Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2009 Jun 2;10(5):587–598. doi: 10.1111/j.1364-3703.2009.00555.x

Studies on the mechanism of resistance to Bipolaris sorokiniana in the barley lesion mimic mutant bst1

MATTIAS PERSSON ✉, ANDERS FALK 1, CHRISTINA DIXELIUS 1
PMCID: PMC6640378  PMID: 19694950

SUMMARY

The Bipolaris sorokiniana tolerant 1 (bst1) barley mutant is derived from fast neutron‐irradiated seeds of wild‐type Bowman(Rph3). The induced mutation was genetically localized to a position on chromosome 5HL distal to the centromere using amplified fragment length polymorphism markers. In addition, the defence responses and related gene expression in the bst1 mutant after fungal challenge were compared with those occurring in wild‐type plants. Hydrogen peroxide generation, determined by 3,3‐diaminobenzidine staining, revealed a clearly reduced level of bst1, compared with the wild‐type, during the entire experimental time: 8–120 h post‐inoculation (hpi). At 48 hpi, the wild‐type samples displayed twice as much fungal mass and three times greater H2O2 production than bst1. At the same time, staining of B. sorokiniana showed less fungal growth in the spontaneous lesions of bst1 compared with the wild‐type. Monitoring of defence‐related genes at 48 hpi demonstrated strong expression of PR‐1a, PR‐2, PR‐5 and PR‐10 in bst1. A gene coding for a unique oxidoreductase enzyme, designated as HCP1, was expressed at much higher levels in inoculated leaves of the bst1 mutant than in those of the wild‐type plant. Taken together, the results suggest that the defence to B. sorokiniana largely relies on salicylic acid‐responsive pathogenesis‐related (PR) genes, as well as selected reactive oxygen species and unknown HCP1‐associated factors.

INTRODUCTION

Plants have developed a variety of strategies, including molecular, chemical and physical barriers, to oppose infection. With regard to molecular barriers, it is known that plants have evolved two classes of immune receptors to detect nonself molecules. One class consists of membrane‐resident pattern recognition receptors (PRRs) that detect microbe‐associated molecular patterns (MAMPs). Plant resistance (R) proteins define a second, mainly intracellular, immune receptor class that has the capacity to detect, directly or indirectly, isolate‐specific pathogen effectors, encoded by avirulence (Avr) genes (reviewed by Chisholm et al., 2006; Jones and Dangl, 2006). Pathogen recognition, through interactions between plant R proteins and the corresponding Avr gene products, may induce localized cell death, the so‐called hypersensitive response (HR). HR may also be triggered in nonhost resistance interactions (Alfano and Collmer, 2004). In addition to restricting the spread of a pathogen, especially biotrophic organisms and their containment to the infection site, HR also triggers local and systemic signalling for the activation of various defences in noninfected tissues. Early signalling associated with HR involves the rapid production of highly reactive molecules, such as nitric oxide and reactive oxygen species (ROS) (Besson‐Bard et al., 2008). The latter molecules play a role as antimicrobial compounds and in cell wall reinforcements, in addition to signalling (Gechev and Hille, 2005; Gechev et al., 2006). Several other components take part in the subsequent defence signalling that activates resistance responses, such as salicylic acid (SA), jasmonic acid (JA), ethylene (ET) and other plant hormones (Glazebrook, 2005; Robert‐Seilaniantz et al., 2007). SA is a positive regulator of HR and is also implicated in systemic acquired resistance (SAR) and the expression of pathogenesis‐related (PR) genes (Raffaele et al., 2006). It is generally believed that SA is associated with biotrophic resistance, whereas necrotrophs benefit from host cell death and their resistance responses are activated by JA and ET (Glazebrook, 2005).

Plants that spontaneously develop necrotic lesions during development or in response to changes in the environment, without the presence of any pathogen, are denoted as disease lesion mimics or lesion mimic mutants (LMMs). LMM genotypes have been observed in many plant species, such as maize (Johal et al., 1995; Walbot et al., 1983), rice (Marchetti et al., 1983; Takahashi et al., 1999; Yin et al., 2000) and barley (Kjaer et al., 1990; Rostoks et al., 2006; Wolter et al., 1993). In Arabidopsis thaliana, screening of similar mutants has resulted in the identification of accelerated cell death (acd), constitutive expresser of PR genes (cpr), lesion simulating disease resistance (lsd) and other groups of cell death‐related mutants (reviewed by Lorrain et al., 2003). Much of our current understanding about the control and execution of HR comes from the analysis of these mutants, but many details remain to be elucidated.

The Bipolaris sorokiniana tolerant 1 (bst1) barley mutant has previously been identified as a genetic source for resistance against fungal spot blotch disease (Persson et al., 2008). bst1 exhibits conspicuous black or brown spots that appear on all above‐ground parts of the plant, including the bristles, with the lesion phenotype most prominent on the leaves. The bst1 mutant is classified as belonging to the initiation group of LMMs. This mutant class, on which locally determinant necrotic lesions are formed, is in contrast with propagation mutants that are unable to control lesion formation (Dangl et al., 1996). In this work, we genetically define the chromosomal region of the bst1 mutation and enhance our understanding of important defence signalling molecules induced on fungal challenge on bst1.

RESULTS

Localization of bst1 to chromosome 5HL

The bst1 mutant was identified in a population composed of 5000 M2 sown spikes derived from fast neutron‐irradiated seeds of the wild‐type cultivar Bowman (Persson et al., 2008). The wild‐type genotype in this study contains the leaf rust resistance gene Rph3 located on chromosome 7HL (Jin et al., 1993). The Rph3 gene has not been found to possess any impact on the barley–Bipolaris sorokiniana interaction in our previous assessments (data not shown).

The bst1 line was crossed with the barley cultivars Proctor and Nudinka, on which amplified fragment length polymorphism (AFLP)‐based marker information was available (Castiglioni et al., 1998). Segregation of bst1 was analysed in the F2 generations, and the analysis showed that the mutation is recessive (χ 2= 116, P < 0.005). From segregating F2 progeny, 20 lesion mimic phenotypic plants and 20 wild‐type plants derived from the bst1 and Nudinka cross were assessed with 72 AFLP primer combinations. Five markers were found that showed polymorphisms of the bst1 mutation on chromosome 5HL distal to the centromere. E40M38‐7 was the most closely linked marker at 2.1 cM distal to bst1 (Fig. 1a). The flanking markers from the Proctor × Nudinka map, Xcln.WG644 and Xcnl.BC0298, were used as a link to the Barley BinMap 2005 and to the rice sequence information (Fig. 1b,c).

Figure 1.

Figure 1

Open in a new tab

Genetic linkage data on bst1 and genome comparisons. (a) Genetic map constructed on mutant bst1 on barley chromosome 5HL bin11 using five different amplified fragment length polymorphism (AFLP) primer combinations on F2 offspring from a cross between bst1 and Nudinka. (b) Genes located on barley BinMap 2005 at the positions between flanking markers Xcln.WG644 and Xcln.BCD0298 from the Proctor × Nudinka map. (c) A selection of defence‐related genes located between the flanking markers Xcl.WG644 and Xcl.BCD298 in rice. (d) Genetic map constructed using seven additional AFLP markers on F2 offspring from a cross between bst1 and Proctor. Genetic distances are shown in cM.

In order to obtain more markers in the chromosomal area of interest, an F2 population (610 lesion mimic phenotypic plants and 48 plants with wild‐type phenotype) derived from the bst1 and Proctor cross was analysed by combinations of PstI primers P11–P26 and MseI primers M31–M78. In total, seven linked AFLP markers were found, with the two closest markers P26M65 and P26M77 at a distance of 0.25 and 0.23 cM from the mutation, respectively (Fig. 1d).

Fungal infection and bst1 mutant characteristics

A fungal isolate constitutively expressing the GUS (β‐glucuronidase) gene, driven by the glyceraldehyde 3‐phosphate dehydrogenase (GPD‐1) promoter (Liljeroth et al., 1993), was introduced to facilitate analysis. At 1 day after point inoculation, a clear difference in lesion size between the moderately susceptible genotypes Bowman(Rph3) and ND B112, compared with the susceptible ND 5883, was observed (Fig. 2). However, fungal growth on bst1 was reduced after the first day (F= 25.52, P < 0.001). The phenotypic difference between the occurrence of small spontaneous necrotic spots of bst1 and pathogen‐induced necrosis was time dependent. At 72 h after spray inoculation, a clear difference between mock‐ and B. sorokiniana‐inoculated leaves of both the wild‐type and bst1 was seen (Fig. 3).

Figure 2.

Figure 2

Open in a new tab

Lesion size after point inoculation with Bipolaris sorokiniana in different barley genotypes: Bowman(Rph3), bst1 and the two reference lines ND B112 and ND 5883. At every time point, bst1 exhibited significantly smaller lesions formed by the fungal infection. Bars indicate pooled standard deviation using Hsu's Multiple Comparisons with the Best (MCB) test.

Figure 3.

Figure 3

Open in a new tab

Leaves of wild‐type Bowman(Rph3) and mutant bst1 after spray inoculation with H2O or Bipolaris sorokiniana, 72 h post‐inoculation (hpi). Clear disease symptoms are evident in the wild‐type samples after inoculation. bst1 exhibits spontaneous necrotic spots in the mock‐treated leaves that are similar to infection symptoms. On B. sorokiniana‐inoculated bst1 plants, symptom development is not as pronounced as seen in the wild‐type.

In order to assess the differences in the level of hydrogen peroxide (H2O2) in bst1, spray‐inoculated leaves were stained with 3,3‐diaminobenzidine (DAB) and compared with the wild‐type. The bst1 mutant exhibited a distinctly low generation of H2O2 induced by the fungus (Fig. 4). Less than 1% of the leaf area was stained with DAB during the first 72 h post‐inoculation (hpi); thereafter, an increase to 3% occurred at 120 hpi (Fig. 4). Bowman(Rph3), however, exhibited 2% DAB‐stained leaf area at 8 and 24 hpi, with a rapid increase to 8% at 48 hpi. At 120 hpi, 12% of the leaf area was stained with DAB.

Figure 4.

Figure 4

Open in a new tab

Hydrogen peroxide detection using 3,3‐diaminobenzidine (DAB) staining of Bipolaris sorokiniana spray‐inoculated bst1 and wild‐type Bowman(Rph3) leaves. The software APS assess was used to quantify the stained leaf surface area. In order to determine the proportion of fungal‐induced cell death, the mock‐inoculated leaf data (spontaneous lesions) were subtracted from the fungal‐inoculated samples. The ratio of stained leaf surface area was calculated as a percentage of the total leaf surface area. Error bars indicate standard deviations for triplicate measurements.

In parallel, the fungal mass in the inoculated samples was determined by GUS quantification. The most striking difference between the two genotypes occurred at 48 hpi, when Bowman(Rph3) contained more than double the increase in fungal mass in the leaves (value ± standard deviation, 1.26 ± 0.23 nmol/mg protein/min) compared with bst1 (0.48 ± 0.12 nmol/mg protein/min) (P < 0.05). This difference in fungal growth was also visualized by lactophenol trypan blue and GUS staining of inoculated leaves (Fig. 5). No mycelia could be detected in spontaneously occurring lesions in the leaves of bst1 (Fig. 5c). The roots of bst1 did not show any spontaneous lesions. No fungal spread from the leaves to the roots could be detected in the plants 4 weeks after inoculation, with only a few exceptions in Bowman(Rph3) with a frequency of less than 1%.

Figure 5.

Figure 5

Open in a new tab

Histological staining of Bipolaris sorokiniana in barley. Lactophenol trypan blue staining showing fungal growth in different barley genotypes 72 h post‐inoculation (hpi). (a) Limited numbers of infected cells in bst1. (b) Large areas of several cells infected with B. sorokiniana in the wild‐type Bowman(Rph3). β‐Glucuronidase (GUS) staining of GUS‐tagged B. sorokiniana at 48 hpi in bst1 (c) and wild‐type Bowman(Rph3) (d) leaves.

Expression of defence‐ and cell death‐related genes

To further investigate the events taking place in the bst1 mutant, several genes linked to cell death processes and defence were monitored at the transcriptional level and compared with the wild‐type at 48 hpi. Primers were designed using barley sequences from orthologous genes in Arabidopsis or rice (Table 1).

Table 1.

List of primers used in quantitative real‐time polymerase chain reaction analysis.

Gene Forward sequence Reverse sequence Product size (bp)
ACS2 * CTGCTCATCCATCGACCTTT CTCCACTCCTCGATCAGGTC 244
APX † CCAAGGGTTCTGACCACCTA TCAAAGGGTTCCTTGTCCAG 150
CSD ‡ CATGAGTTCGGTGACACGAC TGTCTCTGCCACACCTTCAG 150
RBOHB § GATCGAGCTCCACAACCATT CAAGAACAGGCTCACCACAA 160
HPC1 ACCGTCTGAGGAGAAGCAGA ATCTTCGGGCTCAACTCTCA 151
PR1‐a ** ACACCAAACCCAGAATGGAG TGGGGTGAAAGGTAGTCCTG 118
PR‐2 †† GACCTGGCAACCCTCACTAA CAGCCCAAAGTTCCTCTCTG 162
PR‐5 ‡‡ CTTCAACCTTGCCATGGACT CTTCATGGGCAGAAGGTGAT 158
PR‐10 §§ GGTCGAGATGAAGCTTGAGG CAAACAACACCGGGCTACTT 320
NH1 ¶¶ TCCACCTCCGGAGATAACAA AGCCAGCTCAGGTTCATCAT 175
CNGC2 *** GAAAATGCAGAAGGTGACAGG CAACACCCACCTGCAATATG 104
GADPH ††† CGTTCATCACCACCGACTAC CAGCCTTGTCCTTGTCAGTG 225
CesA1 ‡‡‡ CAGGCAAAACCGCACAC ATCAACACAAACCCACAGCA 85
Cyclophilin §§§ AGCAGGAACAACAGGCAGAGA GGGAGCATCACCAAGGAGG 140
Open in a new tab
*

ACS2 PlantGDB‐assembled PUT‐161a‐Hordeum vulgare‐52696, orthologue to ACS2 from Arabidopsis.

†

APX GenBank accession AF411227.

‡

CDS2 GenBank accession AK248474, orthologue to CSD2from Arabidopsis.

§

RBOHB GenBank accession AK249349, orthologue to RBOHB from Oryza sativa.

HPC1 GenBank accession AF527606.

**

PR1‐a GenBank accession X74939.

††

PR‐2 GenBank accession AY239039.

‡‡

PR‐5 GenBank accession AM403331.

§§

PR‐10 GenBank accession AY220734.

¶¶

NH1 GenBank accession AM050559.

***

CNGC2 GenBank accession AY972628.

†††

GADPH (Horvath et al., 2003).

‡‡‡

CesA1 GenBank accession AY483150 (Bengtsson, 2008).

§§§

Cyclophilin Plexdb Barley1_13715 (Bengtsson, 2008).

In the genetic region to which bst1 is localized on 5HL, the cyclic nucleotide‐gated ion channel 2 (CNGC2) gene, showing high similarity to Arabidopsis DND1 (defence no death 1), has been mapped (Rostoks et al., 2006). CNGC2 expression was generally low in both the wild‐type and bst1 genotypes, independent of treatment, but the bst1 mutant showed significantly lower expression of this gene compared with wild‐type plants (Fig. 6a). To further assess the importance of CNGC2‐related processes in defence to B. sorokiniana, Arabidopsis LMM dnd1 (Clough et al., 2000) and corresponding wild‐type Col‐0 plants were inoculated. It was found that the dnd1 mutant exhibited clear susceptibility, whereas Col‐0 showed no symptoms (Fig. 7a–d). Fungal colonization and growth in the dnd1 mutant were, however, not as fast as those observed on the An‐1 accession (Fig. 7e). Two genes encoding for antioxidant enzymes involved in ROS scavenging/detoxification were analysed: the barley ascorbate peroxidase 1 (APX1) and the barley gene orthologue to copper superoxide dismutase (CSD2) from Arabidopsis (At2g28190). No differences in the expression levels of APX1 were found in the different samples. In comparison, the expression of CSD2 increased four‐fold in fungal‐challenged plants of both genotypes (Fig. 6b). To follow up this result, a respiratory burst oxidase homologue B (RBOHB) gene was analysed. Interestingly, it was found to be expressed at low levels in bst1 independent of treatment, but significantly up‐regulated in fungal‐inoculated wild‐type plants (Fig. 6c). A marker for the ET biosynthesis pathway, a barley orthologue to the Arabidopsis 1‐aminocyclopropane‐1‐carboxylate synthase (ACS2), was also studied. In this case, inoculated bst1 and wild‐type plants showed a down‐regulation when compared with water‐inoculated samples (Fig. 6d). The PR‐1a, PR‐2, PR‐5 and PR‐10 genes, all markers for activation of the SA defence response pathway, were expressed at the same high level in mock or inoculated bst1 plants (Fig. 6e–h). However, PR‐2 and PR‐5 expression in inoculated wild‐type plants could not be distinguished from the expression in any bst1 samples. This observation was opposite to that found for PR‐1a and PR‐10, where transcript levels in wild‐type materials were significantly lower than those in the bst1 mutant (Fig. 6e,h). For comparison of the results on SA‐related PR genes, the barley orthologue to the Arabidopsis nonexpressor of PR genes 1, NH1, was included. In this case, a significant increase in gene expression in fungal‐inoculated Bowman(Rph3), compared with bst1, was found (Fig. 6i). Finally, we included the HCP1 barley gene encoding for an iron/ascorbate‐dependent oxidoreductase. Elevated transcript levels were found in mock‐treated and inoculated bst1 plants (12 and 46 relative expression units, respectively), whereas the transcript levels were lower in the wild‐type (Fig. 6j). However, an increase in HCP1 expression was also observed in wild‐type samples after fungal challenge.

Figure 6.

Figure 6

Open in a new tab

Transcript levels of 10 genes in Bipolaris sorokiniana‐inoculated and H2O‐treated barley genotypes Bowman(Rph3) (wild‐type) and bst1 mutant. The expression at 48 h post‐inoculation (hpi) was analysed by real‐time polymerase chain reaction with primer sequences for the cyclic nucleotide‐gated ion channel 2 (CNGC2) (a), copper superoxide dismutase (CSD2) (b), the respiratory burst oxidase (RBOHB) (c), 1‐aminocyclopropane‐1‐carboxylate synthase (ACS2) (d), the pathogenesis‐related PR‐1a (e), PR‐2 (f), PR‐5 (g) and PR‐10 (h), Hordeum vulgare NH1 gene for NPR1‐like 1 protein (NH1) (i) and HCP1 encoding an iron/ascorbate‐dependent oxidoreductase (j). Relative transcript levels were calculated with barley GADPH, CesA1 and Cyclophilin expression as reference. The experiment was based on 10 leaves per genotype and repeated twice.

Figure 7.

Figure 7

Open in a new tab

Phenotype responses in Arabidopsis Col‐0 (wild‐type) plants, the dnd1 mutant and the An‐1 accession to Bipolaris sorokiniana, 10 days post‐inoculation. (a) Col‐0 exhibits no disease symptoms. The dnd1 mutant displays a large difference in symptom development between mock‐ (b) and B. sorokiniana‐inoculated (c) plants. (d) The fungal growth in dnd1 is not as pronounced as seen on the highly susceptible Arabidopsis accession An‐1, visualized by β‐glucuronidase (GUS) staining (e). Conidiophores and conidia can also be formed in An‐1 within 10 days. Ten plants of each genotype were inoculated and the experiment was repeated twice.

DISCUSSION

A number of LMMs have been identified and characterized, not least in barley (Lundqvist et al., 1997; 2003, 2006). One of the most well studied is the mlo mutant, conferring broad resistance to the powdery mildew fungus Blumeria graminis f. sp. hordei (Wolter et al., 1993). In this case, the plasma membrane‐localized MLO proteins are required for successful invasion by the fungus, whereas barley genotypes lacking functional MLO, either as a result of natural variation (Piffanelli et al., 2002) or induced lesions in the Mlo gene (Büschges et al., 1997; Piffanelli et al., 2002), are resistant.

The genetic mapping of the B. sorokiniana‐tolerant bst1 mutation revealed a linkage to chromosome 5HL and bin11–13. No barley LMM has been reported in this chromosomal region previously. During the identification of the barley homologue to the Arabidopsis HLM1 (an HR‐like lesion mimic) gene, which belongs to the nucleotide‐gated ion channel (CNGC) gene family, other members of the barley CNGC gene family were identified (Rostoks et al., 2006). Three of 10 unique genes, represented by EST unigenes, were located to chromosome 5H, and the putative barley CNGC orthologue of the Arabidopsis DND1 gene (EST unigene abc22879) was positioned on bin11. This information led us to study the expression of the CNGC2 gene corresponding to DND1. The transcript level in wild‐type barley was reduced following challenge with B. sorokiniana, whereas the transcript level in the bst1 mutant was even lower and remained unaltered following inoculation. The transcript levels are overall relatively low in both genotypes and do not generate clear evidence to link DND1 to the putative BST1 gene. Sequence analysis of the CNGC2 gene in the bst1 mutant did not reveal any mutations in the coding region. However, we cannot exclude that mutations may have occurred in upstream regions or in other components that could impact upon CNGC2 transcription. The susceptible phenotype of the Arabidopsis dnd1 mutant to B. sorokiniana showed, however, that this gene plays an important role.

The mapped region in Nudinka has a corresponding chromosomal region in the barley BinMap from 2005, which contains several defence‐related genes: for example, genes regulating resistance to the cereal cyst nematode (Rha4) and to the stem rust Puccinia graminis (RpgQ). The corresponding area in rice includes more than 78 genes, a selection of which is shown in Fig. 1. The peroxidase precursors Os03g0762300 and Os03g0762400 are interesting, as malfunction of peroxidase produces a toxic environment that could incite cell death. However, in our DAB staining experiment of bst1, we detected less H2O2 production than in the wild‐type, suggesting an alternative functional explanation.

Enhanced resistance responses in LMMs have been observed in many cases (Dietrich et al., 1994), in particular to biotrophic pathogens. In our attempts to further characterize the bst1 mutant, it became clear that B. sorokiniana has a very slow growth on this genotype compared with the wild‐type. This observation is in accordance with a more extensive study in which lesion formation on leaves caused by a larger set of fungal isolates was compared on 22 different barley accessions (Persson et al., 2008). In many LMMs, an accumulation of superoxide and H2O2 in or around necrotic tissues occurs. The current understanding suggests that high doses trigger cell death, whereas low doses induce protective mechanisms and eventually ROS detoxification (Vranova et al., 2002). Based on DAB staining, it can be concluded that no rapid production of H2O2 occurred in bst1 compared with the wild‐type samples, and no fungal growth was observed in the spontaneous lesions formed on bst1 leaves. The spontaneously appearing lesions are not only spatially, but also temporally, separated from disease lesions, and occur 2 days later than the first disease symptoms. Bipolaris sorokiniana has a short biotrophic phase and successful tissue infection in the necrotrophic growth phase has been correlated previously with the amount of H2O2 produced (Kumar et al., 2002). The delayed disease development seen on bst1 could be linked to reduced establishment of the fungus and its initial biotrophic growth, but this phase is not succeeded by rapid mycelial growth later in pathogenesis, which is to be expected by a necrotroph surrounded by dead leaf tissue. One explanation of this phenomenon could be the induction of cell wall reinforcement via rapid peroxidase activity and the formation of covalent cross‐links between cell wall constituents, or lignification processes (Cona et al., 2006). No enhanced or changed lignification could, however, be seen after lignin staining of fungal‐inoculated leaves (data not shown), excluding a major impact of lignification and a possible involvement of the barley orthologue on the lignin biosynthesis‐related (Os03g0809000) rice gene.

Interestingly, although the Arabidopsis AtrbohD knock‐out mutants exhibited reduced levels of ROS, they showed increased cell death when introduced into an lsd1‐1 background challenged with avirulent bacteria (Torres et al., 2005). One interpretation, together with more recent work (Rusterucci et al., 2007; Zago et al., 2006), suggests that nitric oxide and ROS levels may work in synergy and govern whether cell death is initiated or suppressed. In the case of the bst1 mutant, the RBOHB gene was down‐regulated independent of treatment, pointing to a disturbed RBOHB function. Likewise, a low transcript level of a barley gene orthologue of Arabidopsis nitric oxide synthase 1 (NOS1) was found in the different samples (data not shown). These observations imply that these ROS and NO‐associated genes are not main actors in this particular response. However, in studies of the interaction between Arabidopsis and B. sorokiniana (Persson, 2008), it was shown that some mutants impaired in ROS processes are susceptible, such as lsd1, AtrbohD and AtrbohF, but not ran1‐1 (responsive‐to‐antagonist 1) and rcd1‐1 (radical‐induced cell death 1), further demonstrating the complexity of ROS‐related responses.

NPR1 is a key component of the SA signalling pathway and npr1 plants do not show PR gene induction (Cao et al., 1994). The NPR1 orthologue NH1 was down‐regulated in bst1, whereas elevated transcript levels of the SA‐activated PR‐1a, PR‐2, PR‐5 and PR10 genes were obvious. The latter is common among mutants which develop necrotic lesions spontaneously, for example cpr mutants in Arabidopsis (Yoshioka et al., 2001). Analyses of additional Arabidopsis mutants have, however, shown evidence for the existence of an SA‐dependent, but NPR1‐independent pathway (Lorrain et al., 2004; Shah et al., 2001; Shirano et al., 2002). The interactions between HR, SA, JA and ET are known to be complex, and both antagonistic and agonistic cross‐talk can take place. Elevated levels of ET are commonly observed among different LMMs. However, neither SA nor ET alone can trigger HR (Bouchez et al., 2007; Verberne et al., 2000). Both SA and ET are regarded as positive regulators of HR, in contrast with JA which displays a negative role in programmed cell death regulation (Devadas et al., 2002). Current evidence suggests that components such as enhanced disease susceptibility 1 (EDS1) and phytoalexin deficient 4 (PAD4) amplify ET and SA signals by processing ROS‐derived molecules that are essential for immunity to biotrophic pathogens (Brodersen et al., 2006; Rusterucci et al., 2001).

A relationship between senescence and HRs has been found in several pathosystems. For example, the Arabidopsis double mutant hys1cpr5 shows accelerated senescence and constitutively high levels of defence responses (Yoshida et al., 2002). It has also been demonstrated recently by global transcript profiling that viruses induce large sets of senescence‐associated genes (Espinoza et al., 2007). One class of genes involved in multiple pathways, such as those linked to ROS and senescence, are oxidoreductases (Jamet et al., 2008). In our survey of barley defence‐related sequences, the oxidoreductase HCP1 protein, previously shown to interact with Brome mosaic virus coat protein (Okinaka et al., 2003), was found. When HCP1 gene expression was monitored on bst1 and wild‐type barley materials, it became clear that it was significantly up‐regulated in bst1 samples. The family of oxidoreductases exhibits a great variety of functions, with those having an impact on antioxidant processes and antimicrobial activity via metabolites derived from flavonoid, cathechin and anthocyanidin biosynthesis pathways possibly being among the most important in a defence context (Lukacin and Britsch, 1997; Schweizer, 2008; van Damme et al., 2008). We hypothesize that HCP1 may possess antimicrobial properties, which, together with enhanced PR gene expression, could explain the enhanced resistance to B. sorokiniana without an increase in H2O2. However, much of the defence response in this pathosystem remains unclear. To achieve a fuller understanding of which defence components to B. sorokiniana are activated, and their function and interaction, it seems logical to further explore the Arabidopsis system, followed by a comparison in barley to reveal any discrepancies between the two plant species.

EXPERIMENTAL PROCEDURES

Genetic localization

The bst1 mutant was initially crossed with the barley mapping cultivar Nudinka. The barley plants were grown without inoculation in soil (Weibull's K‐soil, Svalöv Weibull AB, Sweden) in a glasshouse at a temperature of 15 ± 5 °C day/12 ± 5 °C night, with a 16‐h/8‐h light/dark regime. From this cross, 20 F2 plants with the lesion mimic phenotype and 20 F2 plants with the parent cultivar phenotypes were selected. Genomic DNA preparations from 10 plants were combined to form a DNA bulk (Michelmore et al., 1991). AFLP analysis was carried out as described previously (Vos et al., 1995), but α32P‐dATP was used for the labelling of primers. The DNA bulk samples were subjected to AFLP analyses using the 72 primer combinations developed by Castiglioni et al. (1998). For further fine‐scale mapping, bulk samples from a bst1× Proctor F2 population were screened with 768 PstI–MseI AFLP primer combinations. The generation of PstI primers was essentially the same as described by Vos et al. (1995), with two selective nucleotides. Primers relevant for polymorphism detection are shown in Table S1 (see Supporting Information). The primer combination P25M44 detected a marker that was assessed on a population of 610 F2 segregants, resulting in the identification of 52 recombinants. The individual recombinants were used to map the other six markers, P26M33, P26M65, P13M72, P13M61, P24M69 and P16M70. Linkage was calculated using the Kosambi mapping function (Kosambi, 1944).

DNA sequencing

Fragments of the four closest AFLP markers, P26M65, P26M77, P13M72 and P13M61, were cut out from the AFLP gel. Extracted DNA was amplified using AFLP primers (Table S1), cloned into pJET1.2 using a CloneJET™ PCR Cloning Kit (Fermentas GmbH, St. Leon‐Rot, Germany), followed by sequencing (Macrogen Inc., Seoul, South Korea). Sequence data are shown in Table S2 (see Supporting Information).

Fungal growth and inoculations

The GUS‐tagged B. sorokiniana isolate (Liljeroth et al., 1993) was grown on potato dextrose agar medium (Difco, Sparks, MD, USA) for 14 days in a 12‐h dark/12‐h near‐ultraviolet (near‐UV) light regime. Conidia were released by sterile water and the solution was filtered through a 100‐µm Teflon filter to exclude hyphae fragments. For point inoculations, plants were kept at 23 °C, 70% relative humidity (RH), 160 µmol light for 16 h, and 18 °C, 80% RH, darkness for 8 h. The third leaf was carefully detached in a horizontal position, 21 days after sowing, and inoculated with 5 × 5 µL containing 5000 conidia. Five leaves of the genotypes Bowman(Rph3), bst1, ND 5883 and ND B112 were inoculated and the experiment was repeated twice. After inoculation, the humidity was raised to 100% for 18 h. The lesion sizes were measured with a sliding calliper at 24‐h intervals, starting after 24 hpi. For quantitative real‐time polymerase chain reaction and for histological analyses, the first leaves of Bowman(Rph3) and bst1 were spray inoculated 7 days after sowing with a concentration of 10 000 conidia/mL (Ma et al., 2004). Plants were sown in Weibull's K‐soil, and grown at 22 °C, 230 µmol light for 16 h and 8 h of darkness. After inoculations, plants were covered with transparent plastic to retain high humidity until the leaf material was harvested at 8, 24, 48, 72 and 120 hpi. As controls, plants were inoculated with water. The Arabidopsis accession Col‐0, An‐1 and mutant dnd1 (Yu et al., 1998) were cultured as described by Kaliff et al. (2007). Inoculation and screening were performed on 10 plants at the five to six leaf stage and repeated twice using the barley spray inoculations described above.

Histochemical staining and quantification of GUS activity

For DAB detection of the H2O2 level, the method described by Thordal‐Christensen et al. (1997) was used, and de‐staining was performed in 95% boiling ethanol for 20 min. As a control, active catalase was co‐infiltrated simultaneously with DAB, as described by Able (2003). The percentage of DAB‐stained leaf area was quantified from photographs of leaves from Bowman(Rph3) and bst1 using APS assess software (L. Lamari, University of Manitoba, Winnipeg, MB, Canada) and compared with water‐inoculated samples. For each time point, five leaves were photographed and analysed. The spray inoculation, staining and quantification were repeated twice. GUS quantification of the GUS‐tagged B. sorokiniana isolate was assessed at 48 hpi and based on 10 inoculated leaves of Bowman(Rph3) and bst1. The GUS activity was measured using 4‐methylumbelliferyl β‐d‐glucuronide (4‐MUG) (Weigel and Glazebrook, 2002), and analysed in a DyNA Quant™ 200 fluorometer (Hoefer Pharmacia Biotech Inc., Minnesota, USA). The GUS quantification was repeated twice with different biological replicates. Protein concentrations were determined as described by Bradford (1976). Histochemical GUS staining was performed at 48 and 72 hpi on 10 leaves, as described in Jefferson et al. (1987), and the experiment was repeated twice. Leaves of Bowman(Rph3) and bst1 were spray inoculated and fungal growth was visualized at 48 hpi by lactophenol trypan blue staining (Koch and Slusarenko, 1990). The staining procedure was repeated twice, each with seven individual leaves.

Quantitative real‐time polymerase chain reaction

Spray‐inoculated wild‐type Bowman(Rph3) and bst1, treated with either H2O or B. sorokiniana, were harvested at 48 hpi. For each biological replicate, 10 individual leaves were used. Total plant RNA was isolated using the Aurum Total RNA Mini Kit (Bio‐Rad, Hercules, CA, USA). For cDNA syntheses, the iScript cDNA Synthesis Kit (Bio‐Rad) was used with 500 ng of total RNA, as described by the manufacturer. For the expression analysis, 10 µL ABsolute™ QPCR SYBR® Green Fluorescein Mix (Thermo Fisher Scientific Inc., Epsom, UK) was used, together with 3 µm of primers and 5 ng of cDNA, in a total reaction volume of 20 µL. All amplifications were performed in an iQ5 cycler (Bio‐Rad) with the conditions of 15 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, and 60 s at 60 °C, followed by a melt curve analysis. Reactions were analysed in triplicate and experiments were repeated twice. As reference, the barley GADPH (Horvath et al., 2003), CesA1 and Cyclophilin (Bengtsson, 2008) genes were used. Primer sequences used in the transcript analysis (Table 1) were designed using the software Primer3 v. 0.4.0 (http://frodo.wi.mit.edu/cgi‐bin/primer3/primer3_www.cgi).

Statistical analysis

Statistical analyses were carried out using MINITAB® Release 14.20 (Minitab Inc., State College, PA, USA). The data for mapping were evaluated using χ 2 analyses. Hsu's Multiple Comparisons with the Best (MCB) test (Hsu, 1984) was used to evaluate the fungal growth in point‐inoculated ND B112, ND 5883, Bowman(Rph3) and bst1 leaves. Student's t‐test was used to assess gene expression and GUS quantification in Bowman(Rph3) and bst1 inoculated plants at 48 hpi.

Supporting information

Table S1 List of selected amplified fragment length polymorphism (AFLP) primers used in the genetic mapping of bst1. MseI primers (M numbers) were used together with PstI primers (P numbers) on the F2 population between bst1 and Proctor, whereas EcoRI (E numbers) and MseI primers were employed on the F2 population between bst1 and Nudinka.

Table S2 Sequence information of the four closest amplified fragment length polymorphism (AFLP) markers to bst1.

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (45.5KB, doc)

Supporting info item

Click here for additional data file. (35.5KB, doc)

ACKNOWLEDGEMENTS

We thank Dr J. D. Frankowiak (QDPI, Warwick, Australia) for providing the near‐isogenic barley line Bowman harbouring the rust resistance gene Rph3, Dr E. Liljeroth (SLU, Alnarp Sweden) for the GUS‐transformed isolate and Dr R. Hopkins for language correction. This research was supported by the National Graduate Research School in Interactions between Micro‐Organisms and Plants (IMOP) at SLU, Fd Bryggareämbetets i Stockholm pensionskassa, the Royal Swedish Academy of Agriculture and Forestry, Helge Ax:son Johnssons Foundation and the Nilsson–Ehle Foundation.

REFERENCES

  1. Able, A.J. (2003) Role of reactive oxygen species in the response of barley to necrotrophic pathogens. Protoplasma, 221, 137–143. [DOI] [PubMed] [Google Scholar]
  2. Alfano, J.R. and Collmer, A. (2004) Type III secretion effector proteins: double agents in bacterial disease and plant defence. Annu. Rev. Phytopathol. 42, 385–414. [DOI] [PubMed] [Google Scholar]
  3. Bengtsson, T. (2008) Effects of seed treatment with a saprophytic fungus prior to barley leaf infection with Bipolaris sorokiniana—an immunolocalization study of PR‐1 and the development of a qRT‐PCR assay. Master Thesis, SLU, Sweden.
  4. Besson‐Bard, A. , Pugin, A. and Wendehenne, D. (2008) New insight into nitric oxide signaling in plants. Annu. Rev. Plant Biol. 59, 155–163. [DOI] [PubMed] [Google Scholar]
  5. Bouchez, O. , Huard, C. , Lorrain, S. , Roby, D. and Balague, C. (2007) Ethylene is one of the key elements for cell death and defense response control in the Arabidopsis lesion mimic mutant vad1 . Plant Physiol. 14, 465–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bradford, M.M. (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. [DOI] [PubMed] [Google Scholar]
  7. Brodersen, P. , Petersen, M. , Nielsen, H.B. , Zhy, S. , Newman, M.A. , Shokat, K.M. , Rietz, S. , Parker, J. and Mundy, J. (2006) Arabidopsis MAP kinase 4 regulates salicylic acid‐ and jasmonic acid/ethylene‐dependent responses via EDS1 and PAD4. Plant J. 47, 532–546. [DOI] [PubMed] [Google Scholar]
  8. Büschges, R. , Hollricher, K. , Panstruga, R. , Simons, G. , Wolter, M. , Frijters, A. , Van Daelen, R. , Van Der Lee, T. , Diergaarde, P. , Groenendijk, J. , Töpsch, S. , Vos, P. , Salamini, F. and Schulze‐Lefert, P. (1997) The barley Mlo gene: a novel control element of plant pathogen resistance. Cell, 88, 695–705. [DOI] [PubMed] [Google Scholar]
  9. Cao, H. , Bowling, S.A. , Gordon, A. and Dong, X. (1994) Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell, 6, 1583–1592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Castiglioni, P. , Pozzi, C. , Heun, M. , Terzi, V. , Müller, K.J. , Rodhe, W. and Salamini, F. (1998) An AFLP‐based procedure for the efficient mapping of mutations and DNA probes in barley. Genetics, 149, 2039–2056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chisholm, S.T. , Coaker, G. , Day, B. and Staskawicz, B.J. (2006) Host–microbe interactions: shaping the evolution of the plant immune response. Cell, 124, 803–814. [DOI] [PubMed] [Google Scholar]
  12. Clough, S.J. , Fengler, K.A. , Yu, I.‐C. , Lippok, B. , Smith, R.K. and Bent, F.A. (2000) The Arabidopsis dnd1 ‘defence no death’ gene encodes a mutated cyclic nucleotide‐gated ion channel. Proc. Natl. Acad. Sci. USA, 97, 9323–9328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cona, A. , Rea, G. , Botta, M. , Corelli, F. , Federico, R. and Angelini, R. (2006) Flavin‐containing polyamine oxidase is a hydrogen peroxide source in the oxidative response to the protein phosphatase inhibitor cantharidin in Zea mays L. J. Exp. Bot. 57, 2277–2289. [DOI] [PubMed] [Google Scholar]
  14. Dangl, J.L. , Dietrich, R.A. and Richberg, M.H. (1996) Death don't have no mercy: cell death programs in plant–microbe interactions. Plant Cell, 8, 1793–1807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Devadas, S.K. , Enyedi, A. and Raina, R. (2002) The Arabidopsis hrl1 mutation reveals novel overlapping roles for salicylic acid, jasmonic acid and ethylene signalling in cell death and defence against pathogens. Plant J. 30, 467–480. [DOI] [PubMed] [Google Scholar]
  16. Dietrich, R.A. , Delaney, T.P. , Uknes, S.J. , Ward, E.R. , Ryals, J.A. and Dangl, J.L. (1994) Arabidopsis mutants simulating disease resistance response. Cell, 77, 565–577. [DOI] [PubMed] [Google Scholar]
  17. Espinoza, C. , Medina, C. , Somerville, S. and Arce‐Johnson, P. (2007) Senescence‐associated genes induced during compatible viral interactions with grapevine and Arabidopsis. J. Exp. Bot. 58, 3197–3212. [DOI] [PubMed] [Google Scholar]
  18. Gechev, T.S. and Hille, J. (2005) Hydrogen peroxide as a signal controlling plant programmed cell death. J. Cell Biol. 168, 17–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gechev, T.S. , Van Breusegem, F. , Stone, J.M. , Denev, I. and Laloi, C. (2006) Reactive oxygen species as signals that modulate plant stress responses and programmed cell death. BioEssays, 28, 1091–1101. [DOI] [PubMed] [Google Scholar]
  20. Glazebrook, J. (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43, 205–227. [DOI] [PubMed] [Google Scholar]
  21. Horvath, H. , Rostoks, N. , Brueggeman, R. , Steffenson, B. , Von Wettstein, D. and Kleinhofs, A. (2003) Genetically engineered stem rust resistance in barley using the Rpg1 gene. Proc. Natl. Acad. Sci. USA, 100, 364–369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hsu, J.C. (1984) Ranking and selection and multiple comparisons with the best. Design of experiments: ranking and selection In: Essays in Honour of Robert E. Bechhofer (Santner T.J. and Tamhane A.C., eds), pp. 23–33. New York: Marcel Dekker. [Google Scholar]
  23. Jamet, E. , Albenne, C. , Boudart, G. , Irshad, M. , Canut, H. and Pont‐Lezica, R. (2008) Recent advances in plant cell wall proteomics. Proteomics, 8, 893–908. [DOI] [PubMed] [Google Scholar]
  24. Jefferson, R.A. , Kavanagh, T.A. and Bevan, M.W. (1987) GUS fusions: beta‐glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901–3907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jin, Y. , Statler, G.D. , Franckowiak, J.D. and Steffenson, B.J. (1993) Linkage between leaf rust resistance genes and morphological markers in barley. Phytopathology, 83, 230–233. [Google Scholar]
  26. Johal, G.S. , Hulbert, S. and Briggs, S.P. (1995) Disease lesion mimic mutations of maize: a model for cell death in plants. BioEssays, 17, 685–692. [Google Scholar]
  27. Jones, J.D. and Dangl, J.L. (2006) The plant immune system. Nature, 444, 323–329. [DOI] [PubMed] [Google Scholar]
  28. Kaliff, M. , Staal, J. , Myrenås, M. and Dixelius, C. (2007) ABA is required for Leptosphaeria maculans resistance via ABI1‐ and ABI4‐dependent signaling. Mol. Plant–Microbe Interact. 20, 335–345. [DOI] [PubMed] [Google Scholar]
  29. Kjaer, B. , Jensen, H.P. , Jensen, J. and Jorgensen, J.H. (1990) Associations between three ml‐o powdery mildew resistance genes and agronomic traits in barley. Euphytica, 46, 185–193. [Google Scholar]
  30. Koch, E. and Slusarenko, A. (1990) Arabidopsis is susceptible to infection by a downy mildew fungus. Plant Cell, 2, 437–445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kosambi, D.D. (1944) The estimation of map distance from recombination values. Ann. Eugen. 12, 172–175. [Google Scholar]
  32. Kumar, J. , Schäfer, P. , Hückelhoven, R. , Langen, G. , Baltruschat, H. , Stein, E. , Nagarajan, S. and Kogel, K.H. (2002) Bipolaris sorokiniana, a cereal pathogen of global concern: cytological and molecular approaches towards better control. Mol. Plant Pathol. 3, 185–195. [DOI] [PubMed] [Google Scholar]
  33. Liljeroth, E. , Jansson, H.B. and Schäfer, W. (1993) Transformation of Bipolaris sorokiniana with the GUS gene and use for studying fungal colonization of barley roots. Phytopathology, 83, 1484–1489. [Google Scholar]
  34. Lorrain, S. , Vailleau, F. , Balaguè, C. and Roby, D. (2003) Lesion mimic mutants: keys for deciphering cell death and defense pathways in plants? Trends Plant Sci. 8, 263–271. [DOI] [PubMed] [Google Scholar]
  35. Lorrain, S. , Lin, B. , Auriac, M.C. , Kroj, T. , Saindrenan, P. , Nicole, M. , Balague, C. and Roby, D. (2004) VASCULAR ASSOCIATED DEATH2, a novel GRAM domain‐containing protein, is a regulator of cell death and defense responses in vascular tissues. Plant Cell, 16, 2217–2232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lukacin, R. and Britsch, L. (1997) Identification of strictly conserved histidine and arginine residues as part of the active site in Petunia hybrida flavanone 3 beta‐hydroxylase. Eur. J. Biochem. 249, 748–757. [DOI] [PubMed] [Google Scholar]
  37. Lundqvist, U. , Franckowiak, J. and Konishi, T. (1997) New and revised descriptions of barley genes. Barley Genet. Newsl. 26, 22–44. [Google Scholar]
  38. Ma, Z.Q. , Lapitan, N.L.V. and Steffenson, B.J. (2004) QTL mapping of net blotch resistance genes in a doubled‐haploid population of six‐rowed barley. Euphytica, 137, 291–296. [Google Scholar]
  39. Marchetti, M.A. , Bollich, C.N. and Uecker, F.A. (1983) Spontaneous occurrence of the sekiguchi lesion in 2 American rice lines—its induction, inheritance, and utilization. Phytopathology, 73, 603–606. [Google Scholar]
  40. Michelmore, R.W. , Paran, I. and Kesseli, R.V. (1991) Identification of markers linked to disease‐resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA, 88, 9828–9832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Okinaka, Y. , Mise, K. , Okuno, T. and Furusawa, I. (2003) Characterisation of a novel barley protein, HCP1, that interacts with the Brome mosaic virus coat protein. Mol. Plant–Microbe Interact. 16, 352–359. [DOI] [PubMed] [Google Scholar]
  42. Persson, M. (2008) Cell death and defence gene responses in plant–fungal interaction. PhD Thesis No. 51. ISBN 978‐91‐85913‐84‐8. Uppsala: SLU Press. http://diss‐epsilon.slu.se/archive/00001845/
  43. Persson, M. , Rasmussen, M. , Falk, A. and Dixelius, C. (2008) Barley mutants with enhanced level of resistance to Swedish isolates of Bipolaris sorokiniana, casual agent of spot blotch. Plant Breed. 127, 639–643. [Google Scholar]
  44. Piffanelli, P. , Zhou, F. , Casais, C. , Orme, J. , Jarosch, B. , Schaffrath, U. , Collins, N.C. , Panstruga, R. and Schulze‐Lefert, P. (2002) The barley MLO modulator of defense and cell death is responsive to biotic and abiotic stress stimuli. Plant Physiol. 129, 1076–1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Raffaele, S. , Rivas, S. and Roby, D. (2006) An essential role for salicylic acid in AtMYB30‐mediated control of the hypersensitive cell death program in Arabidopsis. FEBS Lett. 14, 3490–3504. [DOI] [PubMed] [Google Scholar]
  46. Robert‐Seilaniantz, A. , Navarro, L. , Bari, R. and Jones, J.D. (2007) Pathological hormone imbalances. Curr. Opin. Plant Biol. 10, 372–379. [DOI] [PubMed] [Google Scholar]
  47. Rostoks, N. , Schmierer, D. , Kudrna, D. and Kleinhofs, A. (2003) Barley putative hypersensitive induced reaction genes: genetic mapping, sequence analyses and differential expression in disease lesion mimic mutants. Theor. Appl. Genet. 107, 1094–1101. [DOI] [PubMed] [Google Scholar]
  48. Rostoks, N.D. , Schmierer, D. , Mudie, S. , Drader, T. , Brueggeman, R. , Caldwell, D.G. , Waugh, R. and Kleinhofs, A. (2006) Barley necrotic locus nec1 encodes the cyclic nucleotide‐gated ion channel 4 homologous to the Arabidopsis HLM1 . Mol. Genet. Genomics, 275, 159–168. [DOI] [PubMed] [Google Scholar]
  49. Rusterucci, C. , Aviv, D.H. , Holt, B.F., III , Dangl, J.L. and Parker, J.E. (2001) The disease resistance signalling components EDS1 and PAD4 are essential regulators of the cell death pathway controlled by LSD1 in Arabidopsis. Plant Cell, 13, 2211–2224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rusterucci, C. , Espunya, M.C. , Diaz, M. , Chabannes, M. and Martinez, M.C. (2007) S‐Nitrosoglutathione reductase affords protection against pathogens in Arabidopsis, both locally and systemically. Plant Physiol. 143, 1282–1292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Schweizer, P. (2008) Tissue‐specific expression of a defence‐related peroxidase in transgenic wheat potentiates cell death in pathogen‐attacked leaf epidermis. Mol. Plant Pathol. 9, 45–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Shah, J. , Kachroo, P. , Nandi, A. and Klessig, D.F. (2001) A recessive mutation in the Arabidopsis SSI2 gene confers SA‐ and NPR1‐independent expression of PR genes and resistance against bacterial and oomycete pathogens. Plant J. 25, 563–574. [DOI] [PubMed] [Google Scholar]
  53. Shirano, Y. , Kachroo, P. , Shah, J. and Klessig, D.F. (2002) A gain‐of‐function mutation in an Arabidopsis Toll Interleukin 1 receptor‐nucleotide binding site‐leucine‐rich repeat type R gene triggers defense responses and results in enhanced disease resistance. Plant Cell, 14, 3149–3162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Takahashi, A. , Kawasaki, T. , Henmi, K. , Shii, K. , Kodama, O. , Satoh, H. and Shimamoto, K. (1999) Lesion mimic mutants of rice with alterations in early signalling events of defense. Plant J. 17, 535–545. [DOI] [PubMed] [Google Scholar]
  55. Thordal‐Christensen, H. , Zhang, Z. , Wei, Y. and Collinge, D.B. (1997) Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley–powdery mildew interaction. Plant J. 11, 1187–1194. [Google Scholar]
  56. Torres, M.A. , Jones, J.D. and Dangl, J.L. (2005) Pathogen‐induced NADPH oxidase‐derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana . Nat. Genet. 3, 1130–1134. [DOI] [PubMed] [Google Scholar]
  57. Van Damme, M. , Hubers, R.P. , Elberse, J. and Van den Ackerveken, G. (2008) Arabidopsis DMR6 encodes a putative 2OG‐Fe(II) oxygenase that is defense‐associated but required for susceptibility to downy mildew. Plant J. 54, 786–793. [DOI] [PubMed] [Google Scholar]
  58. Verberne, M.C. , Verpoorte, R. , Bol, J.F. , Mercado‐Blanco, J. and Linthorst, H.J. (2000) Overproduction of salicylic acid in plants by bacterial transgenes enhances pathogen resistance. Nat. Biotechnol. 18, 779–783. [DOI] [PubMed] [Google Scholar]
  59. Vos, P. , Hogers, R. , Bleeker, M. , Reijans, M. , Van De Lee, T. , Hornes, M. , Frijters, A. , Pot, J. , Peleman, J. , Kuiper, M. and Zabeau, M. (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Vranova, E. , Atichartpongkul, S. , Villarroel, R. , Van Montagu, M. , Inzé, D. and Van Camp, W. (2002) Comprehensive analysis of gene expression in Nicotiana tabacum leaves acclimated to oxidative stress. Proc. Natl. Acad. Sci. USA, 99, 10 870–10 875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Walbot, V. , Hoisington, D.A. and Neuffer, M.G. (1983) Disease lesion mimics in maize In: Genetic Engineering of Plants (Kosuge T., Meridith C. and Hollaender A., eds), pp. 431–442. New York, Plenum Publ. Comp. [Google Scholar]
  62. Weigel, D. and Glazebrook, J. (2002) Arabidopsis. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. [Google Scholar]
  63. Wolter, M. , Hollricher, K. , Salamini, F. and Schulze‐Lefert, P. (1993) The mlo resistance alleles to powdery mildew infection in barley trigger a developmentally controlled defence mimic phenotype. Mol. Gen. Genet. 239, 122–128. [DOI] [PubMed] [Google Scholar]
  64. Yin, Z.J. , Chen, L. , Zeng, M. , Goh, H. , Leung, G.S. , Khush, G.S. and Wang, G.L. (2000) Characterizing rice lesion mimic mutants and identifying a mutant with broad‐spectrum resistance to rice blast and bacterial blight. Mol. Plant–Microbe Interact. 13, 869–879. [DOI] [PubMed] [Google Scholar]
  65. Yoshida, S. , Ito, M. , Nishida, I. and Watanabe, A. (2002) Identification of a novel gene HYS1/CPR5 that has a repressive role in the induction of leaf senescence and pathogen‐defence responses in Arabidopsis thaliana . Plant J. 29, 427–437. [DOI] [PubMed] [Google Scholar]
  66. Yoshioka, K. , Kachroo, P. , Tsui, F. , Sharma, S.B. , Shah, J. and Klessig, D.F. (2001) Environmentally sensitive, SA‐dependent defense responses in the cpr22 mutant of Arabidopsis. Plant J. 26, 447–459. [DOI] [PubMed] [Google Scholar]
  67. Yu, I.C. , Parker, J. and Bent, A.F. (1998) Gene‐for‐gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. USA 95, 7819–7824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zago, E. , Morsa, S. , Dat, J.F. , Alard, P. , Ferrarini, A. , Inzé, D. , Delledonne, M. and Van Breusegem, F. (2006) Nitric oxide‐ and hydrogen peroxide‐responsive gene regulation during cell death induction in tobacco. Plant Physiol. 141, 404–411. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1 List of selected amplified fragment length polymorphism (AFLP) primers used in the genetic mapping of bst1. MseI primers (M numbers) were used together with PstI primers (P numbers) on the F2 population between bst1 and Proctor, whereas EcoRI (E numbers) and MseI primers were employed on the F2 population between bst1 and Nudinka.

Table S2 Sequence information of the four closest amplified fragment length polymorphism (AFLP) markers to bst1.

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (45.5KB, doc)

Supporting info item

Click here for additional data file. (35.5KB, doc)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES