Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2011 Jan 5;12(5):437–447. doi: 10.1111/j.1364-3703.2010.00685.x

Long‐term protection against tobacco mosaic virus induced by the marine alga oligo‐sulphated‐galactan Poly‐Ga in tobacco plants

JEANNETTE VERA 1, JORGE CASTRO 1, ALBERTO GONZÁLEZ 1, HERNA BARRIENTOS 1, BETTY MATSUHIRO 1, PATRICIO ARCE 2, GUSTAVO ZUÑIGA 1, ALEJANDRA MOENNE 1,✉
PMCID: PMC6640457  PMID: 21535350

SUMMARY

In order to study the antiviral effect of the oligo‐sulphated galactan Poly‐Ga, the leaves of tobacco plants XhantiNN were sprayed with water (control), with increasing concentrations of Poly‐Ga, for increasing numbers of treatments or cultivated for increasing times after treatment. Control and treated plants were infected with tobacco mosaic virus (TMV) and the numbers of necrotic lesions were measured in infected leaves. The number of necrotic lesions decreased with increasing concentrations of Poly‐Ga, with increasing numbers of treatments and with increasing time after treatment, indicating a long‐term protection against TMV that mimicks vaccination. In addition, control Xhantinn plants and plants treated with Poly‐Ga and cultivated for increasing times after treatment were infected with TMV in the middle part of the plant, and the levels of TMV‐capsid protein (CP) transcripts were measured in apical leaves. TMV‐CP transcripts decreased in distant leaves, indicating that Poly‐Ga induces systemic protection against TMV. The activities of the defence enzymes phenylalanine ammonia lyase (PAL) and lipoxygenase (LOX) and the amounts of several phenylpropanoid compounds (PPCs) were measured in control and treated plants without infection. A progressive increase in PAL activity was observed with increasing time after treatment, together with the accumulation of free and conjugated PPCs. In contrast, LOX activity remained unchanged. Interestingly, the increase in PAL activity showed a linear correlation with the decrease in necrotic lesions and the decrease in TMV‐CP transcript level. Thus, Poly‐Ga induced systemic and long‐term protection against TMV in tobacco plants that is determined, at least in part, by a sustained activation of PAL and the accumulation of PPCs with potential antiviral activity.

INTRODUCTION

Plant–pathogen interaction induces the release of oligosaccharides derived from plant and/or pathogen cell walls which can act as elicitors of plant defence responses (Darvill et al., 1994; Silipo et al., 2010). The best characterized oligosaccharide elicitors are oligogalacturonides (OGs) produced from pectin, chitooligosaccharides (COSs) derived from fungal cell walls, hepta‐β‐glucosides (HGs) obtained from the cell walls of Phytophtora sojae, lipochitooligosaccharides (LCOs) derived from the cell walls of Gram‐negative bacteria (rhizobia) and rhamnolipids obtained from the cell walls of Pseudomonas aeruginosa (Aziz et al., 2004; Bishop et al., 1981; Denoux et al., 2008; Norman et al., 1999; Sharp et al., 1984; Varnier et al., 2009). These oligosaccharides activate defence mechanisms which protect plants against pathogens, such as bacteria, fungi and viruses (Aziz et al., 2007; Denoux et al., 2008; Varnier et al., 2009; Wang F. et al., 2009). In addition, marine algae sulphated oligosaccharides also stimulate plant defence responses and induce protection against bacteria, fungi and viruses (Aziz et al., 2003; 2000, 2003; Laporte et al., 2007; Ménard et al., 2004).

With regard to the perception of plant/pathogen oligosaccharides in plants, it has been shown that these elicitors bind to specific receptors located in the plasma membrane (Itoh et al., 1997). Indeed, receptors for LCOs, HGs and COSs have been cloned and characterized recently (Fliegmann et al., 2004; Kaku et al., 2006; Madsen et al., 2003; Petutschnig et al., 2010). These receptors share a common LysM domain resembling the peptidoglycan‐binding domain present in Toll‐like receptors (TLRs) of mammalian cells, which is coupled to a kinase domain involved in signal transduction. The interaction of an elicitor with its receptor triggers a transient oxidative burst produced by a reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase located in the plasma membrane, which requires Ca2+ and phosphorylation for its activation (Ogasawara et al., 2008). NADPH oxidase produces superoxide anions in the apoplast which are dismutated to hydrogen peroxide (Hammond‐Kosack and Jones, 1996; Van Breusegem et al., 2008). In addition, the interaction of an elicitor with its receptor can activate calcium channels located in the plasma membrane (Hammond‐Kosack and Jones, 1996; Jeworutzki et al., 2010), inducing a transient increase in intracellular calcium that leads to the activation of calcium‐dependent protein kinases (CDPKs) and mitogen‐activated protein kinases (MAPKs) that trigger defence gene expression (Boudsocq et al., 2010; Daxberger et al., 2007; Miya et al., 2007). The increase in intracellular calcium and reactive oxygen species (ROS) leads to the activation of defence enzymes and pathways and to the accumulation of compounds with antimicrobial activities (Hammond‐Kosack and Jones, 1996; Jabs et al., 1997; Sels et al., 2008).

The expression of most defence genes is not constitutive, but is triggered during compatible or incompatible plant–pathogen interactions. One of the induced defence responses is the expression of pathogenesis‐related (PR) protein families with antifungal and antibacterial properties (Sels et al., 2008). Plant–pathogen interaction also activates the defence phenylpropanoid and octadecanoid pathways leading to the synthesis of phenylpropanoid compounds (PPCs) and oxylipins with antimicrobial activities (Blée, 2004; Dixon, 2001). It is important to mention that the phenylpropanoid pathway is mainly regulated by the activity of phenylalanine ammonia lyase (PAL) and the octadecanoid pathway is regulated by lipoxygenase (LOX) (Howles et al., 1996; La Caméra et al., 2004). Interestingly, it has been shown that many PPCs have antiviral activities, such as benzoic acid, dihydroxybenzoic acid (DHBA), gallic acid (GA), caffeic acid (CA), chlorogenic acid (CHL), ferulic acid, scopoletin (SCO), esculetin (ESC), quercetin (QUE), kaempferol and rutin (RUT), among others (Schneider et al., 2010; Tian et al., 2009; Wang G. F. et al., 2009). These PPCs have antiviral activity mainly against animal viruses, and only SCO has been shown to inhibit plant virus replication (Chong et al., 2002). In addition, plants synthesize other compounds, such as terpenes, terpenoids and alkaloids, which have antiviral activities against animal and plant viruses (Wu et al., 2007; Yan et al., 2010; Zhang et al., 2007)

In a previous study, we prepared the oligo‐sulphated galactan Poly‐Ga with a molecular weight of around 8.5 kDa, which corresponds to 20 units of sulphated galactose (Laporte et al., 2007). In addition, we prepared a depolymerized fraction of mannuronic acid (Poly‐Ma) obtained by acid hydrolysis of alginates extracted from a marine brown alga (Laporte et al., 2007). Poly‐Ga and Poly‐Ma sprayed on tobacco leaves at a concentration of 0.5 mg/mL once a week for 2 weeks, and cultivated for 15 additional days after treatment, induced protection against tobacco mosaic virus (TMV) of 74% and 22%, respectively (Laporte et al., 2007). Interestingly, Poly‐Ga and Poly‐Ma also induced an increase in growth and leaf biomass of 23% and 49%, respectively, after 7 days of treatment.

In this work, we analysed the antiviral effect of Poly‐Ga against TMV in tobacco plants using increasing concentrations of Poly‐Ga, increasing numbers of treatments and cultivating the treated plants for increasing times after treatment. In order to analyse the mechanisms involved in the antiviral effect, we determined the activities of PAL and LOX defence enzymes and the potential correlation between PAL and/or LOX activities and protection against TMV infection. In addition, we analysed the level of several PPCs with potential antiviral activity.

RESULTS

Poly‐Ga induced a dose‐dependent, treatment number‐dependent and long‐term protection against TMV

In order to study the antiviral properties of Poly‐Ga, XhantiNN tobacco plants were treated with water (control), with increasing concentrations of Poly‐Ga, with increasing numbers of treatments or cultivated for increasing time after treatment. Control and treated plants were infected with TMV and the number of necrotic lesions was determined in the infected leaves. Plants treated with 0.1, 0.3, 0.5 and 0.7 mg/mL of Poly‐Ga showed decreases in the number of necrotic lesions of 47%, 53%, 59% and 73%, respectively, compared with control plants (Fig. 1A). In addition, plants treated with Poly‐Ga for one, two, three and four times showed decreases in the number of necrotic lesions of 38%, 51%, 66% and 73%, respectively, compared with control plants (Fig. 1B). Furthermore, plants treated with Poly‐Ga and cultivated for 15, 30, 45 and 60 days after treatment showed decreases in the number of necrotic lesions of 57%, 84%, 94% and 98%, respectively, compared with control plants (Fig. 1C,D). Thus, Poly‐Ga induced a dose‐dependent, treatment number‐dependent and long‐term protection against TMV infection, mimicking a vaccination effect.

Figure 1.

Figure 1

Open in a new tab

Number of necrotic lesions in the infected leaves of control XhantiNN tobacco plants and in plants treated with increasing concentrations of Poly‐Ga (A), with an increasing number of treatments (B) and cultivated for increasing times after treatment (C). Bars correspond to the mean values obtained from seven plants ± SD. Different letters indicate significant differences (P < 0.05). Leaf of a control XhantiNN tobacco plant not infected with tobacco mosaic virus (TMV) (C‐NI); leaf of a plant treated with Poly‐Ga and cultivated for 0, 30, 45 and 60 additional days after treatment and infected with TMV (D).

Poly‐Ga induced a systemic protection against TMV

In order to detect whether Poly‐Ga induced systemic protection against TMV, Xhantinn tobacco plants were treated with water (control) or with Poly‐Ga and cultivated for increasing times after treatment. Control and treated plants were infected with TMV in the middle part of the plant and the relative level of TMV‐capsid protein (CP) transcript was quantified in apical leaves using real‐time reverse transcription‐polymerase chain reaction (RT‐PCR). Plants treated with Poly‐Ga and cultivated for 15, 30, 45 or 60 days after treatment showed decreases in TMV‐CP transcript level of 48%, 83%, 96% and 97%, respectively (Fig. 2A). This was consistent with the decrease in mosaic symptoms in the apical leaves of treated plants (Fig. 2B). Thus, Poly‐Ga induced a systemic protection against TMV in tobacco plants.

Figure 2.

Figure 2

Open in a new tab

Relative level of tobacco mosaic virus (TMV) transcripts in the apical leaves of control Xhantinn tobacco plants and plants treated with Poly‐Ga and cultivated for increasing times after treatment and infected with TMV in the middle part of the plant (A). Bars correspond to the mean values of three independent experiments ± SD. Different letters indicate significant differences (P < 0.05). Leaf of a control Xhantinn tobacco plant not infected with TMV (C‐NI); leaves of plants treated with Poly‐Ga and cultivated for 0, 30, 45 and 60 additional days after treatment and infected with TMV (B). The relative level of TMV‐capsid protein (CP) transcripts is expressed as 2−ΔΔCT, which includes the mean value of the TMV‐CP level in the control plant subtracted from the mean value detected in treated plants.

Poly‐Ga induced a progressive and sustained activation of PAL defence enzyme

In order to analyse the mechanisms involved in the antiviral effect of Poly‐Ga, the activities of PAL and LOX defence enzymes were determined in XhantiNN tobacco plants treated with increasing concentrations of Poly‐Ga, for increasing numbers of treatment and cultivated for increasing times after treatment (and not infected with TMV). Plants treated with 0.1, 0.3, 0.5 and 0.7 mg/mL of Poly‐Ga showed increases in PAL activity of 1.8, 2, 2.8 and 3.4 times, respectively, compared with the control (Fig. 3A), whereas LOX activity remained unchanged (data not shown). In addition, plants treated for 1, 2, 3 and 4 weeks with Poly‐Ga showed increases in PAL activity of 1.5, 2, 2.6 and 3.3 times, respectively, compared with the control (Fig. 3B), whereas LOX enzyme activity remained unchanged (data not shown). Furthermore, plants treated with Poly‐Ga and cultivated for 15, 30, 45 and 60 days after treatment showed increases in PAL activity of 2.6, 4.3, 5 and 5.5 times, respectively, compared with the control (Fig. 3C), whereas LOX activity remained unchanged (Fig. 3D). It is interesting to note that PAL activity did not change in control plants cultivated for 15, 30, 45 and 60 days after treatment (Fig. 3C). Thus, Poly‐Ga induced a dose‐dependent, treatment number‐dependent and long‐term activation of PAL enzyme. Interestingly, the increase in PAL activity correlated linearly with the decrease in necrotic lesions, with increasing concentrations of Poly‐Ga (Fig. 4A), increasing numbers of treatment (Fig. 4B) and increasing times after treatment (Fig. 4C), as well as with the decrease in the TMV‐CP transcript level in apical leaves (Fig. 4D). Thus, PAL activation may determine, at least in part, the antiviral effect induced by Poly‐Ga.

Figure 3.

Figure 3

Open in a new tab

Phenylalanine ammonia lyase (PAL) activity in leaves of XhantiNN tobacco plants treated with increasing concentrations of Poly‐Ga (A), with increasing numbers of treatments (B) and cultivated for increasing times after treatment (C). Lipoxygenase (LOX) activity in plants treated with Poly‐Ga and cultivated for increasing times after treatment (D). Bars correspond to the mean values obtained from seven plants ± SD and the right‐hand bars correspond to control plants. PAL activity is expressed as nanomoles per minute per milligram of protein and LOX activity is expressed in micromoles per minute per milligram of protein. Different letters indicate significant differences (P < 0.05).

Figure 4.

Figure 4

Open in a new tab

Correlation between protection against tobacco mosaic virus (TMV) infection and phenylalanine ammonia lyase (PAL) activity in plants treated with increasing concentrations of Poly‐Ga (A), with increasing numbers of treatments (B) and cultivated for increasing times after treatment (C). Correlation between the decrease in the relative levels of TMV‐capsid protein (CP) transcript and the increase in PAL activity in plants treated with Poly‐Ga and cultivated for increasing times after treatment (D). Protection corresponds to the percentage decrease in the number of necrotic lesions, and PAL activity is expressed in nanomoles per minute per milligram of protein.

Poly‐Ga induced the accumulation of PPCs

In order to determine whether PAL activation induced the accumulation of PPCs with potential antiviral activities, free and conjugated PPCs, such as salicylic acid (SA), DHBA, GA, vanillic acid (VA), CA, CHL, SCO, ESC, QUE and RUT, were detected and quantified by high‐performance liquid chromatography (HPLC) in control plants and in plants treated with Poly‐Ga and cultivated for 0, 15, 30, 45 and 60 days after treatment. The levels of total SA, GA, CA, SCO and ESC progressively increased in plants treated with Poly‐Ga and cultivated for 15, 30, 45 and 60 days after treatment (Fig. 5), whereas the level of PPCs in control plants did not change (data not shown). The level of total VA initially increased and then remained stable, and the levels of total DHBA and RUT increased only at the end of the experiment time. The level of total QUE increased and then decreased during the experimental procedure (Fig. 5). In addition, the levels of free GA and CHL were higher than their conjugated forms, the levels of conjugated SA, DHBA, CA, SCO, ESC and RUT were higher than their free forms and the level of free VA was similar to the level of its conjugated form (Fig. 5). Furthermore, greater increases in total PPCs were registered for DHBA, GA, VA, CHL, SCO and RUT (Table 1). Thus, most of the analysed PPCs with potential antiviral activity, in free and conjugated form, accumulated in plants treated with Poly‐Ga.

Figure 5.

Figure 5

Open in a new tab

Level of free, conjugated and total phenylpropanoid compounds (PPCs) corresponding to salicylic acid (A), dihydroxybenzoic acid (B), gallic acid (C), vanillic acid (D), caffeic acid (E), chlorogenic acid (F), scopoletin (G), esculetin (H), quercetin (I) and rutin (J) in tobacco plants treated with Poly‐Ga and cultivated for increasing times after treatment. The level of PPCs is expressed as micrograms per gram of fresh tissue (FT) except for CHL which is expressed as milligrams per gram of FT. Mean values of free PPCs (open circles) and conjugated PPCs (black circles) were obtained from three independent triplicates ± SD. Total PPCs (free PPCs + conjugated PPCs) are indicated by red triangles.

Table 1.

Level of free, conjugated and total phenylpropanoid compounds (PPCs) in control plants and in plants treated with Poly‐Ga cultivated for 60 days after treatment.

PPCs Control plants Treated plants Fold change†
Free* Conjugated Total Free Conjugated Total
SA 4 0.0 4 40 0 40 10
DHBA 0.5 0.1 0.6 168 6 174 290
GA 0.02 0 0.02 14 109 123 6150
VA 0.4 0 0.4 16 11 27 68
CA 1.6 11 12.6 25 16 41 3
SCO 0.4 0.1 0.5 39 11 50 100
ESC 0.2 3.3 3.5 13 7 20 6
CHL 3 110 113 1000 2550 3550 31
QUE 0 3.2 3.2 0 0 0 0
RUT 0.1 0.1 0.2 9 1.5 10.5 52
Open in a new tab

CA, caffeic acid; CHL, chlorogenic acid; DHBA, dihydroxybenzoic acid; ESC, esculetin; GA, gallic acid; QUE, quercetin; RUT, rutin; SA, salicylic acid; SCO, scopoletin; VA, vanillic acid.

*

The level of free, conjugated and total PPCs is expressed as micromoles per gram of fresh tissue.

†

Fold change in total PPCs.

DISCUSSION

Poly‐Ga induced systemic and long‐term protection against TMV

In this work, we showed that the oligo‐sulphated galactan Poly‐Ga induced a dose‐dependent, treatment number‐dependent and long‐term protection against TMV in tobacco plants, mimicking a vaccination effect. In this sense, vaccination in animals is induced by the infiltration of an antigen derived from a pathogen which activates innate immunity, which, in turn, stimulates cellular immunity. In animals, innate immunity is activated by antigens corresponding to microbe‐associated molecular patterns (MAMPs), such as proteins, oligosaccharides, lipoproteins, lipooligosaccharides and nucleic acids derived from pathogens (Kawai and Akira, 2010). These MAMPs bind to plasma membrane TLRs and/or intracellular nucleotide‐binding and oligomerization domain (NOD) receptors present in dendritic cells, macrophages and immunocompetent tissues. The interaction between a MAMP and its receptor triggers a signal transduction cascade that activates nuclear factor‐κB (NF‐κB) transcriptional regulation factor, which, in turn, activates genes coding for interleukins and interferon. The latter inflammatory signals induce the proliferation of T lymphocytes and B lymphocytes, conferring specificity and amplifying the immune response. In contrast, plants only have an innate immune system and lack the cellular system to amplify the immune response. Innate immunity in plants also depends on MAMPs and plasma membrane‐specific receptors (Boller and Felix, 2009). In plants, MAMPs are molecules derived from pathogens, such as bacterial flagellin, bacterial translation elongation factor Ef‐Tu, bacterial LCOs (nod factors), fungal HGs, fungal COSs, among others (Boller and Felix, 2009; Chinchilla et al., 2007; Kaku et al., 2006). The binding of MAMPs to their specific receptors triggers a signal transduction cascade that activates defence genes, leading to the synthesis of PR proteins with antibacterial and antifungal properties, and to the accumulation of phytoalexins with antiviral activity (Aslam et al., 2009; Kishi‐Kaboshi et al., 2010; Zhang et al., 2007). As mentioned above, Poly‐Ga induced a dose‐dependent, treatment number‐dependent and long‐term antiviral protection, mimicking a vaccination effect, but the mechanisms that determine the number of dose‐dependent effect in plants remain to be determined.

The activation of innate immunity induced by Poly‐Ga suggests that oligosaccharides may reach the plasma membrane of tobacco leaf cells, where specific receptors for sulphated oligosaccharides may exist. With regard to the recognition of sulphated oligosaccharides in plants, it has been shown that nod factors, which are sulphated glucosamine oligosaccharides secreted by rhizobial bacteria, interact with receptors located in the plasma membrane of leguminous root cells (Lerouge et al., 1990; Madsen et al., 2003). Thus, plants not related to leguminous species may have receptors in foliar tissue recognizing sulphated oligosaccharides. The exitence of such receptors may explain the responses induced by sulphated oligosaccharides such as sulphated laminarin, sulphated fucans and Poly‐Ga in tobacco plants (Klarzynski et al., 2003; Laporte et al., 2007; Ménard et al., 2004). The occurrence and cellular location of specific receptors recognizing sulphated oligosaccharides in plants remain to be determined.

Poly‐Ga induced a sustained activation of PAL defence enzyme

With regard to the defence triggered by MAMP–receptor interaction, a common response in plants is the activation of PAL and LOX defence enzymes, which lead to the synthesis of PPCs and oxylipins with antimicrobial activities (Blée, 2004; La Caméra et al., 2004). In this work, we detected a sustained and progressive increase in PAL activity in plants treated with increasing concentrations of Poly‐Ga, with increasing numbers of treatments and cultivated for different times after treatment. This contrasts with previous findings in tobacco plants treated with laminarin, sulphated fucans or with a fructooligosaccharide extracted from roots of the plant Arctium lappa, where PAL expression and activity were only transiently induced (2000, 2003; Wang F. et al., 2009). In addition, the increase in PAL activity correlates linearly with protection against TMV infection, suggesting that the activation of the phenylpropanoid pathway is involved in the antiviral effect induced by Poly‐Ga.

Poly‐Ga induced the accumulation of PPCs

Tobacco plants treated with Poly‐Ga showed a progressive accumulation of several PPCs in their free and/or conjugated forms. Interestingly, free SA increased in plants treated with Poly‐Ga and cultivated for increasing times after treatment (without infection), indicating that Poly‐Ga induced a systemic acquired resistance in tobacco plants and that its accumulation may contribute to the antiviral effect (Vlot et al., 2009). In addition, the accumulation of free and conjugated PPCs correlates with the increase in protection against TMV, indicating that PPCs may contribute to the antiviral effect induced by Poly‐Ga. In this sense, it has been shown that free and conjugated forms of PPCs can have antiviral activity against animal viruses by inhibiting their replication. For example, free GA, CA, CHL and ESC inhibit enterovirus, herpes virus and hepatitis virus infection (Chiang et al., 2002; Choi et al., 2010; Tian et al., 2009; Wang G. F. et al., 2009) and glycosides of GA, CA and QUE inhibit syncytial virus, hepatitis C virus and herpes virus infection (Kernan et al., 1998; Tian et al., 2009; Zuo et al., 2005). It is important to mention that the accumulation of compounds other than phenylpropanoids may also contribute to the antiviral effect induced by Poly‐Ga in tobacco plants. In this sense, it has been shown that terpenoids and alkaloids extracted from plants have antiviral effects against TMV (Wu et al., 2007; Yan et al., 2010; Zhang et al., 2007). Thus, the accumulation of PPCs, as well as terpenes, terpenoids and/or alkaloids, with potential antiviral activity may explain the effect of Poly‐Ga in tobacco plants.

In conclusion, the oligo‐sulphated‐galactan Poly‐Ga induced a dose‐dependent, treatment number‐dependent and long‐term protection against TMV in tobacco plants, mimicking a vaccination effect. The antiviral effect of Poly‐Ga was determined, at least in part, by a sustained activation of PAL defence enzyme, leading to the accumulation of PPCs with potential antiviral activity.

EXPERIMENTAL PROCEDURES

Preparation of Poly‐Ga

Poly‐Ga was prepared as described by Zúñiga et al. (2006).

Plant culture and treatments

XhantiNN and Xhantinn tobacco plants were cultivated in flowerpots with a mixture of compost–vermiculite (3 : 2) in a growth chamber using a light/dark period of 16 h/8 h, light intensity of 100 µmol/m2/s at 22 °C, and watered every 3 days.

For assays with increasing concentrations of Poly‐Ga, XhantiNN tobacco plants were sprayed with water on the upper and lower faces of all the leaves (control plants, n= 7; initial height, 15 cm) or with an aqueous solution of Poly‐Ga at concentrations of 0.1, 0.3, 0.5 or 0.7 mg/mL (n= 7 for each concentration of Poly‐Ga; initial height, 15 cm), once a week for 2 weeks, and cultivated for 15 days after treatment.

For assays with increasing numbers of Poly‐Ga treatments, XhantiNN tobacco plants were sprayed with water on the upper and lower faces of all the leaves (control plants, n= 7; initial height, 15 cm) or with an aqueous solution of Poly‐Ga at a concentration of 0.5 mg/mL, once a week for 1, 2, 3 or 4 weeks (n= 7 for each number of treatments; initial height, 15 cm), and cultivated for 15 days after treatment.

For assays with increasing times after treatment, XhantiNN tobacco plants were sprayed with water on the upper and lower faces of all the leaves, once a week for 2 weeks, and cultivated for 0, 15, 30, 45 or 60 days after treatment (control plants, n= 7; initial height, 15 cm) or sprayed with an aqueous solution of Poly‐Ga at a concentration of 0.5 mg/mL, once a week for 2 weeks, and cultivated for 0, 15, 30, 45 or 60 days after treatment (n= 7 for each time after treatment; initial height, 15 cm).

For infection with TMV and the detection of necrotic lesions, XhantiNN control plants and plants treated with increasing concentrations of Poly‐Ga, for increasing numbers of treatments and cultivated for increasing times after treatment (see above) were infected with TMV in a single leaf located in the middle part of each plant, and the numbers of necrotic lesions were counted in the infected leaf.

For infection with TMV and the detection of the TMV‐CP transcript level, Xhantinn control tobacco plants and treated plants cultivated for increasing times after treatment (see above) were infected with TMV in a single leaf located in the middle part of each plant; the apical leaves with mosaic symptoms were collected after 20 days and the total leaves from two plants were pooled to obtain triplicate samples.

For the detection of PAL activity, the total leaves from each XhantiNN control plant and the total leaves from each plant treated with increasing concentrations of Poly‐Ga, with increasing numbers of treatments and cultivated for increasing times after treatment (see above), and not infected with TMV, were collected. PAL activity was detected in each plant of the control (n= 7) and treated groups (n= 7 for each treatment).

For the detection of PPCs, the total leaves from each XhantiNN control plant and the total leaves from each plant cultivated for increasing times after treatment (see above), and not infected with TMV, were collected, and the total leaves from two plants were pooled to obtain triplicate samples.

Infection with TMV

XhantiNN tobacco plants were infected in a single leaf in the middle part of each plant with 100 µL of TMV‐U 1 viral suspension (2 µg of protein) using carborundum, and necrotic lesions were counted 5 days after infection. Xhantinn tobacco plants were infected in a single leaf in the middle part of each plant using the latter procedure, and mosaic symptoms were observed 20 days after infection.

Preparation of protein extracts

Protein extracts were prepared as described by Laporte et al. (2007).

Detection of PAL and LOX activities

PAL activity was determined in 1 mL of reaction mixture containing 100 mm phosphate buffer, pH 7.0, 13 mm phenylalanine and 100 µg of protein extract at 40 °C. The increase in absorbance, caused by cinnamic acid accumulation, was monitored at 290 nm for 90 min. PAL activity was calculated using the extinction coefficient of cinnamic acid (ε= 17.4 mm −1 cm−1).

LOX activity was determined in 1 mL of reaction mixture containing 100 mm phosphate buffer, pH 7.0, 0.4 mm linoleic acid and 100 µg of protein extract. The increase in absorbance caused by the accumulation of conjugated dienes was monitored at 234 nm for 10 min. LOX activity was calculated using the extinction coefficient of conjugated dienes (ε= 25 mm −1 cm−1).

Quantification of TMV‐CP transcripts by real‐time RT‐PCR

Total RNA was extracted from tobacco leaves (0.5 g) using a FavorPrep Plant Total RNA Kit (Favorgene, Ping Tung, Taiwan) and quantified with a Quanti‐iT Ribogreen RNA Assay Kit (Invitrogen, Eugene, OR, USA). The relative level of transcripts coding for TMV‐CP was detected, as well as the 18S RNA level as an internal control. PCR primers used for CP amplification were as follows: Forward‐CP, 5′‐CTGCCGAAACGTTAGATGCTACT‐3′; Reverse‐CP, 5′‐TCCGGTTCCTCTGATCAATTCT‐3′. Those for 18S RNA amplification were as follows: Forward‐18S, 5′‐TTCTTTGTACCTTTTGCTGGCTTAT‐3′; Reverse‐18S, 5′‐CTCTGGTCCTTCTTTATACAACAAAC‐3′. RT‐PCRs were performed using the Sensimix One‐Step Kit (Quantace, London, UK), 5 µg of total RNA, 10 µm of each PCR primer, 2 mm MgCl2 and a real‐time thermocycler Rotor gene 6000 (Corbett, Research, Sydney, Australia). The RT step was performed for 30 min at 49 °C, the inactivation step for 10 min at 95 °C and the PCR amplification used 40 cycles of 15 s at 95 °C, 30 s at 58 °C and 30 s at 72 °C. Fragments amplified by RT‐PCR were detected by fluorescence using SYBR GREEN I included in the amplification kit. RT‐PCRs were performed in triplicate from three independent replicates. Sample values were averaged, normalized using the ΔΔCT method and the mean value of the control was subtracted from the mean value of the treated sample to determine the fold change in the treated sample. The relative transcript level was expressed as 2−ΔΔCT (Livak and Schmittgen, 2001).

Analysis of PPC level by HPLC

Tobacco leaves (1 g) were frozen in liquid nitrogen and pulverized in a mortar with a pestle. To detect free PPCs, 5 mL of 100% methanol were added, the mixture was incubated in darkness for 24 h at room temperature, centrifuged at 7400 g for 15 min and the supernatant was recovered. To detect conjugated PPCs, 5 mL of 100% ethanol and 5 mL of 1 m NaOH were added, the mixture was incubated in darkness for 24 h at room temperature, neutralized to pH 7.0 with HCl (1 m), centrifuged at 7400 g for 15 min and the pellet was solubilized in 1 mL of 100% methanol.

Free PPCs in the methanol fraction (20 µL) were analysed by HPLC using an Agilent HPLC equipment model 1110 (Agilent Technologies, Santa Cruz, CA, USA) and a reversed phase C‐18 column (length, 15.5 cm; inner diameter, 4.6 mm; particle size, 5 µm) coupled to a photodiode array detector. PPCs were eluted with a linear gradient from 0% to 60% (v/v) of acetonitrile in 5% (v/v) trifluoroacetic acid for 20 min at a flow rate of 1 mL/min. PPCs were detected at 254, 280, 314 and 360 nm using the absorption spectra of pure commercial standards (Sigma, St. Louis, MO, USA), and quantified using a calibration curve prepared with pure standards at concentrations ranging from 0 to 1 mg/mL.

Statistical analysis

Significant differences were determined by two‐way analysis of variance (anova), followed by Tukey's multiple comparisons test (T). Differences between mean values were considered to be significant at a probability of 5% (P < 0.05) (Zar, 1999).

ACKNOWLEDGEMENTS

This work was funded by Fondecyt 1010594 to BM and AM.

REFERENCES

  1. Aslam, S.M. , Erbs, G. , Morrissey, K.L. , Newman, M.A. , Chinchilla, D. , Boller, T. , Molinaro, A. , Jackson, R.W. and Copper, R.M. (2009) Microbe‐associated molecular pattern (MAMP) signature, synergy, size and charge: influences on perception and mobility and host defence responses. Mol. Plant Pathol. 10, 375–387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aziz, A. , Poinssot, B. , Daire, X. , Adrian, M. , Bézier, A. , Lambert, B. , Joubert, J.M. and Pugin, A. (2003) Laminarin elicits defense responses in grapevine and induces protection against Botrytis cinerea and Plasmopara viticola . Mol. Plant–Microbe Interact. 16, 1118–1128. [DOI] [PubMed] [Google Scholar]
  3. Aziz, A. , Heyraud, A. and Lambert, B. (2004) Oligogalacturonide signal transduction, induction of defense‐related responses and protection of grapevine against Botrytis cinerea . Planta, 218, 767–774. [DOI] [PubMed] [Google Scholar]
  4. Aziz, A. , Gauthier, A. , Bézier, A. , Poinssot, B. , Joubert, J.M. , Pugin, A. , Heyraud, A. and Baillieul, F. (2007) Elicitor and resistance‐inducing activities of 1,4 cellodextrins in grapevine, comparison with beta‐1,3 glucans and alpha‐1,4 oligogalacturonides. J. Exp. Bot. 58, 1463–1472. [DOI] [PubMed] [Google Scholar]
  5. Bishop, P.D. , Makus, D.J. , Pearce, G. and Ryan, C.A. (1981) Proteinase inhibitor‐inducing factor activity in tomato leaves resides on oligosaccharides enzymically released from cell walls. Proc. Natl. Acad. Sci. USA, 78, 3536–3540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blée, E. (2004) Impact of phyto‐oxylipins in plant defense. Trends Plant Sci. 7, 315–321. [DOI] [PubMed] [Google Scholar]
  7. Boller, T. and Felix, G. (2009) A renaissance of elicitors: perception of microbe‐associated molecular patterns and danger signals by pattern‐recognition receptors. Annu. Rev. Plant Biol. 60, 379–406. [DOI] [PubMed] [Google Scholar]
  8. Boudsocq, M. , Willmann, M.R. , McCormack, M.W. , Lee, H. , Shan, L. , He, P. , Bush, J. , Cheng, S.H. and Sheen, J. (2010) Differential innate immune signaling via Ca2+ sensor protein kinases. Nature, 464, 418–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chiang, L.C. , Chiang, W. , Chang, M.Y. , Ng, L.T. and Lin, C.C. (2002) Antiviral activity of Plantago major extracts and related compounds in vitro . Antiviral Res. 55, 53–62. [DOI] [PubMed] [Google Scholar]
  10. Chinchilla, D. , Zipfel, C. , Robatzek, S. , Kemmerling, B. , Nürnberger, T. , Jones, J.D. , Felix, G. and Boller, T. (2007) A flagellin‐induced complex of the receptors FLS2 and BAK1 initiates plant defence. Nature, 448, 497–500. [DOI] [PubMed] [Google Scholar]
  11. Choi, H.J. , Song, J.H. , Park, K.S. and Baek, S.H. (2010) In vitro anti‐enterovirus 71 activity of gallic acid from Woodfordia fruticosa flowers. Lett. Appl. Microbiol. 50, 438–440. [DOI] [PubMed] [Google Scholar]
  12. Chong, J. , Baltz, R. , Schmitt, C. , Belfa, R. , Fritig, B. and Saindrenan, P. (2002) Down‐regulation of a pathogen‐responsive tobacco UDP‐Glc:phenylpropanoid glucosyltransferase reduces scopoletin glucoside accumulation, enhances oxidative stress, and weakens virus resistance. Plant Cell, 14, 1093–1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Darvill, A. , Bergmann, C. , Servone, F. , De Lorenzo, G. , Ham, K.S. , Spiro, M.D. , York, W.S. and Albersheim, P. (1994) Oligosaccharins involved in plant growth and host–pathogen interactions. Biochem. Soc. Symp. 60, 89–94. [PubMed] [Google Scholar]
  14. Daxberger, A. , Nemak, A. , Mithöfer, A. , Fliegmann, J. , Ligterink, W. , Hirt, H. and Ebel, J. (2007) Activation of members of a MAPK module in beta‐glucan elicitor‐mediated non‐host resistance of soybean. Planta, 225, 1559–1571. [DOI] [PubMed] [Google Scholar]
  15. Denoux, C. , Galetti, R. , Mamarella, L. , Gopalan, S. , Werck, D. , De Lorenzo, G. , Ferrari, S. , Ausubel, F.M. and Dewdney, J. (2008) Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings. Mol. Plant, 1, 423–445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dixon, R.A. (2001) Natural products and plant disease resistance. Nature, 411, 843–847. [DOI] [PubMed] [Google Scholar]
  17. Fliegmann, J. , Mithofer, A. , Wanner, G. and Ebel, J. (2004) An ancient enzyme domain hidden in the putative beta‐glucan elicitor receptor of soybean may play an active part in the perception of pathogen‐associated molecular patterns during broad host resistance. J. Biol. Chem. 279, 1132–1140. [DOI] [PubMed] [Google Scholar]
  18. Hammond‐Kosack, K.E. and Jones, J.D.G. (1996) Resistance genes‐dependent plant defense responses. Plant Cell, 8, 1773–1791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Howles, P.A. , Paiva, N.L. , Sewalt, V.J.H. , Elkind, N.L. , Bate, Y. , Lamb, C.J. and Dixon, R.A. (1996) Overexpression of L‐phenylalanine ammonia‐lyase in transgenic tobacco plants reveals control points flux into phenylpropanoid biosynthesis. Plant Physiol. 112, 1617–1624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Itoh, Y. , Kaku, H. and Shibuya, N. (1997) Identification of high affinity binding protein for N‐acetylchitooligosaccharide elicitor in the plasma membrane of suspension‐cultured rice cells by affinity labeling. Plant J. 12, 347–356. [DOI] [PubMed] [Google Scholar]
  21. Jabs, T. , Tshöpe, M. , Colling, C. , Halbrock, K. and Scheel, D. (1997) Elicitor‐stimulated ion fluxes and O2 ‐ from the oxidative burst are essential components in triggering defense gene activation and phytoalexin synthesis in parsley. Proc. Natl. Acad. Sci. USA, 94, 4800–4805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jeworutzki, E. , Roelfsema, M.R. , Anshütz, U. , Elzenga, J.T. , Felix, G. , Boller, T. , Hedrich, R. and Becker, D. (2010) Early signaling through the Arabidopsis pattern recognition receptors FLS2 and EFR involves Ca+2‐associated opening of plasma membrane anion channels. Plant J. 62, 367–378. [DOI] [PubMed] [Google Scholar]
  23. Kaku, H. , Nishizawa, Y. , Ishii‐Minami, N. , Akimoto‐Tomiya, C. , Dohmae, N. , Takio, K. , Minami, E. and Shibuya, N. (2006) Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proc. Natl. Acad. Sci. USA, 103, 11 086–11 091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kawai, T. and Akira, S. (2010) The role of pattern‐recognition receptors in innate immunity: update on Toll‐like receptors. Nat. Immunol. 11, 373–384. [DOI] [PubMed] [Google Scholar]
  25. Kernan, M.R. , Amarquaye, A. , Chen, J.L. , Chan, J. , Sesin, D.F. , Parkinson, N. , Ye, Z. , Barrett, M. , Bales, C. , Stoddart, C.A. , Sloan, B. , Blanc, P. , Limbach, C. , Mrischo, S. and Rozhon, E. (1998) Antiviral phenylpropanoid glycosides from the medicinal plant Markhamia lutea . J. Nat. Prod. 61, 564–570. [DOI] [PubMed] [Google Scholar]
  26. Kishi‐Kaboshi, M. , Okada, K. , Kurimoto, L. , Murakami, S. , Umezawa, T. , Shibuya, N. , Yamane, H. , Miyao, A. , Takatsuji, H. , Takahashi, A. and Hiroshika, H. (2010) A rice fungal MAMP‐responsive MAPK cascade regulates metabolic flow to antimicrobial metabolite synthesis. Plant J. 63, 599–612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Klarzynski, O. , Plesse, B. , Joubert, J. , Yvin, C. , Kopp, M. , Kloareg, B. and Fritig, B. (2000) Linear β‐1,3 glucans are elicitors of defense responses in tobacco. Plant Physiol. 124, 1027–1037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Klarzynski, O. , Descamps, V. , Plesse, B. , Yvin, J.C. , Kloareg, B. and Fritig, B. (2003) Sulfated fucan oligosaccharides elicit defense responses in tobacco and local and systemic resistance against tobacco mosaic virus. Mol. Plant–Microbe Interact. 16, 115–122. [DOI] [PubMed] [Google Scholar]
  29. La Caméra, S. , Gouzhert, G. , Dohndt, S. , Hoffmann, L. , Fritig, B. , Legrand, M. and Heitz, T. (2004) Metabolic reprogramming in plant innate immunity: the contribution of the phenylpropanoid and oxylipin pathways. Immunol. Rev. 198, 267–284. [DOI] [PubMed] [Google Scholar]
  30. Laporte, D. , Vera, J. , Chandía, N.P. , Zúñiga, E. , Matsuhiro, B. and Moenne, A. (2007) Structurally unrelated algal oligosaccharides differentially stimulate growth and defense against tobacco mosaic virus in tobacco plants. J. Appl. Phycol. 19, 79–88. [Google Scholar]
  31. Lerouge, P. , Roche, P. , Faucher, C. , Maillet, F. , Truchet, G. , Promé, J.C. and Dénarié, J. (1990) Symbiotic‐host specificity of Rhyzobium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal. Nature, 344, 781–784. [DOI] [PubMed] [Google Scholar]
  32. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real‐time quantitative PCR and the 2−ΔΔCT method. Methods, 25, 402–408. [DOI] [PubMed] [Google Scholar]
  33. Madsen, E.B. , Madsen, L.H. , Radutoiu, S. , Olbryt, M. , Rakwalska, M. , Szczglowsky, K. , Sato, S. , Kaneko, T. , Tabata, S. , Sandai, N. and Stougaard, J. (2003) A receptor kinase gene of the LysM type is involved in legume perception of rhizobial signals. Nature, 425, 637–640. [DOI] [PubMed] [Google Scholar]
  34. Ménard, R. , Alban, S. , De Ruffray, P. , Jamois, F. , Franz, G. , Fritig, B. , Yvin, J.C. and Kauffmann, S. (2004) β‐1,3 glucan sulfate, but not β‐1,3 glucan, induces salicylic acid signaling pathway in tobacco and Arabidopsis. Plant Cell, 16, 3020–3032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Miya, A. , Albert, P. , Shynia, T. , Desaki, Y. , Ichimura, K. , Shirasu, K. , Narusaka, Y. , Kawakami, N. , Kaku, H. and Shibuya, N. (2007) CERK1, a LYSM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. USA, 104, 19 613–19 618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Norman, C. , Vidal, S. and Paiva, E.T. (1999) Oligogalacturonide‐mediated induction of a gene involved in jasmonic acid synthesis in response to the cell‐wall‐degrading enzyme of the plant pathogen Erwinia carotovora . Mol. Plant–Microbe Interact. 12, 640–644. [DOI] [PubMed] [Google Scholar]
  37. Ogasawara, Y. , Kaya, H. , Hiraoka, G. , Yumoto, F. , Kimura, S. , Kadota, Y. , Hishinuma, H. , Sensaki, E. , Yamagoe, S. , Nagata, K. , Nara, M. , Suzuki, K. , Tanokura, M. and Kuchitsu, K. (2008) Synergistic activation of the Arabidopsis NADPH oxidase AtrbohD by Ca2+ and phosphorylation. J. Biol. Chem. 283, 8885–8892. [DOI] [PubMed] [Google Scholar]
  38. Petutschnig, E.K. , Jones, A.M. , Serazetdinova, L. , Lipka, U. and Lipka, V. (2010) The LysM‐RLK CERK1 is a major chitin binding protein in Arabidopsis thaliana and subject to chitin‐induced phosphorylation. J. Biol. Chem. 285, 28 902–28 911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schneider, S. , Reichling, J. , Stintzing, F.C. , Messerschmidt, S. , Meyer, U. and Schnitzler, P. (2010) Anti‐herpetic properties of hydroalcoholic extracts and pressed juice from Echinacea pallida . Planta Med. 76, 265–272. [DOI] [PubMed] [Google Scholar]
  40. Sels, J. , Mathys, J. , De Coninck, B.M. , Cammue, B.P. and De Bolle, M.F. (2008) Plant pathogenesis‐related (PR) proteins: a focus on PR peptides. Plant Physiol. Biochem. 46, 941–950. [DOI] [PubMed] [Google Scholar]
  41. Sharp, J.K. , Valent, B. and Albersheim, P. (1984) Purification and partial characterization of a beta‐glucan fragment that elicits phytoalexin accumulation in soybean. J. Biol. Chem. 259, 11 312–11 320. [PubMed] [Google Scholar]
  42. Silipo, A. , Erbs, G. , Shinya, T. , Dow, J.M. , Parilli, M. , Lanzetta, R. , Shibuya, N. , Newman, M.A. and Molinaro, A. (2010) Glyco‐conjugates as elicitors or suppressors of plant innate immunity. Glycobiology, 20, 406–419. [DOI] [PubMed] [Google Scholar]
  43. Tian, L.W. , Pei, Y. , Zhang, J.G. , Wang, Y.F. and Yang, C.R. (2009) 7‐O‐methylkaempferol and ‐quercetin glycosides from the whole plant Nervilia fordii . J. Nat. Prod. 72, 1057–1060. [DOI] [PubMed] [Google Scholar]
  44. Van Breusegem, F. , Bailey‐Serres, J. and Mittler, R. (2008) Unraveling the tapestry of networks involving reactive oxygen species in plants. Plant Physiol. 147, 978–984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Varnier, A.L. , Sánchez, L. , Vatsa, P. , Boudesocque, L. , Garcia‐Brugger, A. , Rabenoelina, F. , Sorokin, A. , Renault, J.H. , Kauffmann, S. , Pugin, A. , Clement, C. , Baillieul, F. and Dorey, S. (2009) Bacterial rhamnolipids are novel MAMPs conferring resistance to Botrytis cinerea in grapevine. Plant Cell Environ. 32, 178–193. [DOI] [PubMed] [Google Scholar]
  46. Vlot, A.C. , Dempsey, D.A. and Klessig, D.F. (2009) Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 47, 177–206. [DOI] [PubMed] [Google Scholar]
  47. Wang, F. , Feng, G. and Chen, K. (2009) Burdock fructooligosaccharide induces resistance to tobacco mosaic virus in tobacco seedlings. Physiol. Mol. Plant Pathol. 74, 34–40. [Google Scholar]
  48. Wang, G.F. , Shi, L.P. , Ren, Y.D. , Liu, Q.F. , Liu, H.F. , Zhang, R.J. , Li, Z. , Zhu, F.H. , He, P.L. , Tang, W. , Tao, P.Z. , Li, C. , Zhao, W.M. and Zuo, J.P. (2009) Anti‐hepatitis B virus activity of chlorogenic acid, quinic acid, and caffeic acid in vivo and in vitro . Antiviral Res. 83, 186–190. [DOI] [PubMed] [Google Scholar]
  49. Wu, Z.J. , Ouyang, M.A. , Wang, C.Z. , Zhang, Z.K. and Shen, J.G. (2007) Anti‐tobacco mosaic virus (TMV) triterpenoid saponins from the leaves of Ilex oblonga . J. Agric. Food Chem. 55, 1712–1717. [DOI] [PubMed] [Google Scholar]
  50. Yan, H.H. , Chen, J. , Di, Y.T. , Fang, X. , Dong, J.H. , Sang, P. , Wang, Y.H. , He, H.P. , Zhang, Z.K. and Hao, X.J. (2010) Anti‐tobacco mosaic virus (TMV) quassinoids from Brucea javanica (L.) Merr. J. Agric. Food Chem. 58, 1572–1577. [DOI] [PubMed] [Google Scholar]
  51. Zar, J. (1999) Biostatistical Analysis. Englewood Cliffs, NJ: Prentice‐Hall. [Google Scholar]
  52. Zhang, Z.K. , Ouyang, M.A. , Wu, Z.J. , Lin, Q.Y. and Xie, L.H. (2007) Structure activity relationship of triterpenes and triterpenoid glycosides against tobacco mosaic virus. Planta Med. 73, 1457–1463. [DOI] [PubMed] [Google Scholar]
  53. Zúñiga, E. , Matsuhiro, B. and Mejías, E. (2006) Preparation of a low molecular weight fraction by free radical depolymerization of the sulphated galactan from Schyzimenia binderi (Gigartinales, Rodophyta) and its anticoagulant activity. Carbohydr. Polym. 66, 208–215. [Google Scholar]
  54. Zuo, G.Y. , Li, Z.Q. , Chen, L.R. and Xu, X.J. (2005) In vitro anti‐HCV activities of Saxifraga melanocentra and its related polyphenolic compounds. Antivir. Chem. Chemother. 16, 393–398. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES