Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2010 Jul 5;11(6):795–804. doi: 10.1111/j.1364-3703.2010.00644.x

In silico analysis reveals multiple putative type VI secretion systems and effector proteins in Pseudomonas syringae pathovars

PANAGIOTIS F SARRIS 1,2,✉, NICHOLAS SKANDALIS 1,2,3, MICHAEL KOKKINIDIS 1,2, NICKOLAS J PANOPOULOS 1,2,4,✉
PMCID: PMC6640432  PMID: 21091602

SUMMARY

Type VI secretion systems (T6SS) of Gram‐negative bacteria form injectisomes that have the potential to translocate effector proteins into eukaryotic host cells. In silico analysis of the genomes in six Pseudomonas syringae pathovars revealed that P. syringae pv. tomato DC3000, pv. tabaci ATCC 11528, pv. tomato T1 and pv. oryzae 1‐6 each carry two putative T6SS gene clusters (HSI‐I and HSI‐II; HSI: Hcp secretion island), whereas pv. phaseolicola 1448A and pv. syringae B728 each carry one. The pv. tomato DC3000 HSI‐I and pv. tomato T1 HSI‐II possess a highly similar organization and nucleotide sequence, whereas the pv. tomato DC3000, pv. oryzae 1‐6 and pv. tabaci 11528 HSI‐II are more divergent. Putative effector orthologues vary in number among the strains examined. The Clp‐ATPases and IcmF orthologues form distinct phylogenetic groups: the proteins from pv. tomato DC3000, pv. tomato T1, pv. oryzae and pv. tabaci 11528 from HSI‐II group together with most orthologues from other fluorescent pseudomonads, whereas those from pv. phaseolicola, pv. syringae, pv. tabaci, pv. tomato T1 and pv. oryzae from HSI‐I group closer to the Ralstonia solanacearum and Xanthomonas orthologues. Our analysis suggests multiple independent acquisitions and possible gene attrition/loss of putative T6SS genes by members of P. syringae.

Protein secretion/translocation systems play crucial roles in the interactions of pathogenic, symbiotic and commensal bacteria with eukaryotic host organisms. Such systems include the so‐called type I (T1SS), type II (T2SS), type III (T3SS), type IV (T4SS), type V (T5SS) and type VI (T6SS) systems (Economou et al., 2006). T2SS and T5SS secretion systems transport proteins to the extracellular milieu via a two‐step process. In general, T1SS, T3SS and T4SS secretion systems involve complex multiprotein channels (injectisomes) dedicated to the transport of selected sets of passenger proteins (effectors) from the bacterial cytoplasm, either to the extracellular environment or directly into eukaryotic cells (interkingdom protein transfer), probably bypassing both the bacterial periplasm and the prokaryote–eukaryote intercellular space. The secretion pathway T6SS remains unclear in this respect.T4SSs are unique among these systems in their ability to transport genetic molecules (DNA), either between bacteria or across the prokaryote–eukaryote phylogenetic divide, although at least some also transport proteins (Christie and Cascales, 2005).

T6SS is a recently characterized system that is composed of 15–20 proteins whose functions are not well understood (Bingle et al., 2008; Cascales, 2008; Filloux et al., 2008; Shrivastava and Mande, 2008). This system initially drew attention as a conserved family of pathogenicity islands or as an atypical T4SS gene locus in Gram‐negative bacteria, before being identified as encoding a protein secretory machinery required for virulence in Vibrio cholerae (Pukatzki et al., 2006) and Pseudomonas aeruginosa (Paer) (Mougous et al., 2006). T6SS landmarks include an AAA+Clp‐like ATPase (ClpB/ClpV), a regulatory FHA (fork‐head associated) domain protein (Fha), IcmF/IcmH(DotU)‐like proteins that are homologous to T4SS membrane components (Sexton et al., 2004) and the secreted Hcp‐like (haemolysin‐coregulated) and VgrG‐like (valine–glycine repeat) proteins, proposed effectors that are also essential components of the secretion machinery (reviewed in Pukatzki et al., 2009). The ClpB/V homologues belong to a subtype of ATPases, namely the AAA+ family (Schlieker et al., 2005), and appear to be essential for T6SS‐dependent secretion (Mougous et al., 2006). The ClpV group lacks the protein‐disaggregating function of ClpB‐type proteins, although still provides energy to the protein secretion process (Schlieker et al., 2005). Several additional proteins have also been implicated in T6SS‐mediated Hcp protein secretion in Paer strain PAO1 (Mougous et al., 2007): PpkA (a serine/threonine protein kinase) and PppA (a phosphatase) control T6SS function at the post‐translational level. These proteins act on a common protein substrate, Fha1, necessary for ClpV1 localization to T6SS foci. PpkA becomes activated by autophosphorylation under certain environmental conditions and, once these are removed, it dephosphorylates Fha1 and possibly PpkA, switching off T6SS. Several other genes, as well as quorum sensing (QS), also control T6SS gene transcription in various bacteria (Filloux et al., 2008; Ishikawa et al., 2009; Lesic et al., 2009; Liu et al., 2008). In Paer strain PAO1, one of the three T6SS systems (HSI‐I; HSI: Hcp secretion island) is transcriptionally coregulated with T3SS by the retS/ladS genes (Filloux et al., 2008). Furthermore, in the multihost strain PA14 of Paer, HSI‐I is negatively regulated by both the homoserine lactone transcription factor LasR and the 4‐hydroxyquinoline (HAQ) transcriptional regulator MvfR. The other two T6SSs (HSI‐II and HSI‐III) are positively controlled by LasR and MvfR, whereas PqsE, a key component of the MvfR regulon, is required for the expression of part of HSI‐III, but not HSI‐II (Lesic et al., 2009). The presence of genes coding for a putative σ54‐dependent transcriptional factor, sfa, in HSIs further suggests an additional level of regulation (Lesic et al., 2009).

In addition to the mammalian pathogens mentioned above, T6SS clusters have been implicated in the virulence of certain plant pathogenic bacteria, such as Agrobacterium tumefaciens (Wu et al., 2008), Pectobacterium atrosepticum (Liu et al., 2008; Mattinen et al., 2007) and Xanthomonas oryzae (Bingle et al., 2008), as well as in the multihost pathogen of Paer strain PA14 (Lesic et al., 2009). In addition to pathogenesis, T6SS may modulate root colonization/nodule formation by the nitrogen‐fixing plant symbionts/mutualists Mesorhizobium loti, Rhizobium leguminosarum (Bingle et al., 2008; Bladergroen et al., 2003) and Cupriavidus taiwanensis, which belongs to the phylogenetically distinct β‐Rhizobium group (Amadou et al., 2008). Recent in silico analyses of prokaryotic genomes (Bingle et al., 2008; Boyer et al., 2009) have further revealed that T6SSs are widespread among Proteobacteria, suggesting that they may be involved in yet unknown pathogenic or symbiotic lifestyles or other types of cell–cell communication.

In a previous study, Shrivastava and Mande (2008) reported the presence of putative core T6SS genes in some members of Pseudomonas syringae. In this study, we present a comparative in silico analysis of putative T6SS components in six strains of P. syringae. For three of these strains [P. syringae pv. tomato DC3000 (PstomDC), P. syringae pv. syringae B728a (Psyr) and P. syringae pv. phaseolicola 1448A (Psph)], whole genome sequences have been extensively annotated (http://pseudomonas‐syringae.org), whereas, for three others [P. syringae pv. oryzae 1‐6 (Psoryz), P. syringae pv. tabaci ATCC 11528 (Pstab) and P. syringae pv. tomato T1 (PstomT1)], full or partial genomic sequences are available at the draft stage. Our analysis allowed us to identify genes encoding for putative T6SS core components and candidate effectors that had not been described previously in the aforementioned bacteria. In addition, we carried out a phylogenetic analysis of the ClpV/B ATPases and IcmF orthologues, which provides a basis for an understanding of the phylogenetic roots of T6SSs in pathogenic members of P. syringae.

To retrieve T6SS homologue coding loci in the phytopathogenic P. syringae genomes, blastp and reverse blastp analyses (Supporting data file, see Supporting Information) were initially performed in the annotated proteomes of PstomDC, Psyr and Psph (PPI Home page, http://pseudomonas‐syringae.org) and in the Pseudomonas genome database (Stover et al., 2000; Winsor et al., 2009; http://pseudomonas.com), using standard/default blast parameters. Bait protein sequences coded by the T6SS gene islands (HSI‐I, HSI‐II and HSI‐III) of Paer strains PA01 and PA14 were used, as they have been reported by Mougous et al. (2006) and Lesic et al. (2009). Subsequently, Blastp searches were carried out against all KEGG bacterial genomes (>500) using, as bait, all putative T6SS proteins (HSI‐Is) from P. syringae pv. phaseolicola and P. syringae pv. syringae B728a. The closest orthologues identified were from Paer, P. fluorescens and P. putida plus those of HSIs in other P. syringae strains.

Gene clusters potentially coding for putative T6SS core components also exist in the other strains, with either complete or segmental syntenies to those in Paer. For example, IcmF‐IcmH‐HsiJ and ClpV‐HsiH‐HisG‐HsiF proteins are coded by adjacent genes, in the same order and orientation, in the HSIs of all six strains, as in Paer (Fig. 1). Some HSIs of P. syringae strains also have adjacent vgr‐hcp genes, whereas others do not, as is the case with Paer HSIs. These physical arrangements may indicate common regulation and possible physical or functional interactions. The key features of the HSIs in the different strains examined are described below.

Figure 1.

Figure 1

Open in a new tab

Putative type VI secretion system (T6SS) clusters from Pseudomonas syringae pathovars. The amino acid sequences of proteins encoded by the three T6SS gene clusters of P. aeruginosa (two, HSI‐I and HSI‐III, are included in this diagram) were used as queries for blastp and reverse blast searches against the genomes of the P. syringae strains. The putative T6SS clusters deduced for the two P. syringae pv. tomato strains (DC3000 and T1), P. syringae pv. syringae strain B728a, P. syringae pv. phaseolicola strain 1448a, P. syringae pv. tabaci strain ATCC 11528 and P. syringae pv. oryzae strain 1‐6. Orthologues (indicated by the same colours) are based on a blastp E‐value of less than e10 or on the annotated or previously published data (Lindeberg et al., 2008; Wu et al., 2008). Genes adjacent or assigned to the T6SS clusters, but not recognized as orthologues, are indicated by light beige arrows. Arrows indicate the direction of transcription. In each cluster, the four‐digit locus number is shown only for the left‐most gene and the last two digits for the other genes. Published or annotated gene/protein designations are indicated below each gene. Bacterial name abbreviations are as follows: P. aeruginosa (Pseudomonas aeruginosa PAO1); Pstom DC3000 (Pseudomonas syringae pv. tomato DC3000); Pstom T1 (Pseudomonas syringae pv. tomato T1); Psyr B728a (Pseudomonas syringae pv. syringae B728a); Psph 1448a (Pseudomonas syringae pv. phaseolicola 1448a); Pstab 11528 (Pseudomonas syringae pv. tabaci ATCC 11528); Psoryz 1‐6 (Pseudomonas syringae pv. oryzae 1‐6).

Two contiguous clusters coding for potential T6SS proteins were found in the PstomDC genome and were designated HSI‐I and HSI‐II. The HSI‐I cluster comprised 15 genes [open reading frames (ORFs), locus numbers PSPTO_2538 to PSPTO_2554], whereas the HSI‐II cluster contained 22 (PSPTO_5415 to PSPTO_5436; homology between corresponding loci in the two clusters is given in Table S1, see Supporting Information). The contiguity of each cluster is interrupted between hsiB and hcp orthologues by the presence of a putative ISPssy transposase gene (PSPTO_2541 in HSI‐I and PSPTO_5428 in HSI‐II) bracketed by uncharacterized DNA segments, and between hsiJ and sfa orthologues by two small putative ORFs (PSPTO_2550 and PSPTO_2551 in HSI‐I and PSPTO_5421 and PSPTO_5423 in HSI‐II) unrelated to T6SS components (Fig. 1). A gene coding for a VgrG homologue is terminally located in HSI‐I, whereas two such genes are found at either end of HSI‐II. fha and pppA orthologues (PSPTO_5422 and PSPTO_5417) are present only in HSI‐II, between or adjacent to small putative ORFs unrelated to T6SS. A pppA/stp locus is embedded in HSI‐II, but is absent from HSI‐I; pppB orthologues appear to be absent, but a ppkA orthologue is found in a distant location (PSPTO_2874), next to a gene coding for the putative type III effector HopL1 (PSPTO_2872) plus two putative ABC transporters (Fig. 1). The possible significance of this linkage is not apparent and it should be noted that the P. syringae HopL proteins were recently invalidated as type III effectors (see List of Assigned Hop names at http://pseudomonas‐syringae.org/hop_used_names.htm). Nevertheless, the linkage of T6SS and putative T3SS effector genes apparently occurs near one of the HSI‐II and HSI‐III termini in the multihost pathogen Paer strain PA14 (Lesic et al., 2009).

In the Psyr genome, six contiguous genes (hsiB, hsiC, hsiF, hsiG, hsiH and clpB/V) coding for orthologous proteins are found in the same order and orientation to those in the PstomDC HSI‐I counterparts, as in each HSI of PAO1 and PA14 (Fig. 1, and data not shown). Amino acid sequence identities between these and the Paer PAO1 orthologues did not exceed 56% (Table S3, see Supporting Information). A nearly identical cluster to Psyr HSI is found in Psph, with amino acid identity values to Paer PAO1 counterparts up to 60% (Table S2, see Supporting Information). Distinct features of the HSIs in both Psyr and Psph are the presence of genes unlinked to the core clusters coding for putative VgrG‐like proteins, the presence of a ppkA orthologue in Psyr but not in Psph and the extra copies of hcp‐like genes, especially in Psph, that are scattered throughout the genome, except for one copy which is found next to the ompA‐like genes near the terminus of the HSI clusters of both bacteria. A pppA orthologue is also present, but at a distant location from the main clusters in both strains (Fig. 1).

To identify candidate T6SS clusters in the draft versions of the genome sequences of the other P. syringae strains, blast analyses were performed in GenBank (National Center for Biotechnology Information, NCBI) using, as bait, the predicted protein sequences coded in the HSIs of PstomDC and Psph. Two putative T6SS clusters were found in PstomT1, Psoryz and Pstab (Fig. 1; Tables S4a,b and S5a,b, see Supporting Information). In the PstomT1 genome, a cluster of 11 highly homologous genes (99–100%) is found in near‐perfect synteny to the HSI‐I counterparts of PstomDC (Table S4a). When PstomDC HSI‐II‐predicted gene sequences were used as bait, the only orthologue found in PstomT1 corresponded to PSPTO_5430 (coding for a protein of unknown function), with 45% identity to the bait sequence. Nucleotide identities between Psoryz and Pstab genes and the PstomDC HSI‐I bait sequences varied from 54% to 96% and from 50% to 76%, respectively, except for orthologues of PSPTO_5422 (coding for an Fha domain protein), which has a disrupted orthologue with 57% homology in Psoryz HSI‐II (Psyrpo1_18588) and seems to be absent from Pstab (HSI‐II) (Tables S4a and S5b). Finally, a gene coding for a PppA orthologue is also distant from the putative HSIs in PstomT1 (PSPTOT1_4968) and Psoryz (see Table S4), as in Psph and Psyr (Fig. 1). A putative ppkA orthologue is present at some distance (70 ORFs) away from the putative PstomT1 HSI and in the same gene context (i.e. near genes coding a putative HopL1 and ABC transporter) as its orthologues in PstomDC and Psyr.

Similar searches in the PstomT1, Psoryz and Pstab genomes revealed a second putative T6SS cluster (HSI‐I) which has an identical organization and high nucleotide sequence homology (93–100%; Tables S4b and S5a) to the Psph T6SS.

Based on the studies of Mougous et al. (2006) and Lesic et al. (2009), we further sought to identify candidate regulatory gene orthologues to retS/lads, mvfR, lasR, pqsE and sfa in the P. syringae strains by blast searches using the aforementioned Paer proteins as bait. Genes coding for putative RetS homologues have been annotated in the PPI Home site (http://pseudomonas‐syringae.org) for PstomDC (PSPTO_4868), Psyr (Psyr_4088) and Psph (Psph_4451), and candidate homologues were identified in our blast searches for PstomT1 (annotated as PSPTOT1_0312 in NCBI), Pstab and Psoryz (data not shown). LadS homologues also exist in PstomDC (PSPTO_4796), Psyr (Psyr_4339), Psph (PSPPH_4381), PstomT1, Pstab and Psoryz (data not shown). No candidate MvfR, LasR or PqsE homologues were identified in any of the six P. syringae strains. Finally, genes for Sfa homologues (σ54‐dependent transcriptional activator) were found in both HSIs of PstomDC, in the HSI‐II cluster of Pstab and the HSI clusters of PstomT1 and Psoryz, but were seemingly absent from those of Psyr, Psph and from the Pstab HSI‐I cluster.

Phylogenetic trees were constructed (see Supporting data file) for the Clp‐ATPases and IcmF‐like proteins of various bacterial species of different phylogenetic proximity to P. syringae pathovars. The Clp protein tree shows two deep branches (designated cluster I and cluster II in Fig. 2). Cluster I carries all but one P. syringae orthologue and is divided into two broad groups. One (called the ‘Pst’ group) includes the two PstomDC ClpB/V orthologues (PSPTO_2548 and PSPTO_5425), together with the PstomT1, Psoryz and Pstab ClpB/V proteins PSPTOT1_2217, Psyrpo1_18603 and PsyrptA_32530, as well as most Clp orthologues from other fluorescent pseudomonads [Pseudomonas entomophila, Pseudomonas fluorescens and Pseudomonas mendocina plus the ClpV2 protein (PA1662) of the HSI‐II cluster of Paer]. In the other group (‘Psph’ group), the Psph ClpB/V (PSPPH_0129), Pstab ClpB/V (PsyrptA_10435), Psyr ClpB/V (Psyr_4958), PstomT1 ClpB (PSPTOT1_4113) and Psoryz ClpB/V (Psyrpo1_25205) proteins cluster very close to each other, having as nearest neighbours ClpB/V orthologues from phylogenetically distant pathogens (Xanthomonas oryzae pv. oryzicola, Xanthomonas oryzae pv. oryzae and Ralstonia solanacearum). The putative ClpB/V protein of Psph, coded by the solitary locus PSPH_0742, appears in cluster II of the Clp tree, close to the P. putida (Pput_0665) and P. fluorescens (PFL_5304) orthologues. Finally, Paer ClpV1 (HSI‐I), ClpV2 (HSI‐II) and ClpV3 (HSI‐III) are located in separate clades of the tree.

Figure 2.

Figure 2

Open in a new tab

Evolutionary relationships of 47 ClpB/V orthologue proteins from various bacterial species. The evolutionary history was inferred using the neighbour‐joining method (Saitou and Nei, 1987). The optimal tree with the sum of branch length = 6.63970056 is shown. The percentage of replicate trees in which the associated ClpB/V proteins clustered together in the bootstrap test (1000 replicates) is shown next to each branch (Felsenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965), and are in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). There were a total of 782 positions in the final dataset. Phylogenetic analyses were conducted by means of mega4 software (Tamura et al., 2007). Bacterial name abbreviations are as follows: PstomDC (Pseudomonas syringae pv. tomato DC3000); PstomT1 (Pseudomonas syringae pv. tomato T1); Psyr (Pseudomonas syringae pv. syringae B728a); Psph (Pseudomonas syringae pv. phaseolicola 1448a); Psoryz (Pseudomonas syringae pv. oryzae 1‐6); Pstab (Pseudomonas syringae pv. tabaci 11528). Abbreviated genus names: E, Escherichia; P, Pseudomonas; R, Ralstonia; X, Xanthomonas.

In the IcmF tree (Fig. 3), two distinct subgroups were also formed (also designated ‘Pstom’ and ‘Psph’ groups). The PstomDC IcmF paralogues (coded by PSPTO_2554 and PSPTO_5418), together with the PstomT1 (PSPTOT1_2212), Psoryz (Psyrpo1_18563) and Pstab (PsyrptA_32495) proteins, clustered together with the IcmF proteins from P. entomophila, P. fluorescens, P. mendocina and Paer IcmF2 of the HSI‐II locus (PA1669) in the Pstom group. The IcmF orthologues of Psph (PSPPH_0125), Psyr (Psyr_4962), Pstab (PsyrptA_10410), PstomT1 (PSPTOT1_4109) and Psoryz (Psyrpo1_25185) clustered very close to each other, with the R. solanacearum and X. oryzae pv. oryzicola IcmF homologues (RSp0763 and Xoryz_6365) being their nearest neighbours. Interestingly, the Paer IcmF3 protein (PA2361) appeared as an outgroup in our analysis, whereas the Paer IcmF1 homologue (PA0077) clustered with the X. campestris pv. citri, X. axonopodis pv. citri and X. campestris pv. vesicatoria IcmF proteins (XAC4119, XAC4119, XCV2138; Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Evolutionary relationships of 36 IcmF orthologue proteins of various bacterial species. Tree construction and other details are given in the legend to Fig. 2.

Identical tree topologies were obtained by phylogenetic tree construction for three additional T6SS core proteins (ImpB, ImpC and DotU) (Figs S2–S4, see Supporting Information).

Our computational genomic screening approach has revealed the presence of contiguous genomic clusters coding for putative T6SS core components, plus single or multiple unlinked loci coding for putative T6SS effector proteins, in all six P. syringae strains examined. Duplicate T6SS clusters occur in four of the strains examined (PstomDC, PstomT1, Pstab and Psoryz), representative of pathovars with distinct host specialization. The other two strains (Psph and Psyr) harbour single T6SS clusters. Several of the strains carry multiple copies of genes coding for Hcp‐ Vgr‐ and Hsi‐like proteins. We have not assigned specific gene/protein designations in the P. syringae HSIs at this stage of our analysis to avoid confusion in ongoing genome annotations. In addition to structural core proteins and putative effectors that serve as landmarks of T6SS clusters, all six strains examined carry genes potentially coding for the regulatory proteins RetS and LadS, but not MvfR or PsqE homologues, and these are not linked to the HSIs, as is also the case for other bacteria. Genes for Sfa orthologues were found in both HSIs of PstomDC and in HSI‐II of Pstab, PstomT1 and Psoryz, but were seemingly absent from the HSIs of Psyr and Psph and HSI‐I of Pstab, PstomT1 and Psoryz, where they were apparently replaced by homologues annotated as VirB (VasD) in the KEGG database. Genes for putative PpkA orthologues were found in three strains (PstomDC, Psyr and PstomT1) that also carry a gene for a T3SS effector HopL1‐like protein, but appear to be absent from the other strains. With regard to pppA, the PppA/Stp protein embedded in HSI‐II of PstomDC matches its PAO1 HSI‐I orthologue along its entire length, whereas the predicted proteins in all other strains/HSIs are longer (marked by a star in Fig. 1) and their N‐terminal portion matches the PP2Cc superfamily of serine/threonine protein kinases.

Partial or full sets of T6SS orthologues have been described in several phytopathogenic and symbiotic bacteria, including P. syringae, Erwinia carotovora, Pe. atrosepticum, R. solanacearum and Burkholderia cepacia (Bingle et al., 2008; Boyer et al., 2009; Lindeberg et al., 2008; Liu et al., 2008; Shrivastava and Mande, 2008; Wu et al., 2008), and have been implicated in the virulence of A. tumefaciens (Wu et al., 2008), Pe. atrosepticum (Liu et al., 2008; Mattinen et al., 2007), Xanthomonas spp. (Bingle et al., 2008) and in the multihost pathogen of Paer strain PA14 (Lesic et al., 2009). Whether the putative HSIs in P. syringae pathovars are involved in pathogenesis or are functional protein secretion/translocation channels, and the environmental conditions under which they might be expressed, remain to be determined. Some observations raise questions as to whether or not these systems are functional in some of the strains studied. For example, the orthologue of the PSPTO_5418 gene in Pstab HSI‐II, coding for an IcmF‐related protein, has a point mutation which creates an in‐frame stop codon at position 741 (codon 247), and some ORFs in Psoryz and Pstab HSI‐II seem to be disrupted (Fig. 1). Further, a ppkA orthologue appeared to be absent from Psph and, as already noted, the predicted PppA proteins in most strains examined (except for PstomDC) are coded outside the HSIs, and their N‐terminal portion matches well the PP2Cc superfamily of serine/threonine protein kinases in blastp analysis. Finally, an impA gene in PstomDC HSI‐I seems to be nonfunctional because of a transposon insertion (PSPTO_2541, ISPssy transposase) in the corresponding genomic region.

Our phylogenetic analysis for five core proteins of the T6SS secretion machinery (ClpB/V, IcmF, DotU, ImpB and ImpC) revealed a Pstom group, which includes one subgroup with closer phylogenetic relationship among the Clp proteins of PstomDC, PstomT1, Psoryz and Pstab from HSI‐II, as well as another subgroup formed by the ClpB/V2 protein of PstomDC, the Paer ClpV2 protein and by homologues from other nonphytopathogenic fluorescent Pseudomonads. This group is distinct from ClpB/V of other P. syringae pathovars and from Paer ClpV2 and ClpV3. The Clp proteins of Psph, Psyr, Pstab, Psoryz and PstomT1 from HSI‐I grouped closer to those of R. solanacearum, Xanthomonas spp. and the ClpV1 and ClpV3 proteins from Paer, whereas the second ClpB/V orthologue of Psph, coded by the solitary PSPPH_0742 gene, was placed in cluster II separately from all other P. syringae Clp orthologues. An analogous situation occurs with IcmF and IcmF homologues from these strains, with the IcmF3 protein of the Paer HSI‐III locus appearing as an outgroup in the bootstrap analysis. The incongruent phylogenies of these proteins with those of the 16S rRNA gene and other conserved genes, such as rpoB, for members of the Pseudomonas genus (Tayeb et al., 2005), coupled with the absence of a PstomDC HSI‐II orthologue cluster in PstomT1 and the absence of a PstomT1 HSI‐I orthologue cluster in PstomDC, suggest that core T6SS genes in the various strains probably originated from multiple independent acquisitions by horizontal gene transfer from different sources.

The involvement of T6SS in pathogenicity has been established for several bacterial pathogens, including Vibrio cholerae, Paer and Burkholderia pseudomallei in mammalian and other eukaryote host models (Mougous et al., 2006; 2006, 2007; Schell et al., 2007). T6SS clusters have also been implicated in the virulence of certain plant pathogenic bacteria, such as A. tumefaciens (Wu et al., 2008), Pe. atrosepticum (Liu et al., 2008; Mattinen et al., 2007), Xanthomonas spp. (Bingle et al., 2008) and Paer strain PA14 (Lesic et al., 2009). However, there is no information so far on whether T6SS in members of P. syringae is functional and what its biological role might be. To obtain preliminary evidence for transcriptional expression, we carried out reverse transcriptase‐polymerase chain reaction (RT‐PCR) in total RNA extracts from cultures grown in rich (Luria–Bertani) and minimal (M9) media, after exhaustive treatment with RNase‐free DNase I (Roche Applied Science, Indianapolis, IN, USA) to detect putative RNA transcripts of icmF orthologues in PstomDC (PSPTO_5418 in HSI‐II) and Psph (PSPPH_0125). Such transcripts were indeed found under both growth conditions tested (Fig. S1, see Supporting Information), indicating that the gene is probably expressed in both strains.

Multiple copies of T6SS in a single bacterial strain appear to be a frequent phenomenon. Recent studies (Boyer et al., 2009; Filloux et al., 2008) have indicated that multiple copies of apparently complete and/or degenerate T6SS loci occur in about one‐third of over 500 of the proteobacterial genomes examined, that they generally display different phylogenetic origins and are not a result of recent duplication events, suggesting sustained and constrained mechanisms that favour this trend. In the case of pathogenic bacteria, such mechanisms may involve host/vector biology, adaptations via regulatory mechanisms and specialization of effectors to host cellular targets. Our study provides a basis for focused investigations on this newly discovered and poorly understood secretion system in this group of plant pathogens.

Supporting information

Fig. S1 Detection of putative RNA transcripts for the icmF loci (A) of Pseudomonas syringae pv. tomato DC3000 (PSPTO_5418, HSI‐II, lanes 1, 2) and P. syringae pv. phaseolicola 1448A (PSPH_0125, lanes 3, 4) and rRNA (B) by reverse transcriptase‐polymerase chain reaction (RT‐PCR) carried out in DNAase‐treated total RNA extracts from 24‐h cultures grown in Luria–Bertani (LB) (lanes 1, 3) and M9‐glucose (lanes 2, 4) media. Negative control PCR (C) was performed on total RNA from P. syringae pv. tomato DC3000 cultivated in M9 medium (lane 1), P. syringae pv. tomato DC3000 cultivated in LB medium (lane 2), P. syringae pv. phaseolicola 1448a cultivated in M9 medium (lane 3) and P. syringae pv. phaseolicola 1448a cultivated in M9 medium (lane 4), without reverse transcriptase assay. Primers were designed to amplify 642‐ and 771‐nucleotide regions of PSPTO_5418 and PSPPH_0125 (A), and a 540‐nucleotide region of rRNA (B). Primer sequences were as follows: PSPTO_5418 upper, 5′‐GCACCCAGCACTGCGACTGGTACTTC‐3′; lower, 5′‐CCAGATTGGCGCCGATGCCAGCG‐3′; PSPPH_0125 upper, 5′‐GCACCCAGCACTGCGACTGGTACTTC‐3′; lower, 5′‐GGGTCAGGTCACGGTCAGGGAAAATG‐3′; rRNA upper, 5′‐CGGGTACTTGTACCTGGTGGC‐3′; lower, 5′‐CTTGCCAGTTTTGGATGCAGTTC‐3′. Molecular weight markers were phage λ DNA digested with HindIII/EcoRI (A) and PstI (B and C). The experiment was repeated with different cultures and with similar results.

Fig. S2 Evolutionary relationships of 36 DotU/ImpK homologue proteins from various bacterial species. The evolutionary history was inferred using the neighbour‐joining method (Saitou and Nei, 1987). The optimal tree with the sum of branch length = 10.80240760 is shown. The percentages of replicate trees in which the associated DotU/ImpK clustered together in the bootstrap test (1000 replicates) are shown next to the branches (Felsenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965) and are in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). There were a total of 205 positions in the final dataset. Phylogenetic analyses were conducted in mega4 (Tamura et al., 2007).

Fig. S3 Evolutionary relationships of 25 ImpB homologue proteins from various bacterial species. Tree construction and other details are given in the legend to Fig. S2.

Fig. S4 Evolutionary relationships of 23 ImpG homologue proteins from various bacterial species. Tree construction and other details are given in the legend to Fig. S2.

Table S1 Homologies between hypothetical proteins of the putative type VI secretion system (T6SS) clusters (HSI‐I and HSI‐II) of Pseudomonas syringae pv. tomato DC3000. Gene locus numbers are as annotated at PPI Home (http://pseudomonas‐syringae.org).

Table S2 (a) Putative type VI secretion system (T6SS) proteins in Pseudomonas syringae pv. syringae B728a (Psyr). Locus numbers (Psyr) and protein names are as annotated at http://genome.jgi‐psf.org/psesy/psesy.home.html. Protein identities with PAO1 homologues (as annotated at http://www.pseudomonas.com; Stover et al., 2000; Winsor et al., 2009) are included. (b) Reverse blast results for putative type VI secretion system (T6SS) proteins of Pseudomonas syringae pv. syringae B728a (Psyr). Locus numbers (Psyr) and protein names are as annotated at http://genome.jgi‐psf.org/psesy/psesy.home.html. Protein identities with PAO1 homologues (as annotated at http://www.pseudomonas.com; Stover et al., 2000; Winsor et al., 2009) are included.

Table S3 (a) Putative type VI secretion system (T6SS) genes in Pseudomonas syringae pv. phaseolicola 1448A (Psph). Locus numbers (Psph) and protein names are as annotated at http://pseudomonas‐syringae.org. Percentage protein identities with PAO1 homologues (PAO), as annotated at http://www.pseudomonas.com (Stover et al., 2000; Winsor et al., 2009), are included. (b) Reverse blast results for the putative type VI secretion system (T6SS) genes of Pseudomonas syringae pv. phaseolicola 1448A (Psph). Locus numbers (Psph) and protein names are as annotated at http://pseudomonas‐syringae.org). Percentage protein identities with PAO1 homologues (PAO), as annotated at http://www.pseudomonas.com (Stover et al., 2000; Winsor et al., 2009), are included.

Table S4 (a) Putative type VI secretion system (T6SS) genes in Pseudomonas syringae pv. tomato T1 (PstomT1) and P. syringae pv. oryzae 1‐6 (Psoryz) and protein identities with P. syringae pv. tomato DC3000 (PstomDC) and/or P. syringae pv. phaseolicola 1448A (Psph) homologues. Gene locus numbers for PstomDC and Psph are as annotated at PPI Home (http://pseudomonas‐syringae.org). (b) Putative type VI secretion system (T6SS) genes in Pseudomonas syringae pv. tomato T1 (PstomT1) and P. syringae pv. oryzae 1‐6 (Psoryz) and protein identities with P. syringae pv. phaseolicola 1448A (Psph) homologues. Gene locus numbers for Psph are as annotated at PPI Home (http://pseudomonas‐syringae.org).

Table S5 (a, b) Putative type VI secretion system (T6SS) genes of Pseudomonas syringae pv. tabaci ATCC 11528 (Pstab) identified by blastn analysis of the indicated contigs deposited at http://www.ncbi.nlm.nih.gov//genomes/geblast.cgi?gi=6282) and homologies to P. syringae pv. phaseolicola 1448A (Psph) HSI and P. syringae pv. tomato DC3000 (PstomDC) HSI‐II genes used as bait (locus numbers as annotated at PPI Home, http://pseudomonas‐syringae.org).

Supporting data file Materials and methods.

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (30.5KB, doc)

Supporting info item

Click here for additional data file. (7.7MB, doc)

Supporting info item

Click here for additional data file. (51.5KB, doc)

Supporting info item

Click here for additional data file. (420.5KB, doc)

Supporting info item

Click here for additional data file. (447.5KB, doc)

Supporting info item

Click here for additional data file. (98.5KB, doc)

Supporting info item

Click here for additional data file. (84KB, doc)

ACKNOWLEDGEMENTS

This work was supported in part by grants from the Greek Ministry of Education (EPEAEK‐Protein Biotechnology and Plant Molecular Biology and Biotechnology graduate programs) and by Grants 05NON‐EU‐170, PEP‐DEL4 and PENED875‐03ED, implemented within the framework of the ‘Reinforcement Programme of Human Research Manpower’ (PENED) and co‐financed by National and Community Funds (25% from the Greek Ministry of Development‐General Secretariat of Research and Technology and 75% from EU‐European Social Fund from the General Secretariat for Research and Technology of Greece). We thank Dr Laurence Rahme for sharing unpublished data with us.

REFERENCES

  1. Amadou, C. , Pascal, G. , Mangenot, S. , Glew, M. , Bontemps, C. , Capela, D. , Carrère, S. , Cruveiller, S. , Dossat, C. , Lajus, A. , Marchetti, M. , Poinsot, V. , Rouy, Z. , Servin, B. , Saad, M. , Schenowitz, C. , Barbe, V. , Batut, J. , Médigue, C. and Masson‐Boivin, C. (2008) Genome sequence of the rhizobium Cupriavidus taiwanensis and comparative genomics of rhizobia. Genome Res. 18, 1472–1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bingle, L.E.H. , Bailey, C.E. and Pallen, M.J. (2008) Type VI secretion: a beginner's guide. Curr. Opin. Microbiol. 11, 3–8. [DOI] [PubMed] [Google Scholar]
  3. Bladergroen, M.R. , Badelt, K. and Spaink, H.P. (2003) Infection blocking genes of a symbiotic Rhizobium leguminosarum strain that are involved in temperature‐dependent protein secretion. Mol. Plant–Microbe Interact. 16, 53–64. [DOI] [PubMed] [Google Scholar]
  4. Boyer, F. , Fichant, G. , Berthod, J. , Vandenbrouck, Y. and Attree, I. (2009) Dissecting the bacterial type VI secretion system by a genome wide in silico analysis: what can be learned from available microbial genomic resources? BMC Genomics, 10, 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cascales, E. (2008) The type VI secretion toolkit. EMBO Rep. 9, 735–741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Christie, P.J. and Cascales, E. (2005) Structural and dynamic properties of bacterial type IV secretion systems. Mol. Membr. Biol. 22, 51–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Economou, A. , Christie, P.J. , Fernandez, R.C. , Palmer, T. , Plano, G.V. and Pugsley, A.P. (2006) Secretion by numbers: protein traffic in prokaryotes. Mol. Microbiol. 62, 308–319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783–791. [DOI] [PubMed] [Google Scholar]
  9. Filloux, A. , Hachani, A. and Bleves, S. (2008) The bacterial type VI secretion machine: yet another player for protein transport across membranes. Microbiology, 154, 1570–1583. [DOI] [PubMed] [Google Scholar]
  10. Ishikawa, T. , Rompikuntal, P.K. , Lindmark, B. , Milton, D.L. and Wai, S.N. (2009) Quorum sensing regulation of the two hcp alleles in Vibrio cholerae O1 strains. PLoS ONE, 4, e6734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lesic, B. , Starkey, M. , He, J. , Hazan, R. and Rahme, G.L. (2009) Quorum sensing differentially regulates Pseudomonas aeruginosa type VI secretion locus I and homologous loci II and III, which are required for pathogenesis. Microbiology, 155, 2845–2855 (DOI 10.1099/mic.0.029082‐0). [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lindeberg, M. , Myers, C.R. , Collmer, A. and Schneider, D.J. (2008) Roadmap to new virulence determinants in Pseudomonas syringae: insights from comparative genomics and genome organization. Mol. Plant–Microbe Interact. 21, 685–700. [DOI] [PubMed] [Google Scholar]
  13. Liu, H. , Coulthurst, S.J. , Pritchard, L. , Hedley, P.E. , Ravensdale, M. , Humphris, S. , Burr, T. , Takle, G. , Brurberg, M.B. , Birch, P.R. , Salmond, G.P. and Toth, I.K. (2008) Quorum sensing coordinates brute force and stealth modes of infection in the plant pathogen Pectobacterium atrosepticum . PLoS Pathog. 4, e1000093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Mattinen, L. , Nissinen, R. , Riipi, T. , Kalkkinen, N. and Pirhonen, M. (2007) Host‐extract induced changes in the secretome of the plant pathogenic bacterium Pectobacterium atrosepticum . Proteomics, 7, 3527–3537. [DOI] [PubMed] [Google Scholar]
  15. Mougous, J.D. , Cuff, M.E. , Raunser, S. , Shen, A. , Zhou, M. , Gifford, C.A. , Goodman, A.L. , Joachimiak, G. , Ordonez, C.L. , Lory, S. , Walz, T. , Joachimiak, A. and Mekalanos, J.J. (2006) A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus. Science, 312, 1526–1530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mougous, J.D. , Gifford, C.A. , Ramsdell, T.L. and Mekalanos, J.J. (2007) Threonine phosphorylation post‐translationally regulates protein secretion in Pseudomonas aeruginosa . Nat. Cell Biol. 9, 797–803. [DOI] [PubMed] [Google Scholar]
  17. Pukatzki, S. , Ma, A.T. , Sturtevant, D , Krastins, B. , Sarracino, D. , Nelson, W.C. , Heidelberg J.F. and Mekalanos, J.J. (2006) Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc. Natl. Acad. Sci. USA, 103, 1528–1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Pukatzki, S. , Ma, A.T. , Revel, A.T. , Sturtevant, D. and Mekalanos, J.J. (2007) Type VI secretion system translocates a phage tail spike‐like protein into target cells where it crosslinks actin. Proc. Natl. Acad. Sci. USA, 104, 15508–15513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pukatzki, S. , McAuley, S.B. and Miyata, S.T. (2009) The type VI secretion system: translocation of effectors and effector‐domains. Curr. Opin. Microbiol. 12, 11–17. [DOI] [PubMed] [Google Scholar]
  20. Saitou, N. and Nei, M. (1987) The neighbor‐joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. [DOI] [PubMed] [Google Scholar]
  21. Schell, M.A. , Ulrich, R.L. , Ribot, W.J. , Brueggemann, E.E. , Hines, H.B. , Chen, D. , Lipscomb, L. , Kim, H.S. , Mrázek, J. , Nierman, W.C. and Deshazer, D. (2007) Type VI secretion is a major virulence determinant in Burkholderia mallei . Mol. Microbiol. 64, 1466–1485. [DOI] [PubMed] [Google Scholar]
  22. Schlieker, C. , Zentgraf, H. , Dersch, P. and Mogk, A. (2005) ClpV, a unique Hsp100/Clp member of pathogenic proteobacteria. Biol. Chem. 386, 1115–1127. [DOI] [PubMed] [Google Scholar]
  23. Sexton, J.A. , Miller, J.L. , Yoneda, A. , Kehl‐Fie, T.E. and Vogel, J.P. (2004) Legionella pneumophila DotU and IcmF are required for stability of the Dot/Icm complex. Infect. Immun. 72, 5983–5992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shrivastava, S. and Mande, S.S. (2008) Identification and functional characterization of gene components of Type VI secretion system in bacterial genomes. PLoS ONE, 3, 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Stover, C.K. , Pham, X.Q. , Erwin, A.L. , Mizoguchi, S.D. , Warrener, P. , Hickey, M.J. , Brinkman, F.S. , Hufnagle, W.O. , Kowalik, D.J. , Lagrou, M. , Garber, R.L. , Goltry, L. , Tolentino, E. , Westbrock‐Wadman, S. , Yuan, Y. , Brody, L.L. , Coulter, S.N. , Folger, K.R. , Kas, A. , Larbig, K. , Lim, R. , Smith, K. , Spencer, D. , Wong, G.K. , Wu, Z. , Paulsen, I.T. , Reizer, J. , Saier, M.H. , Hancock, R.E. , Lory, S. and Olson, M.V. (2000) Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature, 406, 959–964. [DOI] [PubMed] [Google Scholar]
  26. Tamura, K. , Dudley, J. , Nei, M. and Kumar, S. (2007) MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. [DOI] [PubMed] [Google Scholar]
  27. Tayeb, A.L. , Ageron, E. , Grimont, F. and Grimont, P.A.D. (2005) Molecular phylogeny of the genus Pseudomonas based on rpoB sequences and application for the identification of isolates. Res. Microbiol. 156, 763–773. [DOI] [PubMed] [Google Scholar]
  28. Winsor, G.L. , Van Rossum, T. , Lo, R. , Khaira, B. , Whiteside, M.D. , Hancock, R.E. and Brinkman, F.S. (2009) Pseudomonas genome database: facilitating user‐friendly, comprehensive comparisons of microbial genomes. Nucleic Acids Res. 37 (Database issue), D483–D488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wu, H.Y. , Chung, P.C. , Shih, H.W. , Wen, S.R. and Lai, E.M. (2008) Secretome analysis uncovers an Hcp‐family protein secreted via a type VI secretion system in Agrobacterium tumefaciens . J. Bacteriol. 190, 2841–2850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zuckerkandl, E. and Pauling, L. (1965) Evolutionary divergence and convergence in proteins In: Evolving Genes and Proteins (Bryson V. and Vogel H.J., eds), pp. 97–166. New York: Academic Press. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 Detection of putative RNA transcripts for the icmF loci (A) of Pseudomonas syringae pv. tomato DC3000 (PSPTO_5418, HSI‐II, lanes 1, 2) and P. syringae pv. phaseolicola 1448A (PSPH_0125, lanes 3, 4) and rRNA (B) by reverse transcriptase‐polymerase chain reaction (RT‐PCR) carried out in DNAase‐treated total RNA extracts from 24‐h cultures grown in Luria–Bertani (LB) (lanes 1, 3) and M9‐glucose (lanes 2, 4) media. Negative control PCR (C) was performed on total RNA from P. syringae pv. tomato DC3000 cultivated in M9 medium (lane 1), P. syringae pv. tomato DC3000 cultivated in LB medium (lane 2), P. syringae pv. phaseolicola 1448a cultivated in M9 medium (lane 3) and P. syringae pv. phaseolicola 1448a cultivated in M9 medium (lane 4), without reverse transcriptase assay. Primers were designed to amplify 642‐ and 771‐nucleotide regions of PSPTO_5418 and PSPPH_0125 (A), and a 540‐nucleotide region of rRNA (B). Primer sequences were as follows: PSPTO_5418 upper, 5′‐GCACCCAGCACTGCGACTGGTACTTC‐3′; lower, 5′‐CCAGATTGGCGCCGATGCCAGCG‐3′; PSPPH_0125 upper, 5′‐GCACCCAGCACTGCGACTGGTACTTC‐3′; lower, 5′‐GGGTCAGGTCACGGTCAGGGAAAATG‐3′; rRNA upper, 5′‐CGGGTACTTGTACCTGGTGGC‐3′; lower, 5′‐CTTGCCAGTTTTGGATGCAGTTC‐3′. Molecular weight markers were phage λ DNA digested with HindIII/EcoRI (A) and PstI (B and C). The experiment was repeated with different cultures and with similar results.

Fig. S2 Evolutionary relationships of 36 DotU/ImpK homologue proteins from various bacterial species. The evolutionary history was inferred using the neighbour‐joining method (Saitou and Nei, 1987). The optimal tree with the sum of branch length = 10.80240760 is shown. The percentages of replicate trees in which the associated DotU/ImpK clustered together in the bootstrap test (1000 replicates) are shown next to the branches (Felsenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965) and are in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). There were a total of 205 positions in the final dataset. Phylogenetic analyses were conducted in mega4 (Tamura et al., 2007).

Fig. S3 Evolutionary relationships of 25 ImpB homologue proteins from various bacterial species. Tree construction and other details are given in the legend to Fig. S2.

Fig. S4 Evolutionary relationships of 23 ImpG homologue proteins from various bacterial species. Tree construction and other details are given in the legend to Fig. S2.

Table S1 Homologies between hypothetical proteins of the putative type VI secretion system (T6SS) clusters (HSI‐I and HSI‐II) of Pseudomonas syringae pv. tomato DC3000. Gene locus numbers are as annotated at PPI Home (http://pseudomonas‐syringae.org).

Table S2 (a) Putative type VI secretion system (T6SS) proteins in Pseudomonas syringae pv. syringae B728a (Psyr). Locus numbers (Psyr) and protein names are as annotated at http://genome.jgi‐psf.org/psesy/psesy.home.html. Protein identities with PAO1 homologues (as annotated at http://www.pseudomonas.com; Stover et al., 2000; Winsor et al., 2009) are included. (b) Reverse blast results for putative type VI secretion system (T6SS) proteins of Pseudomonas syringae pv. syringae B728a (Psyr). Locus numbers (Psyr) and protein names are as annotated at http://genome.jgi‐psf.org/psesy/psesy.home.html. Protein identities with PAO1 homologues (as annotated at http://www.pseudomonas.com; Stover et al., 2000; Winsor et al., 2009) are included.

Table S3 (a) Putative type VI secretion system (T6SS) genes in Pseudomonas syringae pv. phaseolicola 1448A (Psph). Locus numbers (Psph) and protein names are as annotated at http://pseudomonas‐syringae.org. Percentage protein identities with PAO1 homologues (PAO), as annotated at http://www.pseudomonas.com (Stover et al., 2000; Winsor et al., 2009), are included. (b) Reverse blast results for the putative type VI secretion system (T6SS) genes of Pseudomonas syringae pv. phaseolicola 1448A (Psph). Locus numbers (Psph) and protein names are as annotated at http://pseudomonas‐syringae.org). Percentage protein identities with PAO1 homologues (PAO), as annotated at http://www.pseudomonas.com (Stover et al., 2000; Winsor et al., 2009), are included.

Table S4 (a) Putative type VI secretion system (T6SS) genes in Pseudomonas syringae pv. tomato T1 (PstomT1) and P. syringae pv. oryzae 1‐6 (Psoryz) and protein identities with P. syringae pv. tomato DC3000 (PstomDC) and/or P. syringae pv. phaseolicola 1448A (Psph) homologues. Gene locus numbers for PstomDC and Psph are as annotated at PPI Home (http://pseudomonas‐syringae.org). (b) Putative type VI secretion system (T6SS) genes in Pseudomonas syringae pv. tomato T1 (PstomT1) and P. syringae pv. oryzae 1‐6 (Psoryz) and protein identities with P. syringae pv. phaseolicola 1448A (Psph) homologues. Gene locus numbers for Psph are as annotated at PPI Home (http://pseudomonas‐syringae.org).

Table S5 (a, b) Putative type VI secretion system (T6SS) genes of Pseudomonas syringae pv. tabaci ATCC 11528 (Pstab) identified by blastn analysis of the indicated contigs deposited at http://www.ncbi.nlm.nih.gov//genomes/geblast.cgi?gi=6282) and homologies to P. syringae pv. phaseolicola 1448A (Psph) HSI and P. syringae pv. tomato DC3000 (PstomDC) HSI‐II genes used as bait (locus numbers as annotated at PPI Home, http://pseudomonas‐syringae.org).

Supporting data file Materials and methods.

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (30.5KB, doc)

Supporting info item

Click here for additional data file. (7.7MB, doc)

Supporting info item

Click here for additional data file. (51.5KB, doc)

Supporting info item

Click here for additional data file. (420.5KB, doc)

Supporting info item

Click here for additional data file. (447.5KB, doc)

Supporting info item

Click here for additional data file. (98.5KB, doc)

Supporting info item

Click here for additional data file. (84KB, doc)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES