Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2008 Jul 11;9(6):763–775. doi: 10.1111/j.1364-3703.2008.00497.x

Differential profiling of selected defence‐related genes induced on challenge with Alternaria brassicicola in resistant white mustard and their comparative expression pattern in susceptible India mustard

KAUSHIK GHOSE 1, SANJUKTA DEY 1, HANNAH BARTON 2, GARY J LOAKE 2, DEBABRATA BASU 1,✉
PMCID: PMC6640447  PMID: 19019005

SUMMARY

The lack of availability of sources of resistance against Alternaria brassicicola within the family Brassicaceae has made oilseed mustard plants a target for one of the most damaging and widespread fungal diseases, Alternaria black spot. Of the other non‐host‐resistant/tolerant plants, Sinapis alba, white mustard, is considered to be the most important apart from Arabidopsis. To understand the defence response of S. alba upon incompatible interaction with this pathogen, a functional genomic approach using cDNA amplified fragment length polymorphism was performed. The highly reproducible bands, found to be either more amplified or uniquely present in infected S. alba plants compared with non‐infected plants, were further subjected to comparative reverse Northern analysis in the incompatible white mustard (S. alba) and compatible India mustard (Brassica juncea L.) plants. The suppression of 46% of the genes in the compatible background indicates the possibility of effective and specific recognition of Alternaria in S. alba. Analysis of the 118 genes up‐regulated specifically in infected S. alba compared with B. juncea showed that 98 genes have similarity to proteins such as receptor‐like protein kinase genes, genes involved with calcium‐mediated signalling and salicylic acid‐dependent genes as well as other genes of known function in Arabidopsis. The apparent expression profile data were further confirmed for selected genes by quantitative real‐time polymerase chain reaction analysis. Classification of these genes on the basis of their induction pattern in Arabidopsis indicates that the expression profile of several of these genes was distinct in S. alba compared with B. juncea.

INTRODUCTION

Alternaria black spot is one of the most damaging and widespread fungal diseases of the oilseed mustards Brassica juncea, Brassica napus and Brassica rapa. The major constraint towards introgression of disease resistance characters is unavailability of sources of resistance against the causal pathogen Alternaria brassicicola within the germplasm of oilseed mustards. By contrast, Arabidopsis thaliana and non‐crossable Sinapis alba, which belong to the same family (Brassicaceae) as oilseed mustards, express non‐host resistance against A. brassicicola (Pedras et al., 2001; Thomma et al., 1999).

Arabidopsis non‐host resistance genes (Navarno et al., 2004) as well as pathogen‐associated molecular pattern (PAMP)‐triggered genes (Thilmony et al., 2006) have already been characterized and the molecular basis of basal resistance was found largely to overlap with incompatible responses to avirulent pathogens (Eulgem et al., 2004). These defence mechanisms are primarily controlled by transcriptional activation of defence‐related genes (Glazebrook 2001). During incompatible interactions defence‐related genes are expressed with accelerated kinetics and increased magnitude relative to their induction during the expression of basal resistance (Eulgem et al., 2004; Maleck et al., 2000; Tao et al., 2003). In the case of non‐host resistance, PAMPs play a vital role in controlling pathogen invasion (Eulgem et al., 2004). They can be perceived during both compatible and incompatible interactions but in the absence of resistance (R) gene‐mediated recognition, basal resistance can be suppressed by effector proteins from virulent pathogens (Caldo et al., 2004). Conversely, incompatible interactions through specific recognition of avirulence (AVR) proteins are robust and negate any pathogen‐mediated suppression by accelerated expression of defence responses (Tao et al., 2003).

Key modulators of the plant defence response, which control signalling process locally as well as systematically, are salicylic acid (SA), jasmonic acid (JA), ethylene (ET) (Glazebrook 2005; Grant and Loake 2007), reactive oxygen intermediates (ROIs) (Grant and Loake, 2000) and nitric oxide (NO) (Feechan et al., 2005; Hong et al., 2008), with several independent pathways found to be instrumental. In the JA‐insensitive mutant coi‐1 of Arabidopsis, resistance against A. brassicicola is compromised and systemic expression of the JA‐inducible PDF1.2 gene is also reduced significantly within 12 h of infection with A. brassicicola. This indicates the requirement of JA‐mediated responses for the expression of this trait (Glazebrook 1999). By contrast, the fact that the SA‐insensitive mutant npr‐1 and SA‐depleted nahG line have no effect on the resistance phenotype (Thomma et al., 1998) indicates no direct involvement of SA as a signalling molecule.

Additionally, phytoalexins may also play a major role in conferring resistance against A. brassicicola as the pad3‐1 mutant of Arabidopsis, which affects the production of the indole‐type phytoalexin camalexin, is more susceptible than wild‐type Col‐0. The role of camalexin was found to be in the inhibition of destruxin B production (a major phytotoxin produced by A. brassicicola) (Pedras et al., 2003). In the ET‐insensitive ein‐2 mutant and nahG plants, although camalexin biosynthesis is lowered upon infection (Thomma et al., 1999), resistance against A. brassicicola is not compromised. However, induction of PR1, a marker of SA signalling, and enhanced biosynthesis of the antifungal compound camalexin upon infection with A. brassicicola in Arabidopsis raises the possibility of cross‐talk between these different signalling networks. Furthermore, camalexin biosynthesis has been found to be positively controlled by SA, ROI and ET but not by JA. Hydroxylated destruxin B, which acts as an inducer of phytoalexin biosynthesis in resistant S. alba, is found to be generated by detoxification through hydroxylation of destruxin B. This step is dominant in S. alba compared with B. juncea (Pedras et al., 2001, 2003) but no information is available so far as to whether this is a part of a signalling network.

Recently, mutations in asymmetric leaves 1 (as1), resulting from a forward genetic screen, were found to convey increased disease resistance against both A. brassicicola and Botrytis cinerea in Arabidopsis (Nurmberg et al., 2007). AS1 encodes an MYB transcription factor that has a well‐established role in leaf dorso‐ventral pattern formation (Waites et al., 1998) and as1 is a classical mutation in Arabidopsis (Rédei and Hirono, 1964). While AS1 functions in combination with AS2 and other transcription factors to control leaf development, AS1 operates independently of AS2 and cognate components in disease resistance (Nurmberg et al., 2007). Furthermore, this novel function for AS1 is conserved in plant species with a divergence time of ~150 Myr.

Microarray analysis has shown that a large number of genes induced by A. brassicicola in Arabidopsis (Saskia et al., 2003) were also co‐induced or co‐repressed after treatment with SA, JA or ET (Schenk et al., 2000) and many of them were induced systemically (Schenk et al., 2003). Seok et al. (2005) found that one ET‐sensitive GDSL lipase, also induced by SA, was involved in resistance against A. brassicicola. In addition, proteomic analysis of two B. napus lines suggested a role for ROI‐mediated auxin signalling as part of the tolerance mechanism towards this pathogen (Sharma et al., 2007). The collective evidence indicates that a coordinated network prevails among SA, JA, ET and ROI signalling pathways engaged during the establishment of resistance against A. brassicicola. Although significant transcriptome analysis data from Arabidopsis and to a lesser extent B. napus are available, comparisons of data between genetically close compatible and incompatible species are missing. In this context, a combination of PCR‐based and hybridization‐based transcript profiling of genes through techniques such as cDNA‐AFLP (amplified fragment length polymorphism) and reverse Northern analysis, respectively, have been carried out to understand similarities and differences at the molecular level through comparing the gene expression pattern between resistant S. alba and susceptible B. juncea plants, which are closely related. Comparison of the expression profiles during these plant–microbe interactions created the possibility of studying the identified genes in two genetic backgrounds that are apparently equipped with the same set of basal resistance genes but with altered signal perception capacity.

RESULTS

Disease progression

Visible lesion formation was observed on infected leaves of S. alba as well as B. juncea; Fig. 1A shows leaves excised from intact plants after infection at different time points. It appeared that the rate of hyphal growth was increased in B. juncea compared with S. alba. Lesion formation appeared to be faster in B. juncea as it started to develop after 48 h and spread over the entire leaf within 72 h. In an identical situation, S. alba did not develop lesions at the infection site until after 72 h and the rate of increase in lesion diameter was considerably slower compared with in B. juncea. Trypan blue (TB) staining of the challenged leaves (data not shown) of both S. alba and B. juncea at different time points showed that this fungus started sporulating within 24 h in B. juncea leaves but only at 36 h in S. alba. Upon transferring the plants to sunlight (both infected and control plants of S. alba and B. juncea) it was observed that infected S. alba plants survived and grew well for more than 15 days though the infected leaves were shed within 7 days and showed some growth retardation compared with control S. alba (uninfected) plants. In comparison, infected B. juncea plants died within a week (Fig. 1B).

Figure 1.

Figure 1

Open in a new tab

Challenge of S. alba and B. juncea with A. brassicicola. (A) Leaves of S. alba and B. juncea were detached from the plant at 48 and 72 h following infection with A. brassicicola. Control leaves were detached from plants without fungal inoculation. (a) Brassica juncea leaf—control; (b) Brassica juncea leaf— 48 h after infection; (c) Brassica juncea leaf 72 h after infection; (d) Sinapis alba mock control; (e) Sinapis alba leaf 48 h after infection; (f) Sinapis alba leaf 72 h after infection. (B) S. alba and B. juncea plants infected with an A. brassicicola spore suspension. (a) Left, control Brassica juncea; right Brassica juncea—5 days after infection. (b) Sinapis alba mock control. (c) Sinapis alba 15 days after infection. Arrows indicate the S. alba leaves which were shed after infection.

cDNA‐AFLP

cDNA‐AFLP (Bachem et al., 1996; Durrant et al., 2000; Vos et al., 1995) is an extremely efficient, reproducible and high‐throughput PCR‐based mRNA fingerprinting method in which prior knowledge of the sequences is not a prerequisite. This approach can be applied when genome‐wide microarrays are not available (Reijans et al., 2003). However, analysis of all the transcripts at a particular time point through cDNA‐AFLP is limited by the availability of restriction sites. Thus, as well as using the two restriction sites EcoRI and MseI, an EcoRI site was incorporated into the oligo dT primer to ensure that all the cDNA was at least restricted with EcoRI.

Comparisons of the cDNA‐AFLP profiles with 100 possible primer combinations were carried out between infected and non‐infected S. alba. The auto‐radiograms (Fig. 2) are representatives of many such gels. During the process, about 5500 bands were scored. The 223 highly reproducible bands (100–800 bp) were either uniquely present in infected plants or amplified to a greater extent in A. brassicicola challenged compared with mock challenged plants. All of these 223 bands were reamplified after elution from gels with specific cDNA‐AFLP primer combinations and the sizes of the fragments were checked in agarose gels.

Figure 2.

Figure 2

Open in a new tab

cDNA‐AFLP profile of Sinapis alba transcripts on infection with A. brassicicola. Representative autoradiogram of cDNA‐AFLP gels: C, non‐infected S. alba cDNA; I, infected S. alba cDNA; M, labelled 100‐bp ladder. Arrows indicate some of the up‐regulated or uniquely expressed amplified cDNA‐AFLP fragments found in infected S. alba.

Differential screening of the cDNA‐AFLP fragments by reverse Northern analysis

In total, 223 cDNA‐AFLP fragments were reamplified and subjected to reverse Northern analysis using α‐P32‐dCTP‐labelled first‐strand cDNA of non‐infected S. alba and those infected for 48 h. This was undertaken by a dot blot method in order to judge the apparent expression pattern and eliminate false positive bands obtained from the cDNA‐AFLP experiment. Furthermore, a second reverse Northern analysis using α‐P32‐dCTP‐labelled first‐strand cDNAs of non‐infected B. juncea and those infected for 48 h was performed to check the expression pattern of the 223 cDNA‐AFLP fragments in the susceptible species. The hybridization pattern of two sets of 32 fragments each are represented in Fig. 3. No hybridization in 11 fragments out of 223 (5%) in both S. alba and B. juncea indicated high levels of positive amplification in cDNA‐AFLP as no hybridization does not rule out the possibility of weakly expressed genes. The intensity of hybridization of the spots was analysed using ‘Phosphor imager’ for comparative analysis of the transcript level of the 212 products between S. alba and B. juncea. Among the 177, the 118 fragments (67%) which were up‐regulated in S. alba compared with B. juncea upon infection are presented in Supporting Information Table S3. In B. juncea the status of these 118 fragments were: 54 fragments (46%) down‐regulated in the infected compared with non‐infected B. juncea and 19 fragments (16%) equally expressed in both control and infected plants. Another 45 fragments (38%) were up‐regulated both in B. juncea and in S. alba on infection, but the induction was greater in S. alba. The remaining 59 (33%) of the 177 fragments were up‐regulated more in infected B. juncea compared with S. alba and were not included for further study, except for a few randomly selected genes. It is important to mention that all the 177 fragments were hybridized with three different batches of non‐infected and infected S. alba and B. juncea labelled cDNA in a highly reproducible and consistent manner.

Figure 3.

Figure 3

Open in a new tab

Reverse Northern analysis of selected cDNA‐AFLP fragments. Autoradiogram representing dot blot hybridization of purified and reamplified cDNA fragments of two sets of 32 fragments each with α‐P32dCTP labelled first‐strand cDNA. The spots marked with circles indicate the internal control, GADPH.

Distribution of the 118 fragments in terms of fold induction in S. alba were: 46 (39%) showed at least a two‐fold increase, 22 (18%) showed a greater than two‐fold but less than five‐fold induction, 33 (28%) showed a greater than five‐fold but less than ten‐fold induction, and 17 fragments (15%) showed a greater than ten‐fold induction compared with the control. Although this kind of approach is sufficient for the elimination of false positive bands and classification of genes in terms of expression, the quantification of transcript levels may vary with some genes due to inevitable cross hybridization.

Cloning of reamplified fragments and sequence analysis

Using the novel strategy detailed in the experimental procedures below, the cDNA fragments which were up‐regulated in infected S. alba compared with infected B. juncea were cloned and sequenced. Additionally, a few cDNA fragments which were expressed more in infected B. juncea compared with infected S. alba were randomly selected and cloned in the same fashion and sequenced.

Of the 118 cDNA‐AFLP fragments, 98 (83%) which showed high homology with known plant genes present in the database and no or very little homology with genes of other organisms were considered. The remaining 20 fragments showed homology with expressed proteins whose functions are not yet known (Supporting Information Table S3). In summary, 23 were either plant defence‐related or stress response‐related, 12 encoded transcription factor‐related proteins, ten were calcium‐signalling‐related, seven were protein kinase‐related, 17 were photosynthesis and metabolic pathway‐related genes, 13 were transporter‐related and intra‐membrane protein genes, and 16 were involved with transcription and translation. Among the genes which were expressed more in infected B juncea, six showed high homology to an anti‐fungal protein (AAY15221.1), cytochrome P450 (AAD03415.1), an MLO family protein (DQ988610), pectin esterase inhibitor (DQ988555), peroxidase 33 (DQ988543) and no apical meristem (NAM) genes (Supporting Information Table S3). All the sequences were submitted in batch to the NCBI database by Sequin, a standalone software tool developed by NCBI for submitting large numbers of sequences to GenBank. The accession numbers provided were DQ988528–DQ988620, EF107052–EF107090 and EF595983. Although no information about A. brassicicola‐induced genes was available, a few genes from S. alba such as the antifungal protein (AAY15221.1), cytochrome P450 (AAD03415.1) and chalcone synthase (CAA32496.1) were already present in the database and their presence was further confirmed by our analysis.

Relative quantification of transcript levels by real‐time PCR

The expression pattern of 12 of the genes was analysed by real‐time quantitative RT‐PCR (Fig. 4) to validate the results obtained from reverse Northern analysis and also for quantitative assessment of the relative abundance of the transcripts at different time points (48 and 64 h) in the localized leaves of both S. alba and B. juncea (48 h). The expression patterns of eight of these genes were monitored in systemic leaves of S. alba at 48, 72 and 96 h after A. brassicicola infection (Fig. 5). The GADPH gene was used as an internal standard to normalize any variation in the quantity and quality of the starting template cDNA. In the case of B. juncea the 64‐h samples were not included in this study as the huge down‐regulation of the GADPH gene evidently indicated the possible onset of necrosis of the entire leaf (data not shown). Primers of all the 12 genes including GADPH were designed from S. alba cDNA sequences (Supporting Information Table S4) and tested by normal RT‐PCR to ensure the specificity of the primers as well as for optimization of cDNA concentration in both S. alba and B. juncea. The bar diagrams (4, 5) represent the average fold induction values of infected S. alba localized and distal uninoculated leaves as well as localized B. juncea leaves compared with the control after calculating the standard error where n = 3 (n represents the number of biological replicates). It was observed that the overall pattern of expression (i.e. up‐regulation and down‐regulation) of these 12 genes reflected the same trend and also corroborated the result obtained by reverse Northern blotting. Among these genes, enhanced expression of anti‐fungal protein (AAY15221.1), cytochrome P450 (AAD03415.1) and MLO family protein (DQ988610) in infected B juncea compared with S. alba was also reflected in reverse Northern data. However, comparison of the fold‐induction values between reverse Northern and real‐time quantitative RT‐PCR indicated some variation. The likely reason was that real‐time quantitative RT‐PCR is more specific and accurate for quantification compared with reverse Northern analysis, as the possibility of cross‐hybridization among the homologous genes cannot be ruled with reverse Northern blotting.

Figure 4.

Figure 4

Open in a new tab

Real‐time relative quantitative estimation of the genes induced in B. juncea and S. alba leaves following local challenge with A. brassicicola. Bar diagrams representing the relative changes in expression of twelve genes with respect to respective controls. Error bars represent SE (n = 3). Open bars, control; closed bars, 48 h localized; shaded bars, 64 h localized leaves of S. alba and B. juncea.

Figure 5.

Figure 5

Open in a new tab

Real‐time relative quantitative estimation of genes induced in systemic leaves of S. alba following challenge with A. brassicicola. Bar diagrams representing the relative change in systemic expression (i.e. expression in distal uninoculated leaves) of eight genes with respect to controls. Error bars represent SE (n = 3). Open bars, control; closed bars, 48 h systemic; pale shaded bars, 72 h systemic; dark shaded bars, 96 h systemic leaves of S. alba.

DISCUSSION

Deciphering the resistance mechanism of Arabidopsis and S. alba against the fungal pathogen A. brassicicola has immense potential for increasing the production of rapeseed mustard by minimization of yield loss. In Arabidopsis, A. brassicicola‐induced genes have been documented by Schenk et al. (2003). However, information on A. brassicicola‐induced genes in S. alba is not yet available. Thus, the present approach of expression profiling of S. alba on infection with A. brassicicola and comparative expression analysis with B. juncea is a significant step in this direction.

Comparative expression analysis indicates that a significant number of genes (33%) are over‐expressed during compatible interactions compared with during incompatible interactions. A similar phenomenon has been reported for B. napus infected with Sclerotinia sclerotiorum (Zhao et al., 2007). Furthermore, the phenomenon of gene suppression in a compatible background indicates that, in the absence of suppressed genes, the genes which were up‐regulated in the compatible background may not be directly involved with resistance. Thus, comparative transcript profiling through reverse Northern analysis comparing the resistant S. alba and susceptible B. juncea has been carried out to eliminate the genes induced more in compatible interactions than in incompatible interactions. Several of the gene classes up‐regulated in S. alba overlapped with non‐host resistance genes (Navarno et al., 2004) as well as PAMP‐triggered genes (Thilmony et al., 2006). On the other hand, suppression of 46% of genes in the compatible background indicates the possibility of effective and specific recognition of the pathogen in S. alba, which shows for the first time, at the molecular level, that the interaction of S. alba with A. brassicicola may be an incompatible interaction. Expression of a number of genes both in S. alba and in B. juncea on infection demonstrated that apparently compatible and incompatible interactions may not be attributable to largely distinct molecular mechanisms, but rather that many of these mechanisms may be shared. In summary, the percentage of different classes of genes which are induced more in S. alba compared with B. juncea on infection are: 19.5% encode plant defence‐related or stress response‐related, 10% encode transcription factor‐related proteins, 8.5% are calcium‐signalling‐related, 6% are protein kinase‐related, 14.5% are photosynthesis and metabolic pathway‐related genes, 11% are transporter‐related and intra‐membrane protein genes, 13.5% are involved with transcription and translation, and 17% show homology with expressed proteins whose functions are not yet known. Similar induction patterns of genes by using cDNA‐AFLP‐mediated differential profiling of transcripts in the case of infection with other organisms on different resistant plants have also been reported (Polesani et al., 2008; Torres et al., 2003).

However, the contribution of genetic differences between S. alba and B. juncea, which belong to the same family, requires further investigation.

Early signal perception components

In plants, RLKs (Receptor like kinase) are localized in the plasma membrane and act as high‐affinity binding sites for PAMPs and play a vital role within multi‐component protein complexes for the activation of basal resistance. Several leucine‐rich repeat (LRR)‐containing RLK genes are found to be up‐regulated at the transcriptional level in Arabidopsis in response to different PAMPs as well as by phytohormones and wounding. For example, RLK3 (Czernic et al., 1999), FRK1 (Asai et al., 2002), various different types of RLKs (Liqun and Zhixiang, 2000) and ADR1 (Grant et al., 2003) have already been documented. In S. alba, two RLK genes (DQ988582, DQ988587), which have very high homology with Arabidopsis homologues AT3G14350.3 and AT2G31880.1, respectively, were found by reverse Northern blotting to be marginally up‐regulated on infection with A. brassicicola. The real‐time quantification of DQ988582 showed that expression was marginally induced or remained at the basal level in infected S. alba but that in B. juncea this gene was down‐regulated significantly on infection.

The LRR containing lectin protein kinases LECRK1 and LRK1 in Arabidopsis and Pi‐d2 in rice, which confers resistance to Magnaporthe grisea (Xuewei et al., 2006), are capable of recognizing oligosaccharide elicitors derived from the breakdown of the cell wall (Herve et al., 1996). One such RLK gene with a legume lectin binding site showed transient up‐regulation in S. alba but down‐regulation in B. juncea by reverse Northern and real‐time quantitative RT‐PCR analysis (Fig. 5).

Another very important participant in this cascade are the mitogen‐activated protein kinases (MAPKs). Comparison of the expression of the MPK6‐like gene by real‐time PCR showed that in B. juncea this gene was down‐regulated significantly compared with S. alba at 48 h in localized infected leaves (Fig. 5). The systemic induction of MPK6 was also observed in S. alba with an increase in expression after a longer infection time. MPK6 is known to be an SA‐induced protein kinase (SIPK) (Zhang and Klessig, 2001) and plays a role in both R gene‐mediated resistance and basal resistance (Asai et al., 2002; Frank et al., 2004). The MPK6‐mediated downstream signalling in S. alba against A. brassicicola is perhaps a very important step, as up‐regulation of an NDR1/HIN‐1‐ (Varet et al., 2002) like gene NHL25, and a beta 1–3 glucanase‐like PR gene was evident in S. alba on infection. Both these genes were previously found to be downstream targets of MPK6 in Arabidopsis and to be controlled by SA (Desikan et al., 1999).

Calcium‐mediated signalling

An increase in cytosolic free calcium derived from the extracellular medium or internal stores has been found to be associated with many stress responses, including the defence response. The immediate Ca2+ sensor proteins which undergo structural alteration or changes in catalytic activity upon Ca2+ binding are calmodulin, calcenurin‐B‐like (CBL) proteins (Yong et al., 2003) and Ca2+‐dependent protein kinases (CDPKs). We have identified CBL interacting protein kinases 9 and 3 by reverse Northern analysis, which were up‐regulated in S. alba compared with B. juncea upon infection. Moreover, significant up‐regulation of a vacuolar Ca2+/H+ antiporter gene (similar to Arabidopsis CAX2) was identified by both reverse Northern and real‐time PCR quantification, and up‐regulation of a plasma membrane (PM)‐type ATP‐driven Ca2+‐ATPase gene (with calmodulin binding site) was shown by reverse Northern analysis in localized S. alba leaves following A. brassicicola infection. Down‐regulation of both these genes in B. juncea indicates that sequestration of free cytosolic calcium in the intracellular organelles in addition to cytosolic pH changes may be important factors in signal perception. This observation can be correlated with the preferential up‐regulation of calcium binding C2 domain‐containing protein genes in S. alba compared with B. juncea on A. brassicicola challenge. This class of proteins operates in Ca2+‐mediated signal transduction and membrane trafficking (Kim et al., 2003) and acts as an important contributor to the plant defence response. Another important gene in this context, MLO, was found to be up‐regulated significantly in localized S. alba and B. juncea leaves on infection, both by reverse Northern analysis and by real‐time quantitative RT‐PCR. Although MLO is reported to be a calmodulin‐dependent membrane‐associated protein and in Arabidopsis is involved in resistance against the necrotrophic pathogens A. alternata and A. brassicicola (Consonni et al., 2006), interpretation of the exact role of MLO in S. alba resistance against A. brassicicola needs further investigation.

Genes involved in indole biosynthesis

An increase in the biosynthesis of indole‐containing compounds is an important step in the plant defence response as both indole‐type glucosinolates and the phytoalexin camalexin have anti‐microbial properties. Up‐regulation of indole‐3‐glycerolphosphate synthase, a very important enzyme in the indole biosynthetic pathway, was shown in localized leaves of both S. alba and B. juncea on A. brassicicola infection by reverse Northern analysis, suggesting the activated synthesis of indole derivatives. Furthermore, up‐regulation of the gene coding for the enzyme CYP79B2, involved in synthesis of indole‐3‐acetaldoxime (a common intermediate), in the localized leaves of B. juncea compared with S. alba on infection (Fig. 5), indicates the dual possibilities of enhanced biosynthesis of both indole‐type glucosinolates and phytoalexins (Glawischnig et al., 2004).

Expression pattern of Arabidopsis phytohormone‐induced gene homologues in S. alba

In Arabidopsis, Schenk et al. (2000) have shown that infection with A. brassicicola caused induction of JA‐, SA‐ and ET‐mediated activation of defence response genes, although SA and ET were not directly involved with resistance. This indicates crosstalk among the pathways in Arabidopsis. In the present study, preferential expression of already identified SA‐induced genes in S. alba compared with B. juncea on infection, as shown in Fig. 6, signifies the same possibility. It remains to be determined whether the phytohormone‐dependent/independent expression pattern of the genes in Arabidopsis follows the pattern in S. alba.

Figure 6.

Figure 6

Open in a new tab

Classification of the genes induced in S. alba on the basis of phytohormone‐dependent/independent expression in Arabidopsis. Venn diagram representing 98 phytohormone‐induced overlapping, non‐overlapping and unknowingly induced genes of S. alba.

In conclusion, the overall results indicate that the combination of cDNA‐AFLP and reverse Northern blotting, followed by real‐time PCR not only supplemented each other but also proved to be very consistent in differential expression profiling of the A. brassicicola‐induced genes. Furthermore, comparative expression profiling has shown differences in signal perception capabilities between B. juncea and S. alba on infection with A. brassicicola. The data obtained through this work are important as a subset of the genes were not up‐regulated in Arabidopsis under similar conditions (Schenk et al., 2000). Hence, we think this information will be helpful in the future development of resistant mustard plants through either genetic manipulation or plant breeding.

EXPERIMENTAL PROCEDURES

Disease progression

Seeds of Sinapis alba (collected from Bet Dagan, Israel) were obtained from Professor Zohara Yaniv (Israeli Gene Bank for Agricultural Crops). S. alba and Brassica juncea plants (8‐ to 12‐leaf stage) were grown in a controlled environment at 25 °C with a 12‐h photoperiod (100 µE/m2/s). Spores of Alternaria brassicicola strain MUCL 20297 (obtained from Professor Willem Broekaert, Katholieke Universiteit Leuven, Belgium) were grown on 2.4% potato dextrose agar (Himedia, India) medium at 25 °C in the dark for 15 days. Two to four leaves of each intact plant of S. alba (resistant) and B. juncea (susceptible) were inoculated with 5 µL of spore suspension of A. brassicicola in water at a concentration of 4 × 105 spores/mL. Control plants were not inoculated, but were otherwise treated in the same way. To identify systemic expression, upper uninoculated distal leaves of a plant were taken whose two bottom most leaves were inoculated. Plants (including the uninfected plants) were kept in a box with a Plexiglas cover at 25 °C at high humidity for monitoring disease progression at different time points. Development of disease symptoms and rate of hyphal growth were measured on the basis of lesion formation around the site of infection and by trypan blue staining, respectively, at different time points.

Isolation of RNA, c‐DNA synthesis and c‐DNA AFLP analysis

Total RNA was isolated from 2 g of control and 48‐h infected S. alba frozen leaves using a CONCERT™ plant RNA reagent kit method (Invitrogen). mRNA was isolated from about 1 mg of total RNA using an m‐RNA purification kit (Amersham Biosciences, UK). Double‐stranded cDNAs were synthesized using a SMART™ cDNA synthesis kit (BD Biosciences) according to the manufacturer's instructions with modification in the sequences of the 3′CDS primer where one EcoRI site was incorporated (5′‐AAGCAGTGGTAACAACGCAGAGAATTCT(30)N−1N‐3′, where N = A,C,G or T; N−1 = (A,G,C) and PCR Primer IIE (5′‐AAGCAGTGGTATCAACGCAGAG‐3′). Then, 250 ng of purified double‐stranded c‐DNA was digested with EcoRI and MseI and the fragments were ligated to EcoRI and MseI adopters as described in the AFLP core kit manual (Invitrogen). Pre‐amplification was carried out using 1/10 volume of the template, according to the protocol of the kit using pre‐amplification primers (Supporting Information Table S1). The EcoRI site‐specific cDNA‐AFLP primers with two selective nucleotide extensions in different combinations at the 3′ end were radiolabelled using γP32‐ATP (6000 Ci/mmol from Perkin‐Elmer) and polynucleotide kinase (Invitrogen). Selective amplifications were carried out individually with 100 different combinations (ten EcoRI and ten MseI) of labelled EcoRI and MseI primers (Supporting Information Table S2). The PCR cycles comprised 14 touchdown cycles with a 0.7 °C decrease per cycle with initial annealing temperature at 68 °C and normal 28 cycles according to the AFLP kit instructions. Amplification products were resolved in 6% polyacrylamide sequencing gels (BioRad Laboratories) according to standard protocols (Bachem et al., 1996; Vos et al., 1995). The cDNA‐AFLP pattern was detected after exposing the dry gel to X‐ray film (Kodak bio max, India) at –70 °C overnight for autoradiography.

Isolation and reamplification of cDNA‐AFLP fragments

The bands of cDNA‐AFLP which were up‐regulated more in the infected compared with the non‐infected S. alba were cut from the gel and eluted according to Michael and Guggenheim (1999). The 4 µL of eluted product was then reamplified in 100 µL volume using the same primer combination and PCR conditions as for selective amplification without touchdown cycles. Then each reamplification product was purified using a QIAquick PCR product purification kit (Quiagen Inc.). All the PCR reactions were performed in a PTC‐200 programmable thermal cycler (MJ Research).

Reverse Northern analysis

Purified PCR‐reamplified product (10 µL) was mixed with water (40 µL) and samples were heat denatured at 95 °C for 5 min and quickly chilled on ice. One volume of 10× SSC was added and the samples were spotted on a Hybond‐N+ membrane using a 96‐well vacuum manifold. The membranes were denatured and neutralized by soaking in denaturing solution and neutralizing solution (Dong‐Chul et al., 1998). Membranes were air dried and cross linked using a UVC 500 UV cross linker (Amersham Biosciences, UK). Radiolabelled first‐strand cDNA probes were synthesized from 1 µg of polyA RNA using α‐P32‐labelled dCTP (10 µCi/µL) and purified using spun columns packed with Sephadex G‐50 according to the protocol of Sambrook et al. (1989). Specific activity of the probes was measured using a scintillation counter (Beckman). Membranes were hybridized with an equivalent amount of α‐32P‐labelled single‐stranded cDNA (specific activity, 1.3 × 109 cpm/µg) probe at 65 °C in the presence of rapid hyb buffer solution (Amersham Biosciences, UK), washed at successive stringency of 2×, 1× and 0.5× SSC with 0.1% SDS at 65 °C and exposed to X‐ray film followed by a phosphor imaging screen overnight. The experiments were repeated three times with three different biological replicates each containing leaves of 30 individual plants. The intensity of the spots was calculated (after background subtraction) in OD/mm2 using GS‐525 phosphor imaging software (BioRad Laboratories). The RT‐PCR‐mediated amplified cDNA of the S. alba housekeeping gene GADPH, blotted in equal amounts on each membrane, was used as the internal control to normalize the hybridization. The mean spot intensities from three individual experiments were calculated. Fold induction or repressions of each gene were calculated by dividing the average hybridization intensity values of the infected plant cDNA by that of the control plant cDNA. Genes that showed an induction ratio of at least two‐fold and a P value of at least 0.05 (calculated using GraphPad Prism version 2.01 by one‐way anova using the Newman–Keuls multiple comparison test) were considered for the present study.

Cloning of the differentially expressed cDNA‐AFLP fragments

Cloning of all the cDNA fragments was done in a batch process to make it economical. In this strategy, each batch consisting of a maximum of six PCR‐amplified bands from two different primer combinations, each having three different sizes of fragments, were mixed together for each ligation with pGEM‐T Easy vector (Promega Corp.). The ligation mix was then transformed into DH5α and the white colonies were then checked by colony PCR‐derived band size using different cDNA AFLP primer combinations and also by restriction analysis. Sequencing of the positive clones was done in an Automated DNA sequencer 3130XL Genetic analyser (Applied Biosystem) using M13 forward primer. The sequences of cDNA‐AFLP‐derived fragments were analysed using the BLASTN and BLASTX software of the NCBI database (Altschul et al., 1990) and TAIR (The Arabidopsis Information Resources).

Real‐time quantitative RT‐PCR analysis of the transcripts

One microgram of purified polyA mRNA was isolated from each of the samples and cDNA synthesis was carried out using powerscript™ (BD Biosciences) according to the protocol of the kit. RT‐PCR was done using different cDNA concentrations and gene‐specific primers designed from the coding region of each gene using the Primer 3 software (v 0.4.0) (Supporting Information Table S4) and Taq DNA polymerase (Promega Corp.). PCR cycling conditions comprised an initial denaturation step at 94 °C for 2 min, followed by 35 cycles at 94 °C for 35 s, 53 °C for 45 s and 72 °C for 1 min. Amplification of the products was monitored by running in 1.2% agarose gel containing ethidium bromide to check the efficiency of each set of primers for individual genes and also to optimize the cDNA concentration in the exponential phase of amplification over 35 cycles.

Quantitative real‐time PCR was carried out using the 7500 Fast real‐time PCR sequence detector and SYBR Green Master mix (Applied Biosystems) using primers at a final concentration of 0.28 µm each and 3 µL of diluted cDNA template (optimized by RT‐PCR) in 20 µL total volume. PCR cycling conditions comprised an initial polymerase activation step at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 59 °C for 1 min, and a final stage of 15 s at 95 °C, 15 s at 60 °C and 15 s at 95 °C to determine dissociation curves of the amplified products. Real‐time cDNA amplification was monitored and analysed using the Sequence Detection system software (version 1.4, Applied Biosystems). Variations in cDNAs of the samples were normalized using GADPH as an internal standard. Fold induction was calculated for 48‐ and 64‐h localized infected leaves of S. alba, 48‐h localized infected leaves of B. juncea and 48‐, 72‐ and 96‐h systemic leaves of S. alba. Fold changes in gene expression between inoculated and mock‐inoculated S. alba and B. juncea leaves were based on ΔCt calculation (2−ΔΔCT method). ΔCt corresponded to Ct of one selected gene subtracted from Ct of GADPH, and fold‐change expression was based on calculation of the ΔΔCt (Livak and Schmittgen, 2001) that corresponded to ΔCt in inoculated leaves subtracted from the ΔCt in mock‐inoculated tissues. Quantitative RT PCR experiments of all the 12 genes were performed in triplicate. The average fold induction values were calculated after considering the standard error, where n = 3 (where n represents the number of biological replicates and leaves of 30 individual plants were pooled together for each biological replicate).

Supporting information

Table S1 Primers used for preamplification reaction. Sequences of the EcoR1 and MseI adopter‐specific primers used for preamplification.

Table S2 Primers used for selective amplification reaction. Sequences of the ten EcoR1 and ten MseI primers used for selective amplification. The two selective nucleotides at the 3′ end of each primer are indicated by bold letters.

Table S3 Homology‐based classification of S. alba genes induced upon infection and their differential expression pattern in susceptible and resistant genetic backgrounds. The tables represent BLAST X results of the cloned S. alba genes induced by A. brassicicola after sequence analysis using TAIR (The Arabidopsis Information Resources). Additionally, DEC represents the degree of expression change calculated after phosphor imaging analysis. Spots represented as (+) are up‐regulated in expression whereas (−) are down‐regulated in expression of genes with respect to control: (+) two‐fold; (++) > two‐fold to < five‐fold; (+++) > five‐fold to < ten‐fold; (++++) > ten‐fold up‐regulation in expression; (=) genes equally expressed in control and infected population. Genes which showed probability values P < 0.05 were included in this table.

Table S4 Primers used for real‐time quantitative RT‐PCR. Sequences of 12 gene‐specific primers designed from the coding region of S. alba using Primer3 software (v 0.4.0).

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (13.5KB, xls)

Supporting info item

Click here for additional data file. (15KB, xls)

Supporting info item

Click here for additional data file. (67KB, xls)

Supporting info item

Click here for additional data file. (15.5KB, xls)

ACKNOWLEDGEMENTS

We are grateful to the Director of the Bose Institute for encouragement and support. We thank the Department of Biotechnology, Government of India, project no. BT/PR2593/BRB/15/242/2001 and the Council of Scientific and Industrial Research for providing financial support. We are also grateful to Professor Willem Broekaert for providing A. brassicicola strain MUCL 20297 and Professor Zohara Yaniv for providing S. alba seeds. We are indebted to Professor K. K. Mukherjee and Professor S. Das for their constant encouragement and support. We also thank to Dr Gaurab Gangopadhyay, Dr Subhash Kanti Roy, Mr Jadab Kumar Ghosh and Mr Arup Sen for their support in preparation of the manuscript.

REFERENCES

  1. Altschul, S.F. , Gish, W. , Miller, W. , Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403–410. [DOI] [PubMed] [Google Scholar]
  2. Asai, T. , Tena, G. , Plotnikova, J. , Willmann, M.R. , Chiu, W.L. , Gomez‐Gomez, L. , Boller, T. , Ausubel, F.M. and Sheen, J. (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature, 415, 977–983. [DOI] [PubMed] [Google Scholar]
  3. Bachem, C.W.B. , Van Der Hoeven, R.S. , De Bruijn, S.M. , Vreugdenhil, D. , Zabeau, M. and Kisser, R.G.F. (1996) Visualization of differential gene expression using a novel method for RNA fingerprinting based on AFLP analysis of gene expression in potato tuber development. Plant J. 9, 745–753. [DOI] [PubMed] [Google Scholar]
  4. Caldo, R.A. , Nettleton, D. and Wise, R.P. (2004) Interaction dependant gene expression in Mla specified response to barley powdery mildew. Plant Cell, 16, 2514–2528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Consonni, C. , Humphry, M.E. , Hartmann, H.A. , Livaja, M. , Durner, J. , Estphal, L. , Vogel, J. , Lipka, V. , Kemmerling, B. , Schulze‐Lefert, P. , Somerville, S.C. and Panstruga, R. (2006) Conserved requirement for a plant host cell protein in powdery mildew pathogenesis. Nat. Genet. 38, 716–720. [DOI] [PubMed] [Google Scholar]
  6. Czernic, P. , Visser, B. , Sun, W. , Savoure, A. , Deslandes, L. , Marco, Y. , Montagu, M.V. and Verbruggen, N. (1999) Characterization of an Arabidopsis thaliana receptor‐like kinase gene activated by oxidative stress and pathogen attack. Plant J. 18, 321–327. [DOI] [PubMed] [Google Scholar]
  7. Desikan, R. , Clarke, A. , Atherfold, P. , Hancock, J.T. and Neill, S.J. (1999) Harpin induces mitogen‐activated protein kinase activity during defence responses in Arabidopsis thaliana suspension cultures. Planta, 210, 97–103. [DOI] [PubMed] [Google Scholar]
  8. Dong‐Chul, K. , Raphael, L. , Zao‐Zhong, S. and Paul, B.F. (1998) Reciprocal subtraction differential RNA display: an efficient and rapid procedure for isolating differentially expressed gene sequences. Proc. Natl Acad. Sci. USA, 95, 13788–13793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Durrant, W.E. , Rowland, O. , Piedras, P. , Kim, E. , Kosack, H. and Jones, J.D.G. (2000) cDNA‐AFLP reveals a striking overlap in race‐specific resistance and wound response gene expression profiles. Plant Cell, 12, 963–977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Eulgem, T. , Wiegman, V.J. , Chang, H. , McDowell, J.M. , Holub, E.B. , Glazebrook, J. , Zhu, T. and Dangl, J.L. (2004) Gene expression signatures from thee genetically separable resistance gene signalling pathways for downy mildew resistance. Plant Physiol. 135, 1129–1144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Feechan, A. , Yun, B.‐W. , Wang, Y. , Kwon, E.‐J. , Pallas, J. and Loake, G.J. (2005) A central role for S‐nitrosothiols in plant disease resistance. Proc. Natl Acad. Sci. USA, 102, 8054–8059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Frank, L.H.M. , Johan, A.P. , Corne, M.J.P. and Daniel, F.K. (2004) Silencing of the mitogen‐activated protein kinase MPK6 compromises disease resistance in arabidopsis. Plant Cell, 16, 897–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Glawischnig, E. , Hansen, B.G. , Olsen, C.E. and Halkier, B.A. (2004) Camalexin is synthesized from indole‐3‐acetaldoxime, a key branching point between primary and secondary metabolism in Arabidopsis. Proc. Natl Acad. Sci. USA, 101, 8245–8250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Glazebrook, J. (1999) Genes controlling expression of defense responses in Arabidopsis . Curr. Opin. Plant Biol. 2, 280–286. [DOI] [PubMed] [Google Scholar]
  15. Glazebrook, J. (2001) Genes controlling expression of defense responses in Arabidopsis. Curr. Opin. Plant. Biol. 4, 301–308. [DOI] [PubMed] [Google Scholar]
  16. Glazebrook, J. (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Ann. Rev. Phytopathol. 43, 205–227. [DOI] [PubMed] [Google Scholar]
  17. Grant, J.J. and Loake, G.J. (2000) Role of reactive oxygen intermediates and cognate redox signaling in disease resistance. Plant Physiol. 124, 21–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Grant, J.J. , Chini, A. , Basu, D. and Loake, G.J. (2003) Targeted activation tagging of the Arabidopsis NBS‐LRR gene, ADR1, conveys resistance to virulent pathogens. Mol. Plant–Microbe. Interact. 16, 669–680. [DOI] [PubMed] [Google Scholar]
  19. Grant, M. and Loake, G.J. (2007). Recent advances in salicylic acid signaling. Curr. Opin. Plant Biol. 10, 466–472. [DOI] [PubMed] [Google Scholar]
  20. Herve, C. , Dabos, P. , Galaud, J.P. , Rouge, P. and Lescure, B. (1996) Characterization of an Arabidopsis thaliana gene that defines a new class of putative plant receptor kinases with an extracellular lectin‐like domain. J. Mol. Biol. 258, 778–788. [DOI] [PubMed] [Google Scholar]
  21. Hong, J.K. , Yun, B. , Kang, J. , Raja, M.U. , Kwon, E. , Sorhagen, K. , Chu, C. , Wang, Y. and Loake, G.J. (2008) Nitric oxide function and signalling in plant disease resistance. J. Exp. Bot. 59: 147–154. [DOI] [PubMed] [Google Scholar]
  22. Kim, C.Y. , Koo, Y.D. , Jin, J.B. , Moon, B.C. , Kang, C.H. , Kim, S.T. , Park, B.O. , Lee, S.Y. , Kim, M.L. , Hwang, I. , Kang, K.Y. , Bahk, J.D. , Lee, S.Y. and Cho, M.J. (2003) Rice C2‐domain proteins are induced and translocated to the plasma membrane in response to a fungal elicitor. Biochem. 14, 11625–11633. [DOI] [PubMed] [Google Scholar]
  23. Liqun, D. and Zhixiang, C. (2000) Identification of genes encoding receptor‐like protein kinases as possible targets of pathogen‐ and salicylic acid induced WRKY DNA‐binding proteins in Arabidopsis. Plant J. 24, 837–847. [DOI] [PubMed] [Google Scholar]
  24. Livak, L. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real‐time quantitative PCR and the 2−ΔΔCT method. Methods, 25, 402–408. [DOI] [PubMed] [Google Scholar]
  25. Maleck, K. , Levine, A. , Eulgem, T. , Morgan, A. , Schmid, J. , Lawton, K.A. , Dangl, J.L. and Dietrich, R.A. (2000) The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nat. Genet. 26, 403–410. [DOI] [PubMed] [Google Scholar]
  26. Michael, R.F. and Guggenheim, J.A. (1999) Prevention of depurination during elution facilitates the reamplification of DNA from differential display gels. Nucleic Acids. Res. 27, 15 e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Navarno, L. , Zipfel, C. , Rowland, O. , Keller, L. , Robertzek, S. , Boller, T. and Jones, J.D. (2004) The transcriptional innate immune response to flg22, Interplay and overlap with Avr gene dependant defense responses and bacterial pathogenesis. Plant Physiol. 135, 1113–1128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nurmberg, P.L. , Knox A.K., Yun, B. , Morris, C.P. , Shafiei, R. , Hudson, A. and Loake, G.J. (2007) The developmental selector AS1 is an evolutionarily conserved regulator of the plant immune response. Proc. Natl Acad. Sci. USA, 104, 18795–18800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Pedras, M.S.C. , Zaharia, I.L. , Gai, Y. , Zhou. Y. and Ward, D.E. (2001) In planta sequential hydroxylation and glycosylation of a fungal phytotoxin: avoiding cell death and overcoming the fungal invader. Proc. Natl Acad. Sci. USA, 98, 747–752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pedras, M.S.C. , Montaut, S. , Zaharia, I.L. , Gai, Y. and Ward, D.E. (2003) Transformation of the host selective toxin destruxin B by wild crucifers: probing a detoxification pathway. Phytochemistry, 64, 957–964. [DOI] [PubMed] [Google Scholar]
  31. Polesani, M. , Desario, F. , Ferrarini, A. , Zamboni, A. , Pezzotti, M. , Kortekamp, A. and Polverari, A. (2008) cDNA‐AFLP analysis of plant and pathogen genes expressed in grapevine infected with Plasmopara viticola . BMC Genomics, 9, 142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rédei, G.P. and Hirono, Y. (1964) Linkage studies. Arabid. Inf. Serv. 1, 9–10. [Google Scholar]
  33. Reijans, M. , Lascaris, R. , Groeneger, A.O. , Wittenberg, A. , Wesselink, E. , Oeveren, J.V. , Boorsma, E.W.A. , Voetdijk, B. , Spek, H.V.D. , Grivell, L.A. and Simonsa, G. (2003) Quantitative comparison of cDNA‐AFLP, microarrays, and GeneChip expression data in Saccharomyces cerevisiae. Genomics, 82, 606–618. [DOI] [PubMed] [Google Scholar]
  34. Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. [Google Scholar]
  35. Saskia, C.M. , Van, W. , Hur‐Song, C. , Tong, Z. and Glazebrook, J. (2003) Characterization of the early response of Arabidopsis to Alternaria brassicicola infection using expression profiling. Plant Physiol. 132, 606–617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Schenk, P.M. , Kazan, K. , Wilson, I.W. , Anderson, J.P. , Richmond, T. , Somerville, S.C. and Manners, J.M. (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc. Natl Acad. Sci. USA, 97, 11655–11660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Schenk, P.M. , Kazan, K. , Manners, J.M. , Anderson, J.P. , Simpson. R.S , Wilson, I.W , Somerville, S.C. and Maclean, D.J. (2003) Systemic gene expression in Arabidopsis during an incompatible interaction with Alternaria brassicicola . Plant Physiol. 132, 999–1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Seok, Oh. , Ae Ran, P. , Min Seok, B. , Sun Jae, K. , Young Soon, K. , Ji Eun, L. , Na Young, K. , Sumin, L. , Hyeonsook, C. and Ohkmae, K.P. (2005) Secretome analysis reveals an Arabidopsis lipase involved in defense against Alternaria brassicicola . Plant Cell, 17, 2832–2847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sharma, N. , Rahman, M.H. , Strelkov, S. , Thiagarajah, M. , Bansal, V.K. and Kav, N.N.V. (2007) Proteome‐level changes in two Brassica napus lines exhibiting differential responses to the fungal pathogen Alternaria brassicae . Plant Sci. 172, 95–110. [Google Scholar]
  40. Tao, Y. , Xie, Z. , Chen, W. , Glazebrook, J. , Chang, H. , Han, B. , Zhu, T. , Zou, G. and Katagiri, F. (2003) Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae . Plant Cell, 15, 317–330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Thilmony, R. , Underwood, W. and He, S.Y. (2006) Genome wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. Plant J. 46, 34–53. [DOI] [PubMed] [Google Scholar]
  42. Thomma, B.P. , Eggermont, K. , Penninckx, I.A. , Mauch‐Mani, B. , Vogelsang, R. , Cammue, B.P. and Broekaert, W.F. (1998) Separate jasmonate‐dependent and salicylate‐dependent defense‐response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl Acad. Sci. USA, 95, 15107–15111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Thomma, B.P. , Eggermont, K. , Tierens, K.F. and Broekaert, W.F. (1999) Requirement of Functional Ethylene‐Insensitive 2 gene for efficient resistance of Arabidopsis to infection by Botrytis cinerea 1. Plant Physiol. 121, 1093–1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Torres, M. , Sanchez, P. , Delmond, I.F. and Grant, M. (2003) Expression profiling of the host response to bacterial infection: the transition from basal to induced defence responses in RPM1‐mediated resistance. Plant J. 33, 665–676. [DOI] [PubMed] [Google Scholar]
  45. Varet, A. , Parker, J. , Tornero, P. , Nass, N. , Nurnberger, T. , Dangl, J.L. , Schee, D. and Lee, J. (2002) NHL25 and NHL3, two NDR1/HIN1‐Like genes in Arabidopsis thaliana with potential role(s) in plant defense. Mol. Plant–Microbe Interact. 15, 608–616. [DOI] [PubMed] [Google Scholar]
  46. Vos, P. , Hogers, R. , Blecker, M. , Reijans, M. , Van Lee, T. , Hornes, M. , Frijters, A. , Pot, J. , Peleman, J. , Kuiper, M. and Zabeau, M. (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Waites, R. , Selvadurai, H.R. , Oliver, I.R. and Hudson, A. (1998) The PHANTASTICA gene encodes a MYB transcription factor involved in growth and dorsoventrality of lateral organs in Antirrhinum . Cell, 93, 779–789. [DOI] [PubMed] [Google Scholar]
  48. Xuewei, C. , Shang, J. , Chen, D. , Lei, C. , Zou, Y. , Zhai, W. , Liu, G. , Xu, J. , Ling, Z. , Cao, G. , Ma, B. , Wang, Y. , Zhao, X. , Li, S. and Zhu, L. (2006) A B‐lectin receptor kinase gene conferring rice blast resistance. Plant J. 46, 794–804. [DOI] [PubMed] [Google Scholar]
  49. Yong, H.C. , Kyung‐Nam, K. , Girdhar, K.P. , Rajeev, G. , John, J.G. and Sheng, L. (2003) CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis. Plant Cell, 15, 1833–1845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang, S. and Klessig, D.F. (2001) MAPK cascades in plant defense signalling. Trends Plant Sci. 6, 11. [DOI] [PubMed] [Google Scholar]
  51. Zhao, J. , Wang, J. , An, L. , Doerge, R.W.Z. , Chen, J. , Grau, C.R. , Meng, J. and Osborn, T.C. (2007) Analysis of gene expression profiles in response to Sclerotinia sclerotiorum in Brassica napus . Planta, 227, 13–24. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1 Primers used for preamplification reaction. Sequences of the EcoR1 and MseI adopter‐specific primers used for preamplification.

Table S2 Primers used for selective amplification reaction. Sequences of the ten EcoR1 and ten MseI primers used for selective amplification. The two selective nucleotides at the 3′ end of each primer are indicated by bold letters.

Table S3 Homology‐based classification of S. alba genes induced upon infection and their differential expression pattern in susceptible and resistant genetic backgrounds. The tables represent BLAST X results of the cloned S. alba genes induced by A. brassicicola after sequence analysis using TAIR (The Arabidopsis Information Resources). Additionally, DEC represents the degree of expression change calculated after phosphor imaging analysis. Spots represented as (+) are up‐regulated in expression whereas (−) are down‐regulated in expression of genes with respect to control: (+) two‐fold; (++) > two‐fold to < five‐fold; (+++) > five‐fold to < ten‐fold; (++++) > ten‐fold up‐regulation in expression; (=) genes equally expressed in control and infected population. Genes which showed probability values P < 0.05 were included in this table.

Table S4 Primers used for real‐time quantitative RT‐PCR. Sequences of 12 gene‐specific primers designed from the coding region of S. alba using Primer3 software (v 0.4.0).

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Click here for additional data file. (13.5KB, xls)

Supporting info item

Click here for additional data file. (15KB, xls)

Supporting info item

Click here for additional data file. (67KB, xls)

Supporting info item

Click here for additional data file. (15.5KB, xls)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES