr2 are involved in intramolecular disulphide bonds. This could be verified by showing that the molecular mass of completely reduced Avr2 increased by 8 Da (6093 Da).

Disulphide mass mapping of Avr2

In order to determine the disulphide bond pattern of Avr2, disulphide mass mapping using cyanylation and CN‐induced cleavage by hydroxide or ammonia was performed as described previously (Wu and Watson, 1998). First, Avr2 was partially reduced with an 18‐fold molar excess of Tris‐(2‐carboethyl)phosphine hydrochloride (TCEP). Subsequently, Avr2 was cyanylated with a 300‐fold molar excess of 1‐cyano‐4‐dimethylamino‐pyridium tetrafluoroborate (CDAP) and then cleaved by ammonia, after which the products were separated by RP‐HPLC. Two singly reduced cyanylated Avr2 species were obtained, in which the presence of disulphide bonds between Cys7–Cys33 and Cys53–Cys57 could be assigned by mass determination after CN‐induced cleavage. The disulphide bonds of doubly reduced species could not be assigned in this way, but could be determined by a combination of partial reduction with TCEP, followed by alkylation with N‐ethylmaleimide (NEM), separation on RP‐HPLC and digestion with Staphylococcus aureus endoprotease GluC, which cleaves directly C‐terminal of a glutamic acid residue, followed by mass determination of the products obtained. In this way, it was shown that the two remaining disulphide bonds are present between Cys12–Cys52 and Cys29–Cys43. The complete disulphide bond pattern of Avr2 is shown in Fig. 1B. The disulphide bonds between Cys7–Cys33, Cys12–Cys52 and Cys29–Cys43 in Avr2 provide a very compact and stable structure, which is presumably difficult to digest by extracellular plant proteases that are often present in the apoplastic space of tomato leaves. The overall disulphide bond pattern of Avr2 is different from the disulphide bond patterns reported for two other C. fulvum effectors. Avr9 contains a cystine knot structure consisting of three disulphide bonds (Van den Hooven et al., 2001), whereas Avr4 contains four disulphide bridges including a chitin‐binding domain structure (Van den Burg et al., 2003).

Production of mutant Avr2 proteins

We decided to generate Avr2 mutants by introducing amino acid substitutions and deletions in domains of the protein that might be involved in cysteine protease binding and cysteine protease inhibition, based on the presumed roles of Cys residues in disulphide bridges and some presumed homology with phytocystatins. We substituted all Cys residues individually by Ala and also deleted all six C‐terminal amino acid residues. In addition, Tyr21 and Phe54 were selected to be replaced by Ala as they might function as a putative P2 subsite to occupy the S2 subsite of Rcr3. Lys17 and Lys20 were chosen to be replaced by Ala, as many phytocystatins are Lys‐rich (Martinez and Diaz, 2008). Figure 1A shows an overview of the amino acid substitutions and the C‐terminal deletion that were introduced in the various mutant Avr2 proteins through polymerase chain reaction (PCR)‐based site‐directed mutagenesis of the Avr2 gene. Wild‐type and mutant versions of the Avr2 gene were cloned in expression vector pPIC9 and transformed into the yeast P. pastoris. Proteins produced in P. pastoris were purified, analysed and quantified by sodium dodecylsulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE) (Fig. 2). Mutant Avr2 proteins with the following amino acid substitutions could be produced in sufficient amounts: Avr2‐K17A, Avr2‐K20A, Avr2‐Y21A, Avr2‐C53a, Avr2‐F54A, Avr2‐C57A and the Avr2 mutant lacking all six C‐terminal amino acid residues (Avr2‐C53X). Substitution of all individual Cys residues by Ala, except for residues Cys53 and Cys57, resulted in too little Avr2 protein produced in P. pastoris, most probably because of instability of the mutant proteins. For wild‐type and all mutant Avr2 proteins that could be produced in sufficient amounts, equal amounts were used to determine their inhibitory activity towards Rcr3 and their ability to trigger a Cf‐2‐mediated HR.

Figure 2.

Figure 2

Open in a new tab

Sodium dodecylsulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE) of wild‐type His‐Flag‐tagged Avr2 and mutant Avr2 proteins containing various amino acid substitutions or a C‐terminal deletion of six amino acids (C53X). Equal amounts of protein (as indicated) were loaded on the gel. Proteins were stained with Coomassie Brilliant Blue (CBB) and identified by Western blot analysis using anti‐Flag and anti‐Avr2 antibodies.

Inhibitory activity of wild‐type and mutant Avr2 proteins towards Rcr3

Previously, it has been shown that wild‐type Avr2 is not a substrate for Rcr3, as the overall mass of wild‐type Avr2 does not change after prolonged incubation with Rcr3 (Rooney et al., 2005). Thus, it is anticipated that Avr2 interacts with Rcr3 by an irreversible trapping or a reversible tight‐binding reaction. To determine which type of interaction occurs, we studied the kinetics of the interaction between Avr2 and Rcr3 in more detail by Lineweaver–Burk plot analysis. In this analysis, we used a constant Rcr3 concentration and varying concentrations of the green fluorescent casein substrate (Bodipy FL‐casein) at different concentrations of Avr2. Avr2 shows an inhibition pattern that is most similar to that of uncompetitive inhibition, as both V max and K m of Rcr3 are affected at different concentrations of Avr2 (Fig. 3). The pattern observed for 40 nm Avr2 is fairly similar to that observed for 20 nm Avr2 indicating that, at a concentration of 20 nm Avr2, nearly all binding sites are occupied and increasing the Avr2 concentration has only minor affects. Uncompetitive inhibition is consistent with Avr2 only binding to the Rcr3–substrate complex outside the active centre of Rcr3. This is also in agreement with the finding that Avr2 is not a substrate of Rcr3, and that binding of the irreversible inhibitor E‐64 to Rcr3 can be achieved by a three‐fold molar excess of Avr2 over E‐64 (Rooney et al., 2005).

Figure 3.

Figure 3

Open in a new tab

Lineweaver–Burk plot analysis. Rcr3 activity was measured for each Avr2 concentration indicated in the inset of the figure at four different Bodipy FL‐casein substrate concentrations (230, 460, 920 and 1840 nm) and constant Rcr3 concentration. The reciprocal of the substrate Bodipy FL‐casein concentration is shown on the x‐axis. The Rcr3 rest activity is indicated on the y‐axis as the reciprocal of the relative amount of Bodipy FL released from the Bodipy FL‐casein substrate over 24 h at room temperature. The relative amount of released Bodipy FL was determined by measuring its fluorescence at 530 nm. The observed inhibition pattern is consistent with uncompetitive inhibition of Rcr3 by Avr2.

We also measured the inhibitory constants (K i values) of wild‐type Avr2 and the different mutant Avr2 proteins for Rcr3 by measuring the remaining protease activity at constant Bodipy FL‐casein substrate concentration after incubation with varying concentrations of wild‐type or mutant Avr2 proteins for 24 h. The K i value for wild‐type Avr2 was 16.1 nm and the K i values for the various mutant Avr2 proteins varied between 20 and 1444 nm (Fig. 4). Substitution of Cys53, Phe54 or Cys57 by Ala increased the K i value of Avr2 by approximately five‐fold, whereas deletion of all six C‐terminal amino acid residues increased the K i value of Avr2 by more than 70‐fold. Individual substitution of the Lys17, Lys20 or Tyr21 residue in Avr2 by Ala did not change significantly the K i values towards Rcr3 relative to wild‐type Avr2, suggesting that these residues are not crucial for the affinity of Avr2 for Rcr3.

Figure 4.

Figure 4

Open in a new tab

The affinity of wild‐type and mutant Avr2 proteins for Rcr3. Wild‐type or mutant Avr2 proteins were incubated at different concentrations (x‐axis) at constant Rcr3 protease and substrate Bodipy FL‐casein concentrations. The rest activity of Rcr3 (y‐axis) was measured as the relative fluorescence of released Bodipy FL at 530 nm, 24 h after incubation at room temperature. The K i values indicated in the inset were determined as described in Experimental procedures.

Cf‐2‐mediated HR triggered by wild‐type and mutant Avr2 proteins

The mutant Avr2 proteins with various affinities for Rcr3 were also assayed for their ability to trigger a Cf‐2‐mediated HR in tomato. Equal amounts (100 µL volume with a concentration of 2 µm) were injected into leaflets of Cf‐2 tomato plants and the Cf‐2‐mediated HR‐inducing activity was scored 3 days post‐injection (Fig. 5). The Cf‐2‐mediated HR triggered by wild‐type Avr2 and various Avr2 mutant proteins varied significantly. For the Cys residues in Avr2 that were substituted by Ala, only results for C53A and C57A substitutions could be obtained, because, for the Avr2 mutants in which the individual substitutions C7A, C12A, C29A, C33A, C43A and C52A were introduced, insufficient amounts of Avr2 mutant proteins could be produced in P. pastoris, most probably because of protein stability. The Cf‐2‐mediated HR‐inducing activities of Avr2 mutant proteins, in which one amino acid residue in the C‐terminal part was substituted by Ala (Avr2‐C53A, Avr2‐C57A and Avr2‐F54A mutants), were significantly lower when compared with the activity of wild‐type Avr2. Deletion of all six C‐terminal amino acid residues in Avr2 (Avr2‐C53X) abolished the Cf‐2‐mediated HR‐inducing activity nearly completely.

Figure 5.

Figure 5

Open in a new tab

Cf‐2‐mediated hypersensitive response (HR)‐inducing activity triggered by wild‐type Avr2 and mutant Avr2 proteins produced in Pichia pastoris. Photograph was taken 3 days post‐injection of 100 µL of an aqueous solution containing 2 µm of wild‐type Avr2 or mutant Avr2 protein as indicated. Note that only amino acid substitutions in the six C‐terminal amino acids of Avr2 significantly affected Cf‐2‐mediated HR‐inducing activities. Deletion of all six C‐terminal amino acid residues of Avr2 (Avr2‐C53X) abolished Cf‐2‐mediated HR‐inducing activity nearly completely (compare also Cf‐2‐mediated HR‐inducing activities with the K i values for wild‐type Avr2 and mutant Avr2 proteins presented in Fig. 4).

Substitution of the amino acid residue Lys17, Lys20 or Tyr21 by Ala (Avr2‐L17A, Avr2‐K20A and Avr2‐Y21A) in Avr2 did not alter significantly the Cf‐2‐mediated HR‐inducing activity. Together, these results (shown in Fig. 5), combined with the observed K i values (shown in Fig. 4), suggest a positive correlation between the affinity of the Avr2 mutant proteins for Rcr3 and their ability to trigger a Cf‐2‐mediated HR.

DISCUSSION

MALDI‐TOF MS analysis showed that all eight Cys residues present in the cysteine protease inhibitor Avr2 are involved in disulphide bonds (Fig. 1B). Disulphide bonds are formed between Cys7–Cys33, Cys12–Cys52, Cys29–Cys43 and Cys53–Cys57. Three of these bonds (Cys7–Cys33, Cys12–Cys52 and Cys29–Cys43) are required for Avr2 stability, and therefore indirectly also for its inhibitory activity against the cysteine protease Rcr3, and its ability to trigger a Cf‐2‐mediated HR. So far, the spacing pattern of the Cys residues in Avr2 has not been found in protein structure databases, but the overall disulphide bond pattern present in Avr2 also occurs in members of a serine protease‐inhibiting peptide family isolated from arthropods (Simonet et al., 2002), in WAP (whey acidic protein) protease inhibitors (Ohashi et al., 2003; Ranganathan et al., 1999; Sano et al., 2005) and in thionine‐related fabatins, small antimicrobial peptides (Zhang and Lewis, 1997).

Individual substitution of Cys residues Cys7, Cys12, Cys29, Cys33, Cys43 or Cys52 by Ala strongly affected the stability of the Avr2 protein, and this was the main reason why we could not produce these Avr2 mutant proteins in sufficient amounts in P. pastoris for detailed biological studies. Substitution of the Cys residues forming the disulphide bond between Cys53 and Cys57 in the C‐terminus of Avr2 by Ala did not affect the stability of the corresponding mutant protein, but showed a reduction in both the Rcr3 inhibitory activity and the ability to trigger a Cf‐2‐mediated HR. In addition, deletion of all six C‐terminal amino acid residues of Avr2 showed a decrease in both Rcr3 inhibition and Cf‐2‐mediated HR‐inducing activity of over 100‐fold. This indicates that the C‐terminal part of Avr2 is crucial for biological activity and most probably interacts with Rcr3. In order to find direct evidence for this interaction, we performed MALDI‐TOF MS analysis of Rcr3 in the presence of biotinylated Avr2, and attempted to detect the Rcr3–Avr2 complex in co‐immunoprecipitates in order to identify the interaction site. Although we were able to identify Rcr3 fragments after trypsin digestion, we could not identify Rcr3 fragments bound to Avr2, indicating that the interaction between Rcr3 and Avr2 is reversible and not covalent. This makes it difficult or even impossible to identify the interaction site(s) between Rcr3 and Avr2 by mass spectrometry. We have also tried to fixate the Rcr3–Avr2 complex by photo‐affinity labelling but, so far, pilot experiments have failed.

Amino acid substitutions outside the six‐amino‐acid C‐terminal part of Avr2, different from Cys, did not change the affinity of Avr2 mutant proteins for Rcr3 and did not affect Cf‐2‐mediated HR‐inducing activity.

As the Avr2 amino acid sequence and overall structure are distinct from those of other known protease inhibitors, such as phytocystatins, we studied the mode of inhibition in more detail. We performed inhibitor assays for each Avr2 concentration at constant Rcr3 concentrations and varying Bodipy FL‐casein substrate concentrations. The data presented in a Lineweaver–Burk plot (Fig. 3) show that Avr2 is clearly not a competitive cysteine protease inhibitor, but behaves as an uncompetitive inhibitor. This indicates that Avr2 most probably only binds the Rcr3–substrate complex outside the catalytic centre of Rcr3 and affects both V m and K m. We used Bodipy FL‐casein as a substrate to measure the enzymatic activity of Rcr3, as the native substrate in tomato for Rcr3 is not yet known. The K i values of wild‐type and mutant Avr2 proteins towards Rcr3 negatively correlate with Avr2‐triggered Cf‐2‐mediated HR. This means that the lower the affinity of Avr2 mutants for Rcr3, the lower their Cf‐2‐mediated HR‐inducing activity. As Avr2 does not bind to the catalytic centre of Rcr3, this suggests that the conformational change(s) of Rcr3 induced by binding of Avr2 triggers the Cf‐2‐mediated HR. This is in agreement with the observation that the Lycopersicon esculentum variant of Rcr3 (Rcr3esc) triggers a Cf‐2‐mediated HR in an Avr2‐independent manner. Rcr3esc differs from Rcr3pimp in only a few amino acid residues, and these seem to be sufficient to cause a conformational change in the protein to trigger a Cf‐2‐mediated HR in an Avr2‐independent manner.

A similar finding has been reported for the relationship between the affinity of Avr9 mutant proteins for HABS and Avr9‐triggered Cf‐9‐medited HR (Kooman‐Gersmann et al., 1998). Ala scanning mutants of Avr9 with the lowest affinity for HABS also showed the lowest Cf‐9‐mediated HR‐inducing activity.

In conclusion, Avr2 is a potent cysteine protease inhibitor that is different from other known cysteine protease inhibitors such as the phytocystatins (Rawlings et al., 2004). Avr2 is required by C. fulvum to inhibit various extracellular plant cysteine proteases, including Rcr3 and Pip1, to enable the pathogen to grow in the harsh cysteine protease‐rich environment of the apoplastic space of a tomato leaf. Indeed, it has been shown that Avr2 behaves as a genuine virulence factor of C. fulvum in the absence of the Cf‐2 protein (Van Esse et al., 2008), whereas it acts as an avirulence factor in the presence of the Cf‐2 protein (Rooney et al., 2005).

Recently, it has been reported that Phytophthora infestans, a pathogen of tomato and potato, secretes two cystatin‐like protease inhibitors, Epic1 and Epic2B, which both interact with, and inhibit, Rcr3 but fail to trigger a Cf‐2‐mediated HR (Song et al., 2009). In addition, the inhibition of Rcr3 by the irreversible inhibitor E‐64 does not trigger a Cf‐2‐mediated HR (Rooney et al., 2005). This shows that inhibition of Rcr3 can be achieved by different cysteine protease inhibitors, but that only the interaction of Rcr3 with Avr2 triggers a Cf‐2‐mediated HR, indicating that the conformational change in Rcr3 induced by Avr2 is different from that induced by the phytocystatins Epic1, Epic2B and E‐64. These data also indicate that Avr2 is a unique cysteine protease inhibitor, and that its interaction with Rcr3 results in a unique conformational change that is recognized by Cf‐2. The C‐terminal tail of Avr2 most probably interacts with Rcr3, but, so far, we have not been able to identify the exact interaction site between Avr2 and Rcr3.

EXPERIMENTAL PROCEDURES

Plasmid constructs used for protein expression in P. pastoris

Plasmids for the expression of Rcr3, wild‐type Avr2 and mutant Avr2 proteins in P. pastoris were generated as described previously (Rooney et al., 2005). Throughout this study the Rcr3 pimpinellifolium (Rcr3pim) isoform was used.

Mutant Avr2 peptide production in P. pastoris

Pichia pastoris strain GS115 (Invitrogen, Landsmeer, the Netherlands) was transformed with plasmids encoding different mutant Avr2 proteins. The tags and various mutations introduced in Avr2 are indicated in Fig. 1A, and the different primers used to introduce the mutations are shown in Table 1. The vector pPIC9 (Invitrogen) was used for secretion of the proteins in the culture medium. Transformants were grown in small cultures and the proteins secreted into the medium were analysed by Tricine SDS‐PAGE, and afterwards stained with Coomassie Brilliant Blue or analysed on Western blots, using antibodies (anti‐Flag or anti‐Avr2). Transformants expressing significant amounts of the different Avr2 proteins were selected for bulk fermentation. Fermentation was performed as described previously (Rooney et al., 2005). The tagged proteins were subsequently purified on an Ni‐NTA column and fractions containing highly purified proteins were pooled and dialysed against water. For mass spectrometric analysis of Avr2, the His‐Flag tag was removed by treatment with enterokinase. Protein concentrations were determined by the bicinchoninic acid (BCA) protein assay (Pierce art. No. 23225, Landsmeer, the Netherlands). Purified wild‐type and Avr2 mutants were tested for their Rcr3 inhibitory activity and their potential to trigger a Cf‐2‐mediated HR. Plants were monitored for HR development 3–5 days post‐injection of wild‐type and Avr2 mutant proteins.

Table 1.

Primers used in this study.

Code Sequence
A2K17AF GTGAAGGAGGCGTCTGGAAAG
A2K17AR CTTTCCAGACGCCTCCTTCAC
A2K20AF GGAGAAGTCTGGAGCGTATAAATTG
A2K20AR CAATTTATACGCTCCAGACTTCTCC
A2Y21AF GGAGAAGTCTGGAAAGGCTAAATTGAAG
A2Y21AR CTTCAATTTAGCCTTTCCAGACTTCTCC
A2C29AF GATTGGTGCTAAAGCCTCGGCGACATGTG
A2C29AR CACATGTCGCCGAGGCTTTAGCACCAATC
A2C33AF GGTGCTAAATGCTCGGCGACAGCTGACGGG
A2C33AR CCCGTCAGCTGTCGCCGAGCATTTAGCACC
A2C52AR GGGTAATCACCTTGCCTGTTTTGGTCTTTGCGG
A2C52AF CCGCAAAGACCAAAACAGGCAAGGTGATTACCC
A2C53AR GGGTAATCACCTTTGCGCTTTTGGTCTTTGCGG
A2C53AF CCGCAAAGACCAAAAGCGCAAAGGTGATTACCC
A2F54AF CACCTTTGCTGTGCTGGTCTTTGC
A2F54AR GCAAAGACCAGCACAGCAAAGGTG
A2C57AR CCTTTGCTGTTTTGGTCTTGCCGGTTGATGATACG
A2C57AF CGTATCATCAACCGGCAAGACCAAAACAGCAAAGG
A2C53XF GGGTAATCACCTTTGCTGATAGTGAGAATTCCG
A2C53XR CGGAATTCTCACTATCAGCAAAGGTGATTACCC
Open in a new tab

F and R stand for forward and reverse primer sequences, respectively.

Primer codes should be read as follows: A2 stands for Avr2; the next four characters indicate the amino acid residue and its position in the Avr2 protein sequence to be substituted by alanine, except for A2C53XF and A2C53XR which lead to a protein with a C‐terminal six‐amino‐acid deletion.

Disulphide mass mapping of Avr2

The disulphide mass mapping of purified Avr2 produced in P. pastoris was performed by the method previously used for the disulphide mass mapping of Avr4 (Van den Burg et al., 2003). The molecular masses of partially and fully reduced Avr2 peptides were determined by MALDI‐TOF MS.

Determination of apparent equilibrium dissociation constants

For the wild‐type and mutant Avr2 proteins, the apparent inhibitory constants (K i values) for Rcr3 were determined by titration of the enzyme using curve‐fitting software as described previously (Annadana et al., 2003). For determination of K i, different concentrations of each Avr2 mutant protein were added to Rcr3 and the remaining Rcr3 enzyme activity was measured 24 h after incubation with the substrate Bodipy FL‐casein in the presence of 10 mm l‐cysteine, 50 mm Na‐acetate, pH 5.0 (Annadana et al., 2003). The relative amount of released Bodipy FL was measured in a fluorescence microplate reader with standard fluorescein excitation filters at 485 ± 12.5 nm and emission at 530 ± 15 nm. All K i measurements were performed in triplicate. Fluorescence values were fitted to the K i model (Beekwilder et al., 2000).

Lineweaver–Burk plots

The V max and K m values for Rcr3 were measured indirectly by determining the Rcr3 activity in the presence of various substrate and Avr2 concentrations. The effects of different Avr2 concentrations on Rcr3 activity were visualized using Lineweaver–Burk plots, allowing conclusions to be drawn on the mode of inhibition (competitive, uncompetitive, noncompetitive or mixed), where competitive inhibitors affect K m, noncompetitive inhibitors affect V max and uncompetitive inhibitors affect both V max and K m. Mixed inhibitors show intermediate patterns. For each Avr2 concentration, a fixed Rcr3 concentration was used and the Bodipy FL‐casein substrate was varied. All tests were performed in 10 mm l‐cysteine, 50 mm Na‐acetate, pH 5.0. All samples were measured after incubation for 24 h at room temperature.

REFERENCES

  1. Annadana, S. , Schipper, B. , Beekwilder, J. , Outchkourov, N. , Udayakumar, M. and Jongsma, M.A. (2003) Cloning, functional expression in Pichia pastoris, and purification of potato cystatin and multicystatin. J. Biosci. Bioeng. 95, 118–123. [DOI] [PubMed] [Google Scholar]
  2. Beekwilder, J. , Schipper, B. , Bakker, P. , Bosch, D. and Jongsma, M. (2000) Characterization of potato proteinase inhibitor II reactive site mutants. Eur. J. Biochem. 267, 1975–1984. [DOI] [PubMed] [Google Scholar]
  3. Bolton, M.D. , Van Esse, H.P. , Vossen, J.H. , De Jonge, R. , Stergiopoulos, I. , Stulemeijer, I.J.E. , Van Den Berg, G.C.M. , Borras‐Hidalgo, O. , Dekker, H.L. , De Koster, C.G. , De Wit, P.J.G.M. , Joosten, M.H.A.J. and Thomma, B.P.H.J. (2008) The novel Cladosporium fulvum lysin motif effector Ecp6 is a virulence factor with orthologues in other fungal species. Mol. Microbiol. 69, 119–136. [DOI] [PubMed] [Google Scholar]
  4. De Wit, P. , Mehrabi, R. , Van den Burg, H.A. and Stergiopoulos, I. (2009) Fungal effector proteins: past, present and future. Mol. Plant Pathol. 10, 735–747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. De Wit, P.J.G. , Joosten, M.H.A.J. , Thomma, B.H.P.J. and Stergiopoulos, I. (2008) Gene‐for‐gene models and beyond: the Cladosporium fulvum–tomato pathosystem. Mycota, V, 135–156. [Google Scholar]
  6. Dixon, M.S. , Jones, D.A. , Keddie, J.S. , Thomas, C.M. , Harrison, K. and Jones, J.D.G. (1996) The tomato Cf‐2 disease resistance locus comprises two functional genes encoding leucine‐rich repeat proteins. Cell, 84, 451–459. [DOI] [PubMed] [Google Scholar]
  7. Hatsugai, N. , Kuroyanagi, M. , Yamada, K. , Meshi, T. , Tsuda, S. , Kondo, M. , Nishimura, M. and Hara‐Nishimura, I. (2004) A plant vacuolar protease, VPE, mediates virus‐induced hypersensitive cell death. Science, 305, 855–858. [DOI] [PubMed] [Google Scholar]
  8. Jones, D.A. , Thomas, C.M. , Hammond‐Kosack, K.E. , Balint Kurti, P.J. and Jones, J.D.G. (1994) Isolation of the tomato Cf‐9 gene for resistance to Cladosporium fulvum by transposon tagging. Science, 266, 789–793. [DOI] [PubMed] [Google Scholar]
  9. Joosten, M.H.A. , Cozijnsen, T.J. and De Wit, P.J.G.M. (1994) Host resistance to a fungal tomato pathogen lost by a single base‐pair change in an avirulence gene. Nature, 367, 384–386. [DOI] [PubMed] [Google Scholar]
  10. Kiyosaki, T. , Asakura, T. , Matsumoto, I. , Tamura, T. , Terauchi, K. , Funaki, J. , Kuroda, M. , Misaka, T. and Abe, K. (2009) Wheat cysteine proteases triticain alpha, beta and gamma exhibit mutually distinct responses to gibberellin in germinating seeds. J. Plant Physiol. 166, 101–106. [DOI] [PubMed] [Google Scholar]
  11. Kooman‐Gersmann, M. , Honée, G. , Bonnema, G. and De Wit, P.J.G. (1996) A high‐affinity binding site for the AVR9 peptide elicitor of Cladosporium fulvum is present on plasma membranes of tomato and other solanaceous plants. Plant Cell, 8, 929–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kooman‐Gersmann, M. , Vogelsang, R. , Vossen, P. , Van den Hooven, H.W. , Mahe, E. , Honeé, G. and De Wit, P.J.G. (1998) Correlation between binding affinity and necrosis‐inducing activity of mutant AVR9 peptide elicitors. Plant Physiol. 117, 609–618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Krüger, J. , Thomas, C.M. , Golstein, C. , Dixon, M.S. , Smoker, M. , Tang, S. , Mulder, L. and Jones, J.D.G. (2002) A tomato cysteine protease required for Cf‐2‐dependent disease resistance and suppression of autonecrosis. Science, 296, 744–747. [DOI] [PubMed] [Google Scholar]
  14. Luderer, R. , Rivas, S. , Nurnberger, T. , Mattei, B. , Van den Hooven, H.W. , Van der Hoorn, R.A.L. , Romeis, T. , Wehrfritz, J.M. , Blume, B. , Nennstiel, D. , Zuidema, D. , Vervoort, J. , De Lorenzo, G. , Jones, J.D.G. , De Wit, P.J.G.M. and Joosten, M.H.A.J. (2001) No evidence for binding between resistance gene product Cf‐9 of tomato and avirulence gene product AVR9 of Cladosporium fulvum . Mol. Plant–Microbe Interact. 14, 867–876. [DOI] [PubMed] [Google Scholar]
  15. Marmeisse, R. , Van den Ackerveken, G.F.J.M. , Goosen, T. , De Wit, P.J.G.M. and Van den Broek, H.W.J. (1993) Disruption of the avirulence gene avr9 in two races of the tomato pathogen Cladosporium fulvum causes virulence on tomato genotypes with the complementary resistance gene Cf9 . Mol Plant–Microbe Interact. 6, 412–417. [Google Scholar]
  16. Martinez, M. and Diaz, I. (2008) The origin and evolution of plant cystatins and their target cysteine proteinases indicate a complex functional relationship. BMC Evol. Biol. 8, 198. doi:10.1186/1471‐2148‐8‐198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ohashi, A. , Murata, E. , Yamamoto, K. , Majima, E. , Sano, E. , Le, Q.T. and Katunuma, N. (2003) New functions of lactoferrin and beta‐casein in mammalian milk as cysteine protease inhibitors. Biochem. Biophys. Res. Commun. 306, 98–103. [DOI] [PubMed] [Google Scholar]
  18. Ranganathan, S. , Simpson, K.J. , Shaw, D.C. and Nicholas, K.R. (1999) The whey acidic protein family: a new signature motif and three‐dimensional structure by comparative modeling. J. Mol. Graph. Model. 17, 106–113. [DOI] [PubMed] [Google Scholar]
  19. Rawlings, N.D. , Tolle, D.P. and Barrett, A.J. (2004) Evolutionary families of peptidase inhibitors. Biochem. J. 378, 705–716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Rawlings, N.D. , Morton, F.R. , Kok, C.Y. , Kong, J. and Barrett, A.J. (2008) MEROPS: the peptidase database. Nucleic Acids Res. 36, D320–D325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Rooney, H.C.E. , Van ‘t Klooster, J.W. , Van Der Hoorn, R.A.L. , Joosten, M.H.A.J. , Jones, J.D.G. and De Wit, P.J.G.M. (2005) Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf‐2‐dependent disease resistance. Science, 308, 1783–1786. [DOI] [PubMed] [Google Scholar]
  22. Sano, E. , Miyauchi, R. , Takakura, N. , Yamauchi, K. , Murata, E. , Le, Q.T. and Katunuma, N. (2005) Cysteine protease inhibitors in various milk preparations and its importance as a food. Food Res. Int. 38, 427–433. [Google Scholar]
  23. Shabab, M. , Shindo, T. , Gu, C. , Kaschani, F. , Pansuriya, T. , Chintha, R. , Harzen, A. , Colby, T. , Kamoun, S. and Van der Hoorn, R.A.L. (2008) Fungal effector protein AVR2 targets diversifying defense‐related cys proteases of tomato. Plant Cell, 20, 1169–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Simonet, G. , Claeys, I. and Vanden Broeck, J. (2002) Structural and functional properties of a novel serine protease inhibiting peptide family in arthropods. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 132, 247–255. [DOI] [PubMed] [Google Scholar]
  25. Song, J. , Win, J. , Tian, M.Y. , Schornack, S. , Kaschani, F. , Ilyas, M. , Van Der Hoorn, R.A.L. and Kamoun, S. (2009) Apoplastic effectors secreted by two unrelated eukaryotic plant pathogens target the tomato defense protease Rcr3. Proc. Natl. Acad. Sci. USA, 106, 1654–1659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Stergiopoulos, I. and De Wit, P.J.G.M. (2009) Fungal effector proteins. Annu. Rev. Phytopathol. 47, 233–263. [DOI] [PubMed] [Google Scholar]
  27. Stergiopoulos, I. , Van Den Burg, H.A. , Ökmen, B. , Beenen, H. , Kema, G.H.J. and De Wit, P.J.G.M. (2010) Tomato Cf resistance proteins mediate recognition of cognate homologous effectors from fungi pathogenic on dicots and monocots. Proc. Natl. Acad. Sci. USA, 107, 7610–7615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Takken, F.L.W. , Thomas, C.M. , Joosten, M. , Golstein, C. , Westerink, N. , Hille, J. , Nijkamp, H.J.J. , De Wit, P.J.G.M. and Jones, J.D.G. (1999) A second gene at the tomato Cf‐4 locus confers resistance to Cladosporium fulvum through recognition of a novel avirulence determinant. Plant J. 20, 279–288. [DOI] [PubMed] [Google Scholar]
  29. Thomas, C.M. , Jones, D.A. , Parniske, M. , Harrison, K. , Balint‐Kurti, P.J. , Hatzixanthis, K. and Jones, J.D.G. (1997) Characterization of the tomato Cf‐4 gene for resistance to Cladosporium fulvum identifies sequences that determine recognitional specificity in Cf‐4 and Cf‐9. Plant Cell, 9, 2209–2224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Thomma, B.P.H. , Van Esse, H.P. , Crous, P.W. and De Wit, P.J.G.M. (2005) Cladosporium fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model for functional studies on plant pathogenic Mycosphaerellaceae. Mol. Plant Pathol. 6, 379–393. [DOI] [PubMed] [Google Scholar]
  31. Tian, M.Y. , Win, J. , Song, J. , Van Der Hoorn, R.A.L. , Van der Knaap, E. and Kamoun, S. (2007) A Phytophthora infestans cystatin‐like protein targets a novel tomato papain‐like apoplastic protease. Plant Physiol. 143, 364–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Turk, D. , Guncar, G. , Podobnik, M. and Turk, B. (1998) Revised definition of substrate binding sites of papain‐like cysteine proteases. Biol. Chem. 379, 137–147. [DOI] [PubMed] [Google Scholar]
  33. Van den Ackerveken, G.F.J. , Vossen, P. and De Wit, P.J.G.M. (1993) The AVR9 race‐specific elicitor of Cladosporium fulvum is processed by endogenous and plant proteases. Plant Physiol. 103, 91–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Van den Burg, H.A. , De Wit, P.J.G.M. and Vervoort, J. (2001) Efficient C‐13/N‐15 double labeling of the avirulence protein AVR4 in a methanol‐utilizing strain (Mut(+)) of Pichia pastoris . J. Biomol. NMR, 20, 251–261. [DOI] [PubMed] [Google Scholar]
  35. Van den Burg, H.A. , Westerink, N. , Francoijs, K.J. , Roth, R. , Woestenenk, E. , Boeren, S. , De Wit, P.J.G.M. , Joosten, M.H.A.J. and Vervoort, J. (2003) Natural disulfide bond‐disrupted mutants of AVR4 of the tomato pathogen Cladosporium fulvum are sensitive to proteolysis, circumvent Cf‐4‐mediated resistance, but retain their chitin binding ability. J. Biol. Chem. 278, 27 340–27 346. [DOI] [PubMed] [Google Scholar]
  36. Van den Burg, H.A. , Spronk, C.A.E.M. , Boeren, S. , Kennedy, M.A. , Vissers, J.P.C. , Vuister, G.W. , De Wit, P.J.G.M. and Vervoort, J. (2004) Binding of the AVR4 elicitor of Cladosporium fulvum to chitotriose units is facilitated by positive allosteric protein–protein interactions: the chitin‐binding site of Avr4 represents a novel binding site on the folding scaffold shared between the invertebrate and the plant chitin‐binding domain. J. Biol. Chem. 279, 16 786–16 796. [DOI] [PubMed] [Google Scholar]
  37. Van den Burg, H.A. , Harrison, S.J. , Joosten, M.H.A.J. , Vervoort, J. and De Wit, P.J.G.M. (2006) Cladosporium fulvum Avr4 protects fungal cell walls against hydrolysis by plant chitinases accumulating during infection. Mol. Plant–Microbe Interact. 19, 1420–1430. [DOI] [PubMed] [Google Scholar]
  38. Van den Hooven, H.W. , Van Den Burg, H.A. , Vossen, P. , Boeren, S. , De Wit, P.J.G.M. and Vervoort, J. (2001) Disulfide bond structure of the AVR9 elicitor of the fungal tomato pathogen Cladosporium fulvum: evidence for a cystine knot. Biochemistry, 40, 3458–3466. [DOI] [PubMed] [Google Scholar]
  39. Van der Biezen, E.A. and Jones, J.D.G. (1998) Plant disease‐resistance proteins and the gene‐for‐gene concept. Trends Biochem. Sci. 23, 454–456. [DOI] [PubMed] [Google Scholar]
  40. Van der Hoorn, R.A.L. (2008) Plant proteases: from phenotypes to molecular mechanisms. Annu. Rev. Plant Biol. 59, 191–223. [DOI] [PubMed] [Google Scholar]
  41. Van Esse, H.P. , Bolton, M.D. , Stergiopoulos, I. , De Wit, P.J.G.M. and Thomma, B.P.H.J. (2007) The chitin‐binding Cladosporium fulvum effector protein Avr4 is a virulence factor. Mol. Plant–Microbe Interact. 20, 1092–1101. [DOI] [PubMed] [Google Scholar]
  42. Van Esse, H.P. , Van't Klooster, J.W. , Bolton, M.D. , Yadeta, K.A. , Van Baarlen, P. , Boeren, S. , Vervoort, J. , De Wit, P. and Thomma, B. (2008) The Cladosporium fulvum virulence protein Avr2 inhibits host proteases required for basal defense. Plant Cell, 20, 1948–1963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Van Esse, H.P. , Fradin, E.F. , De Groot, P.J. , De Wit, P.J.G.M. and Thomma, B.P.H.J. (2009) Tomato transcriptional responses to a foliar and a vascular fungal pathogen are distinct. Mol. Plant–Microbe Interact. 22, 245–258. [DOI] [PubMed] [Google Scholar]
  44. Van Kan, J.A.L. , Van den Ackerveken, G.F.J.M. and De Wit, P.J.G.M. (1991) Cloning and characterization of cDNA of avirulence gene avr9 of the fungal pathogen Cladosporium fulvum, causal agent of tomato leaf mold. Mol. Plant–Microbe Interact. 4, 52–59. [DOI] [PubMed] [Google Scholar]
  45. Vervoort, J. , Van Den Hooven, H.W. , Berg, A. , Vossen, P. , Vogelsang, R. , Joosten, M.H.A. and De Wit, P.J.G.M. (1997) The race‐specific elicitor AVR9 of the tomato pathogen Cladosporium fulvum: a cystine knot protein: sequence‐specific 1H NMR assignments, secondary structure and global fold of the protein. FEBS Lett. 404, 153–158. [DOI] [PubMed] [Google Scholar]
  46. Westerink, N. , Brandwagt, B.F. , De Wit, P.J.G.M. and Joosten, M.H.A.J. (2004) Cladosporium fulvum circumvents the second functional resistance gene homologue at the Cf‐4 locus (Hcr9‐4E) by secretion of a stable avr4E isoform. Mol. Microbiol. 54, 533–545. [DOI] [PubMed] [Google Scholar]
  47. Wu, J. and Watson, J.T. (1998) Optimization of the cleavage reaction for cyanylated cysteinyl proteins for efficient and simplified mass mapping. Anal. Biochem. 258, 268–276. [DOI] [PubMed] [Google Scholar]
  48. Zhang, Y. and Lewis, K. (1997) Fabatins: new antimicrobial plant peptides. FEMS Microbiol. Lett. 149, 59–64. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES