Skip to main content
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2010 Nov 18;12(4):355–364. doi: 10.1111/j.1364-3703.2010.00675.x

Expression of Arabidopsis pathogenesis‐related genes during nematode infection

NOUREDDINE HAMAMOUCH 1, CHUNYING LI 1, PIL JOON SEO 2, CHUNG‐MO PARK 2, ERIC L DAVIS 1,✉
PMCID: PMC6640486  PMID: 21453430

SUMMARY

The expression pattern of pathogenesis‐related genes PR‐1 to PR‐5 was examined in the roots and leaves of Arabidopsis thaliana plants on infection with beet‐cyst (Heterodera schachtii) and root‐knot (Meloidogyne incognita) nematodes. During H. schachtii parasitism of Arabidopsis, the expression of PR‐1, PR‐2 and PR‐5, which are considered to be markers for salicylic acid (SA)‐dependent systemic acquired resistance (SAR), was induced in both roots and leaves of infected plants. In addition, the expression of PR‐3 and PR‐4, which are used as markers for jasmonic acid (JA)‐dependent SAR, was not altered in roots, but in the leaves of H. schachtii‐infected plants, the expression PR‐3 was induced, whereas the expression of PR‐4 was down‐regulated. During M. incognita infection of Arabidopsis, the expression of PR‐1, PR‐2 and PR‐5 was highly induced in roots, as was PR‐3 to a lesser extent, but the expression of PR‐4 was not altered, indicating that infection with M. incognita activated both SA‐ and JA‐dependent SAR in roots. However, all PRgenes examined (PR‐1 to PR‐5) were down‐regulated in the leaves of M. incognita‐infected plants, suggesting the suppression of both SA‐ and JA‐dependent SAR. Furthermore, constitutive expression of a single PR in Arabidopsis altered the transcription patterns of other PR genes, and the over‐expression of PR‐1 reduced successful infection by both H. schachtii and M. incognita, whereas the over‐expression of PR‐3 reduced host susceptibility to M. incognita but had no effect on H. schachtii parasitism. The results suggest that fundamental differences in the mechanisms of infection by beet‐cyst and root‐knot nematodes differentially regulate PR protein production and mobilization within susceptible host plants.

INTRODUCTION

Plants possess both basal and inducible mechanisms to defend themselves against invading pathogens. Such mechanisms include the formation of cell wall polymers, secondary metabolites (phytoanticipins and phytoalexins) and proteins with antimicrobial activities (Slusarenko et al., 2000; Van Loon et al., 2006). Defence responses are triggered on recognition of elicitors derived from the invading pathogens. The local recognition events subsequently initiate signalling compounds, which spread systemically throughout the plant tissues from the infection site, finally establishing increased resistance to secondary infections in distal tissues (Durrant and Dong, 2004). This spread of resistance is collectively termed ‘systemic acquired resistance’ (SAR).

In several plant species, the establishment of SAR is associated with enhanced transcription of a large number of genes. A major class of these genes encodes the so‐called pathogenesis‐related (PR) proteins that were initially isolated in defence responses, but can also be up‐regulated during compatible plant–pathogen interactions (Van Loon et al., 2006). The PR proteins have been implicated in active defence and may play a role in restricting pathogen development and spread in the plant. They have been described in at least 17 families and are induced in response to oomycetes, fungi, bacteria, viruses, insects and nematodes (Van Loon et al., 2006). Most PR proteins possess antimicrobial activities in vitro through hydrolytic activities on cell walls, contact toxicity and may be involved in defence signalling. However, other PR proteins are developmentally regulated and expressed in specific plant organs or tissues, and others are induced in response to environmental stimuli, such as wounding or cold stress. Plant resistance to pathogens involves the plant hormones jasmonic acid (JA) and salicylic acid (SA) (Dong, 1998; Thomma et al., 2001). SA and JA appear to trigger defence responses against distinct sets of pathogens. SA‐dependent signalling seems to be crucial for resistance against biotrophic pathogens (Delaney et al., 1994; Reuber et al., 1998) and, in Arabidopsis thaliana, activates defence genes such as PR‐1, PR‐2 and PR‐5 (Thomma et al., 1998). In contrast, JA‐dependent resistance appears to be more effective against necrotrophic pathogens (Staswick et al., 1998; Vijayan et al., 1998), and involves increased expression of PR‐3, PR‐4 and PR‐12 (defensin or PDF1.2) genes in Arabidopsis (Thomma et al., 1998).

Cyst and root‐knot nematodes are obligate sedentary endoparasites of plant roots. On hatching in soil, the motile, infective, second‐stage juveniles (J2s) penetrate plant roots and migrate through the root until the appropriate root vascular cells to form feeding sites are recognized. Cyst and root‐knot nematodes secrete effector molecules into these selected root cells to induce their de‐differentiation into elaborate, multinucleate and metabolically active feeding cells, called syncytia and giant cells, respectively, that are essential to sustain nematode growth and development (Davis et al., 2008). A relatively few (three to six) giant cells are formed around the root‐knot nematode head through individual cell expansion with karyokinesis uncoupled from cytokinesis (Jones, 1981). In contrast, coordinated dissolution of walls adjacent to an initial syncytial cell gives rise to a syncytium induced by cyst nematodes that can incorporate many cells distal to the nematode.

Microarray analysis has revealed that the expression of multiple plant genes is altered in nematode infection sites, including the plant genes involved in cellular metabolism, cell wall synthesis, the cell cycle, signal transduction and defence responses, including PR genes (Alkharouf et al., 2006; Gheysen and Mitchum, 2009; 2007a, 2007b; Jammes et al., 2005; Puthoff et al., 2003; Szakasits et al., 2009). It has been reported that the infection of Arabidopsis roots by the beet‐cyst nematode, Heterodera schachtii, induces the expression of PR‐1, PR‐2 and PR‐5 in host roots and of PR‐1 in shoots (Wubben et al., 2008). However, the potential expression of PR‐2 and PR‐5 in Arabidopsis shoots during H. schachtii infection is still unresolved. The potential change in expression of the JA‐dependent PR genes, PR‐3 and PR‐4, in the roots and shoots of nematode‐infected plants is also unknown. Moreover, the expression of Arabidopsis PR genes during infection with the root‐knot nematode, Meloidogyne incognita, and the role of PR genes in host–nematode interaction remain to be investigated. In this study, a more comprehensive analysis of the expression patterns of PR genes in the roots and leaves of Arabidopsis plants during infection with H. schachtii and M. incognita is presented. In addition, the effect of PR proteins on nematode parasitism was examined using transgenic Arabidopsis plants that over‐express PR genes.

RESULTS

Expression of Arabidopsis PR genes during beet‐cyst nematode infection

Quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR) was used to measure the transcript levels of selected representatives (Seo et al., 2008) of five classes of Arabidopsis PR genes (PR‐1, PR‐2, PR‐3, PR‐4 and PR‐5) in the roots and leaves of wild‐type Arabidopsis plants at 0, 5, 9 and 14 days post‐infection (dpi) with H. schachtii. PR‐1, PR‐2 and PR‐5 are commonly used as molecular markers for SA‐dependent SAR signalling and their expression is coordinately regulated by SA (Bowling et al., 1994; Cao et al., 1994; Uknes et al., 1993), whereas PR‐3 and PR‐4 are often used as markers for JA‐dependent SAR signalling. Therefore, expression analysis of these genes during nematode parasitism will indicate how SA‐ and JA‐dependent SAR are manipulated during nematode parasitism. Our results showed that the expression of PR‐1 and PR‐2 genes increased in roots of H. schachtii‐infected plants at 9 dpi and then declined at 14 dpi (Fig. 1A), whereas the expression of PR‐5 increased at 9 dpi and remained elevated at 14 dpi. In contrast, the expression levels of PR‐3 and PR‐4 did not change in roots of H. schachtii‐infected plants (Fig. 1A). These results indicate that parasitism by the beet‐cyst nematode elicits the SA‐dependent SAR pathway in Arabidopsis roots and does not alter the JA‐dependent SAR pathway.

Figure 1.

Figure 1

Time‐course analysis of pathogenesis‐related (PR) gene expression by quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR) in roots (A) and shoots (B) of wild‐type Arabidopsis plants at 0, 5, 9 and 14 days post‐infection (dpi) with the beet‐cyst nematode, Heterodera schachtii. The presented data are the mean fold changes ± standard errors in PR transcript levels relative to uninfected control tissue (baseline set at 1.0) from three biological replicates. An asterisk (*) indicates that the mean fold change is significantly different from 1.0 as determined by t‐test (P < 0.05).

In leaves of H. schachtii‐infected plants (Fig. 1B), the expression of PR‐1 and PR‐2 followed a pattern similar to that observed in roots; their expression increased at 9 dpi and then declined thereafter. In addition, the expression of PR‐5 also increased at 9 dpi before it declined. These results indicate that parasitism by H. schachtii induces the SA‐dependent SAR pathway in leaves of infected plants. In addition, JA‐dependent SAR also appeared to be induced in leaves of H. schachtii‐infected Arabidopsis, as indicated by an increase in PR‐3 mRNA transcript level, although PR‐4 expression appeared to be down‐regulated (Fig. 1B). Taken together, these results indicate that H. schachtii induces SA‐dependent SAR in both roots and leaves of infected plants and may alter JA‐dependent SAR in leaves.

Expression of Arabidopsis PR genes during root‐knot nematode infection

In addition to examining the expression of Arabidopsis PR genes during beet‐cyst nematode parasitism, the expression patterns of Arabidopsis PR‐1, PR‐2, PR‐3, PR‐4 and PR‐5 genes were also examined at 0, 5, 9 and 14 dpi with the southern root‐knot nematode M. incognita. qRT‐PCR analysis indicated that the expression of PR‐1, PR‐2, PR‐3 and PR‐5 increased in roots of infected plants at 9 dpi and then declined at 14 dpi, indicating that root‐knot nematode infection induces both SA‐ and JA‐dependent SAR in roots of infected plants (Fig. 2A), although the expression level of PR‐4 did not change. Interestingly, and contrary to PR expression in root tissues, the transcript levels of all PR genes (PR‐1 to PR‐5) seemed to be down‐regulated in leaves of M. incognita‐infected plants (Fig. 2B), suggesting that M. incognita may be suppressing SA‐ and JA‐dependent SAR in leaves of infected plants.

Figure 2.

Figure 2

Time‐course analysis of pathogenesis‐related (PR) gene expression by quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR) in roots (A) and shoots (B) of wild‐type Arabidopsis plants at 0, 5, 9 and 14 days post‐infection (dpi) with the southern root‐knot nematode, Meloidogyne incognita. The presented data are the mean fold changes ± standard errors in PR transcript levels relative to uninfected control tissue (baseline set at 1.0) from two biological replicates. An asterisk (*) indicates that the mean fold change is significantly different from 1.0 as determined by t‐test (P < 0.05).

Effect of PR over‐expression on nematode infection

To examine the potential ability of PR proteins to defend host plants against nematode infection, transgenic Arabidopsis plants were used that constitutively expressed PR‐1, PR‐2, PR‐3, PR‐4 or PR‐5 (PR‐OE) under the control of the cauliflower mosaic virus (CaMV) 35S promoter (Seo et al., 2008). Homozygous lines were generated and challenged with infective J2s of H. schachtii or M. incognita in six‐well plates containing agar‐based plant growth medium. There was no apparent difference in growth between plants that over‐expressed PR genes and wild‐type control plants (data not shown). The numbers of developing (fourth‐stage) H. schachtii females or root galls induced by M. incognita in wild‐type and transgenic plants were counted 3–4 weeks post‐infection to assess the parasitic success of nematodes in PR‐OE roots.

In our assay, Arabidopsis plants that over‐expressed PR‐1 and PR‐3 were less susceptible to infection by H. schachtii relative to nontransformed wild‐type plants or plants transformed with the 35S::GUS gene (Fig. 3A). However, there was no difference in the number of developed cyst females in Arabidopsis roots that over‐expressed PR‐2, PR‐4 and PR‐5 and in roots of nontransformed control plants (Fig. 3A). Plants that over‐expressed PR‐1 were more resistant to root‐knot nematode infection relative to the wild‐type, as evidenced by the smaller number of galls developed relative to those in nontransformed control plants (Fig. 3B). No difference was observed between the number of galls developed on plants over‐expressing PR‐2, PR‐3, PR‐4, PR‐5 and wild‐type control plants. These results indicate that constitutive expression of PR‐1 reduces the level of parasitism of both H. schachtii and M. incognita, whereas PR‐3 over‐expression reduces only H. schachtii infection and has no effect on M. incognita development.

Figure 3.

Figure 3

Cyst and root‐knot nematode infection of roots of transgenic Arabidopsis thaliana plants that over‐expressed (OE) individual pathogenesis‐related (PR) genes. (A) Number of beet cyst nematodes, Heterodera schachtii, that developed to fourth‐stage juvenile (J4) in roots of Arabidopsis that over‐expressed PR‐1–PR‐5 genes. (B) Number of galls induced by the southern root‐knot nematode, Meloidogyne incognita, in roots of Arabidopsis that over‐expressed PR‐1–PR‐5 genes. Data are the mean ± standard error (n= 20) number of J4 or galls, respectively, for PR‐OE relative to wild‐type Columbia‐0 (WT). An asterisk (*) indicates that the mean is significantly different (P < 0.05) from WT in a paired t‐test.

Effect of over‐expression of a single PR gene on the transcriptional regulation of other PR genes

To assess whether constitutive expression of a single PR gene affects the transcript levels of other PR genes, we used qRT‐PCR to measure the mRNA transcript levels of PR‐1, PR‐2, PR‐3, PR‐4 and PR‐5 in PR‐OE plants. As a gene marker of SA‐dependent SAR, over‐expression of PR‐1 augmented the transcriptional level of PR‐2 and, to a lesser extent, of PR‐5, but had no effect on the transcription of PR‐3 and PR‐4 (Fig. 4). However, over‐expression of PR‐2 reduced the transcription of PR‐1 but had no effect on the transcription of PR‐3, PR‐4 and PR‐5. These results indicate that the over‐expression of a component of SA‐dependent SAR can alter the transcriptional regulation of other genes in the same pathway, but appears to have no effect on JA‐dependent SAR. However, with regard to the PR markers of JA‐dependent SAR, both PR‐3 and PR‐4 over‐expression augmented the transcriptional level of PR‐1 and PR‐2, but had no effect on PR‐5 expression, indicating that the activation of the JA‐dependent SAR pathway induces the activation of SA‐dependent SAR. Interestingly, over‐expression of PR‐3 had no effect on PR‐4 expression, and over‐expression of PR‐4 had no effect on the transcript level of PR‐3, indicating that, although PR‐3 and PR‐4 are used as markers for the activation of JA‐dependent SAR, they do not appear to be coordinately expressed. Moreover, the over‐expression of PR‐3, PR‐4 and PR‐5 elevated the mRNA transcript of PR‐1 to a level comparable with or higher than the level of PR‐1 transcripts in PR1‐OE plants. Likewise, the transcript level of PR‐2 is higher in plants over‐expressing PR‐1 and PR‐4 than in PR2‐OE plants.

Figure 4.

Figure 4

Effect of over‐expression of a single pathogenesis‐related (PR) gene in transgenic Arabidopsis on the expression of other PR genes in whole‐plant samples. The transcript level was measured by quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR) in seedlings of wild‐type Arabidopsis plants. The presented data are the mean fold changes ± standard errors in PR transcript levels relative to uninfected control tissue (baseline set at 1.0) from three biological replicates. An asterisk (*) indicates that the mean fold change is significantly different from 1.0 as determined by t‐test (P < 0.05).

DISCUSSION

Cyst and root‐knot nematodes are sedentary endoparasites that secrete effector molecules into selected host root cells and transform them into metabolically active feeding sites that are crucial for the survival of the nematode (Davis et al., 2008). Both cyst and root‐knot nematodes alter the expression of defence‐related genes, possibly to escape host defence mechanisms (Gheysen and Mitchum, 2009; 2007a, 2007b; Jammes et al., 2005; Puthoff et al., 2003; Szakasits et al., 2009). The aim of this study was to provide a systematic characterization of the expression patterns of five classes of Arabidopsis PR genes during nematode interactions, and to assess the effect of the constitutive expression of PR genes on nematode parasitism.

qRT‐PCR analysis indicated that H. schachtii elicits SA‐dependent SAR in both roots and leaves of Arabidopsis‐infected plants, as evidenced by an increase in transcript levels of PR‐2 and PR‐5, which are used as markers of SA‐dependent SAR. The induction of PR‐2 and PR‐5 in roots of H. schachtii‐infected plant has been reported previously (Wubben et al., 2008). However, contrary to that report, our results indicate that PR‐1 is also induced in roots of H. schachtii‐infected plants.

JA‐dependent SAR also appears to be modulated in H. schachtii‐infected plants, but only in leaves. The up‐regulation of PR‐3 and the down‐regulation of PR‐4 in leaves of H. schachtii‐infected plants indicate that, during nematode parasitism, these two genes are not coordinately regulated. Moreover, the expression of PR‐3 and PR‐4 in leaves, but not in roots, is surprising, given that the roots are in direct contact with the nematodes; it suggests that, during H. schachtii infection, the regulation of these two genes may be under different control mechanisms in leaves vs. roots.

By contrast, M. incognita appears to induce both SA‐dependent and JA‐dependent SAR in roots of infected plants, although we did not observe any changes in the transcriptional level of PR‐4. The high levels of mRNA transcripts of PR‐2, PR‐3 and PR‐5 observed in roots of M. incognita‐infected plants relative to H. schachtii‐infected roots could be attributed to the difference in the level of infectivity and/or to the different mechanisms of parasitism used by these two different nematodes (Davis et al., 2008). Contrary to H. schachtii, M. incognita seems to down‐regulate both SA‐ and JA‐dependent SAR in leaves of infected plants, as evidenced by the reduced levels of PR‐1 to PR‐5 transcripts. The down‐regulation of PR genes following infection with root‐knot nematodes has been documented previously in tomato (Sanz‐Alferez et al., 2008). In contrast, in the Hero‐mediated incompatible response to potato cyst nematode, the up‐regulation of PR‐1 and PR‐5 in roots was observed (Sobczak et al., 2005). Furthermore, the difference in PR expression between the roots and leaves of M. incognita‐infected Arabidopsis plants further supports our hypothesis that, during nematode parasitism, the expression of some PR genes may be under different control mechanisms in leaves vs. roots. In a recent study, it has been reported that the regulation of PR genes is different in seedlings relative to adult plants (Fiocchetti et al., 2006). It is worth noting that our analysis of PR expression reflects expression in whole root or shoot systems and does not indicate transcriptional changes at the nematode feeding sites. Therefore, we cannot rule out the possibility that the expression of PR genes analysed in this study may be under different regulatory mechanisms directly in nematode‐feeding sites.

The similar spike in induction of PR‐1, PR‐2 and PR‐5 at 9 dpi in the roots by both root‐knot and cyst nematodes is curious, given the differential ontogeny of giant cells and syncytia, respectively (Jones, 1981). The early stages (0–6 days) of giant cell formation are characterized by cell elongation, expansion and nuclear division, compared with the coordinated cell wall dissolution characteristic of syncytia at similar time points. Giant cells are essentially mature by around 10–12 days after initiation, whereas syncytia continue to grow for up to 3–4 weeks, together with the developing cyst nematode. At the 9‐day time point, however, the osmoticum and cell wall thickening of both giant cells and syncytia increase to dramatic levels to support the feeding nematodes (Jones, 1981). Interestingly, the potential functions of PR‐2 and PR‐5 genes can include wall modifications and osmotic regulation (Van Loon et al., 2006), respectively, which may account for their similar expression patterns in roots at 9 dpi by either root‐knot or cyst nematodes.

The over‐expression of PR proteins in transgenic plants has been used previously to increase tolerance to plant pathogens. For instance, increased tolerance to Peronospora tabacina and Phytophthora parasitica var. nicotianae was demonstrated in tobacco over‐expressing the PR‐1a gene (Alexander et al., 1993). Transgenic rice and orange plants over‐expressing PR‐5 possess increased tolerance to Rhizoctonia solani and Phytophthora infestans (Bachmann et al., 1998). PR‐2 and PR‐3 genes confer resistance of carrot to several pathogens. The simultaneous expression of tobacco β‐1,3‐glucanase and chitinase genes in tomato plants results in increased resistance to fungal pathogens (Melchers et al., 1998). Moreover, it has long been suggested that the differences between susceptibility and resistance are associated with differences in the timing and magnitude of defence changes (Tao et al., 2003). Thus, we hypothesized that the effectiveness of PR proteins against nematode infection may lie both in their magnitude and rapidity of onset. To test this hypothesis, we used transgenic Arabidopsis plants that expressed PR‐1 to PR‐5 under the control of the CaMV 35S promoter, and examined their response to nematode infection. Our results indicated that transgenic Arabidopsis plants that constitutively express PR‐3 exhibit reduced susceptibility to H. schachtii infection relative to wild‐type plants or plants over‐expressing PR‐2, PR‐4 and PR‐5, whereas PR‐1‐over‐expressing plants exhibit reduced susceptibility to both H. schachtii and M. incognita infection. The mechanism of the increased resistance to nematodes is still unclear. Although chitin is not a known structural component of the nematode stages observed here (chitin is present only in the nematode eggshell), PR‐3 may potentially modulate the chitinase effectors predicted to be secreted by parasitic cyst nematode life stages (Gao et al., 2003). Alternatively, the over‐expression of PR‐3 drastically increased the expression levels of PR‐1, indicating that constitutive expression of a component of the plant response to pathogens can influence the expression of at least some other defence genes, and interfere with their transcriptional regulation, a phenomenon that has been reported previously in other studies (Fiocchetti et al., 2006; Linthorst et al., 1989). The biological activity of PR‐1 has long remained unclear, although decreased host susceptibility to H. schachii infection following treatment with SA has been associated with increased levels of PR‐1 in the roots and shoots (Wubben et al., 2008), and application of SAR elicitors to tomato plants has been shown to activate PR‐1 and PR‐2, and to reduce plant susceptibility to root‐knot nematode infection (Sanz‐Alferez et al., 2008). PR‐1 is one of several genes that are coordinately regulated during the plant defence response (Maleck et al., 2000), and may be viewed as a molecular marker for those genes that are effective against the nematode (Wubben et al., 2008).

The over‐expression of a PR gene of the SA‐dependent SAR pathway affects the expression regulation of other PR genes of the same pathway, but does not affect the expression of PR gene markers of the JA‐dependent SAR pathway. However, the over‐expression of a PR gene marker in JA‐dependent SAR induces the expression of PR gene markers of the SA‐dependent SAR pathway, indicating cross‐talk between the two pathways. This observation is consistent with the cross‐talk between SA‐ and JA‐dependent pathways that has been reported in a number of plant–pathogen interactions (Van Loon et al., 2006). Signalling by SA appears to be a critical component to achieve nematode suppression in both resistance gene‐mediated (Li et al., 2006) and normally compatible (Wubben et al., 2008) plant–nematode interactions. A systematic study of PR genes between compatible and incompatible plant–nematode pathosystems may similarly reveal that the quantitative and temporal expression of critical PR proteins (such as PR‐1) may regulate the success of nematode parasitism. By the combination of analyses of reporter gene constructs with technologies to quantify PR gene expression within and around nematode feeding cells (Ithal et al., 2007b; Szakasits et al., 2009), the potential biological significance of localized PR gene expression on nematode parasitic success can be assessed.

EXPERIMENTAL PROCEDURES

PR genes and plant materials analysed

A list of the Arabidopsis PR genes analysed in this study and the primer sets used for PCR is presented in Table 1. Representatives of the PR‐1–PR‐5 families were chosen for comparison with existing data on their expression in different plant tissues and stages of plant development (Seo et al., 2008). Arabidopsis thaliana seeds that constitutively over‐express individual PR‐1–PR‐5 genes (PR‐OE) (Seo et al., 2008) were kindly provided by Chung‐Mo Park at Seoul National University, Seoul, South Korea. Seeds were surface sterilized and plated in six‐well culture plates (Falcon, Lincoln Park, NJ, USA) containing Knops medium (Sijmons et al., 1991), which was solidified with 0.8% Daishin agar (Brunschwig Chemie, Amsterdam, the Netherlands). Plates were placed in a growth chamber at 25 °C under 16 h of light and 8 h of dark for 2 weeks before inoculation with nematodes.

Table 1.

The Arabidopsis thaliana pathogenesis‐related (PR) genes (based on Seo et al., 2008) examined in this study and the specific primers used in quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR).

Protein name Accession number Activity Primer sequence (5′–3′) Amplicon (bp)
PR‐1 AT2G14610 Unknown F: TTCTTCCCTCGAAAGCTCAA 434
R: TTGCAACTGATTATGGTTCCAC
PR‐2 AT3G57260 β‐1,3‐Glucanase F: GCAATGCAGAACATCGAGAA 124
R: TCATCCCTGAACCTTCCTTG
PR‐3 AT3G12500 Endo‐chitinase F: CGGGCATCATTTCAAGTTCT 432
R: GCAACAAGGTCAGGGTTGTT
PR‐4 AT3G04717 Endo‐chitinase F: TGTTCTCCGACCAACAACTG 404
R: CAATGAGATGGCCTTGTTGA
PR‐5 AT1G75040 Thaumatin‐like F: CGTACAGGCTGCAACTTTGA 465
R: AGTGAAGGTGCTCGTTTCGT
Actin ATU42007 N/A F: GCCCCGAGCAGCATGAAGAT 100
R: GCTGGAAAGTGCGGGAAGC

Nematode culture and sterilization

Pure cultures of H. schachtii (beet‐cyst nematode) and M. incognita (southern root‐knot nematode) were grown on the roots of plants in pots in a glasshouse. Eggs of H. schachtii were collected from crushed cysts developed on roots of cabbage plants (Brassica oleracea var. capitata), as described previously (Goellner et al., 2001). Eggs of M. incognita were extracted from roots of tomato plants (Solanum lycopersicon cv. Rutgers), as described previously (Hussey and Barker, 1973). Eggs were hatched over water at 28 °C for 48 h, after which the hatched preparasitic J2s (pre‐J2s) were collected and surface sterilized by incubation for 10 min in sterilization solution (0.004% mercuric chloride, 0.004% sodium azide and 0.002% Triton X‐100), followed by three washes with sterile distilled water.

Nematode infection assay and data collection

Seeds of wild‐type Arabidopsis (ecotype Columbia) and PR‐OE plants were surface sterilized and transferred (one seed per well) into six‐well culture plates (Falcon) containing 6 mL of sterile modified Knops medium (Sijmons et al., 1991) solidified with 0.8% Daishin agar (Brunschwig Chemie). Plates were placed in a 24 °C growth chamber under a 16 h light/8 h dark cycle for 2 weeks. After sterilization, J2 nematodes were suspended in 1.5% low‐melting‐point agarose to allow even distribution and to facilitate their movement into solid Knops medium. Plants were inoculated with approximately 60 J2s per plant and placed back in the growth chamber. The root systems of wild‐type Arabidopsis were harvested at 0, 5, 9 and 14 dpi with either H. schachtii or M. incognita, and stored at −80 °C for subsequent RNA extraction and qRT‐PCR. To analyse nematode infection rates of PR‐OE plants, the cysts (for beet‐cyst nematodes) and galls (for root‐knot nematodes) developed in wild‐type and PR‐OE plants were counted 3–4 weeks post‐infection, respectively, using a dissecting microscope, and the mean and standard error of 20 replicates per treatment were calculated. Statistical differences in the mean (n= 20) were determined by the paired t‐test with an α level of 0.05 using SAS software (Cary, NC, USA).

RNA isolation and qRT‐PCR

Total RNA for qRT‐PCR was isolated from the bulked root systems of 12 Arabidopsis plants to achieve one biological replicate, with two and three biological replicates completed for root‐knot and cyst nematode‐infected plants, respectively. Total RNA was isolated using the RNeasy Plant Mini Kit (QIAgen, Valencia, CA, USA) following the manufacturer's instructions. Prior to qRT‐PCR, RNA was treated with RNase‐free DNase I (Ambion, Austin, TX, USA) to eliminate any contaminating genomic DNA. First‐strand cDNA was synthesized from 2–3 µg of total RNA using Super‐Script II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and oligo‐dT18 primers following the manufacturer's instructions.

A single 20‐µL PCR included 1 × SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 2 µL of cDNA template and 5 µm each of forward and reverse primers. The PCR cycling parameters were set at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. After completion of the cycling parameters, dissociation melt curve analysis (60–90 °C every 0.5 °C for 1 s) was conducted to discount the effects of primer dimer formation and contamination. The qRT‐PCRs were performed in triplicate and the negative controls included water and mRNA prior to reverse transcription. The Arabidopsis actin 8 gene (ATU42007) was used as an internal control for the levels of cDNA used.

The relative fold change was calculated according to the 2–ΔΔCT method (Livak and Schmittgen, 2001). The paired t‐test with an α level of 0.05 was used to compare the relative transcript level means employing the statistical software package of SAS. All qRT‐PCRs were performed in a DNA Engine Opticon2 (Biorad, Hercules, CA, USA). Reactions were repeated at least twice and a representative result was displayed for individual assays. In addition to analysing PR gene expression in nematode‐infected Arabidopsis plants, PR gene expression from RNA extracts of whole 2‐week‐old Arabidopsis plants of the different PR‐OE Arabidopsis lines examined was also analysed by qRT‐PCR using the conditions above.

ACKNOWLEDGEMENTS

This research was supported by the North Carolina Agricultural Research Service and by funding through the US Department of Agriculture‐National Institute of Food and Agriculture (USDA‐NIFA) grant 2008‐35302‐18824.

REFERENCES

  1. Alexander, D. , Goodman, R.M. , Gut‐Rella, M. , Glascock, C. , Weyman, K. , Friedrich, L. , Maddox, D. , Ahl‐Goy, P. , Luntz, T. , Ward, E. and Ryals, J. (1993) Increased tolerance to two oomycete pathogens in transgenic tobacco expressing pathogen‐related protein 1a. Proc. Natl. Acad. Sci. USA, 90, 7327–7331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alkharouf, N. , Klink, V.P. , Chouikha, I.B. , Beard, H.S. , MacDonald, M.H. , Meyer, S. , Knap, H.T. , Khan, R. and Matthews, B.F. (2006) Timecourse microarray analyses reveals global changes in gene expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines (soybean cyst nematode). Planta, 224, 838–852. [DOI] [PubMed] [Google Scholar]
  3. Bachmann, D. , Rezzonico, E. , Retelska, D. , Chetelat, A. , Schaerer, S. and Beffa, R. (1998) Improvement of potato resistance to Phytophtora infestans by overexpressing antifungal hydrolases. 5th International Workshop on pathogenesis‐related proteins. Signaling pathways and biological activities. 29 March–2 April 1998, Aussois, France. Abstr. P‐57. American Society of Plant Physiologists.
  4. Bowling, S.A. , Guo, A. , Cao, H. , Gordon, A.S. , Klessig, D.F. and Dong, X. (1994) A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell, 6, 1845–1857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao, H. , Bowling, S.A. , Gordon, A.S. and Dong, X. (1994) Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell, 6, 1583–1592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Davis, E.L. , Hussey, R.S. , Mitchum, M.G. and Baum, T.J. (2008) Parasitism proteins in nematode–plant interactions. Curr. Opin. Plant Biol. 11, 360–366. [DOI] [PubMed] [Google Scholar]
  7. Delaney, T.P. , Uknes, S. , Vernooij, B. , Friedrich, L. , Weymann, K. , Negrotto, D. , Gaffney, T. , Gut‐Rella, M. , Kessmann, H. , Ward, E. and Ryals, J. (1994) A central role of salicylic acid in plant disease resistance. Science, 266, 1247–1250. [DOI] [PubMed] [Google Scholar]
  8. Dong, X. (1998) SA, JA, ethylene and disease resistance in plants. Curr. Opin. Plant Biol. 1, 316–323. [DOI] [PubMed] [Google Scholar]
  9. Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytopathol. 42, 185–209. [DOI] [PubMed] [Google Scholar]
  10. Fiocchetti, F. , Caruso, C. , Bertini, L. , Vitii, D. , Saccardo, F. and Tucci, M. (2006) Over‐expression of a pathogenesis‐related protein gene in transgenic tomato alters the transcription patterns of other defence genes. J. Hortic. Sci. Biotechol. 81, 27–32. [Google Scholar]
  11. Gao, B. , Allen, R. , Maier, T. , Davis, E.L. , Baum, T.J. and Hussey, R.S. (2003) The parasitome of the phytonematode Heterodera glycines . Mol. Plant–Microbe Interact. 16, 270–276. [DOI] [PubMed] [Google Scholar]
  12. Gheysen, G. and Mitchum, M.G. (2009) Molecular insights in the susceptible plant response to nematode infection In: Plant Cell Monographs: Cell Biology of Plant Nematode Interactions (Berg R.H. and Taylor C.G., eds), pp. 45–81. Heidelberg: Springer. [Google Scholar]
  13. Goellner, M. , Wang, X. and Davis, E.L. (2001) Endo‐beta‐1,4‐endoglucanase expression in compatible plant nematode interactions. Plant Cell, 13, 2241–2255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hussey, R.S. and Barker, K.R. (1973) A comparison of methods of collecting inocula of Meloidogyne spp., including a new technique. Plant Dis. Rep. 57, 1025–1028. [Google Scholar]
  15. Ithal, N. , Recknor, J. , Nettleton, D. , Hearne, L. , Maier, T. , Baum, T.J. and Mitchum, M.G. (2007a) Parallel genome‐wide expression profiling of host and pathogen during soybean cyst nematode infection of soybean. Mol. Plant–Microbe Interact. 20, 293–305. [DOI] [PubMed] [Google Scholar]
  16. Ithal, N. , Recknor, J. , Nettleton, D. , Maier, T. , Baum, T.J. and Mitchum, M.G. (2007b) Developmental transcript profiling of cyst nematode feeding cells in soybean roots. Mol. Plant–Microbe Interact. 20, 510–525. [DOI] [PubMed] [Google Scholar]
  17. Jammes, F. , Lecomte, P. , de Almeida‐engler, J. , Bitton, F. , Martin‐Magniette, M.L. , Renou, J.P. , Abad, P. and Favery, B. (2005) Genome‐wide expression profiling of the host response to root‐knot nematode infection in Arabidopsis . Plant J. 44, 447–458. [DOI] [PubMed] [Google Scholar]
  18. Jones, M.G.K. (1981) The development and function of plant cells modified by endoparasitic nematodes In: Plant Parasitic Nematodes, Vol. III (Zuckerman B.M. and Rohde R.A., eds), pp. 255–280. New York: Academic Press. [Google Scholar]
  19. Li, Q. , Xie, Q.G. , Smith‐Becker, J. , Navarre, D.A. and Kaloshian, I. (2006) Mi‐1‐mediated aphid resistance involves salicylic acid and mitogen‐activated protein kinase signaling cascades. Mol. Plant–Microbe Interact. 19, 655–664. [DOI] [PubMed] [Google Scholar]
  20. Linthorst, H.J.M. , Meuwissen, R.L.J. , Kauffmann, S. and Bol, J.F. (1989) Constitutive expression of pathogenesis‐related proteins PR‐1, GRP, and PR‐S in tobacco has no effect on virus infection. Plant Cell, 1, 285–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCT method. Methods, 25, 402–408. [DOI] [PubMed] [Google Scholar]
  22. Maleck, K. , Levine, A. , Eulgem, T. , Morgan, A. , Schmid, J. , Lawton, K.A. , Dangl, J.L. and Dietrich, R.A. (2000) The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nat. Genet. 26, 403–410. [DOI] [PubMed] [Google Scholar]
  23. Melchers, L.S. , Lageweg, W. and Stuiver, M.H. (1998) The utility of PR genes to develop disease resistance in transgenic crops. 5th International Workshop on pathogenesis‐related proteins. Signaling pathways and biological activities. 29 March–2 April 1998, Aussois, France. Abstr. P‐46. American Society of Plant Physiologists.
  24. Puthoff, D.P. , Nettleton, D. , Rodermel, S.R. and Baum, T.J. (2003) Arabidopsis gene expression changes during cyst nematode parasitism revealed by statistical analyses of microarray expression profiles. Plant J. 33, 911–921. [DOI] [PubMed] [Google Scholar]
  25. Reuber, T.L. , Plotnikova, J.M. , Dewdney, J. , Rogers, E.E. , Wood, W. and Ausubel, F.M. (1998) Correlation of defense gene induction defects with powdery mildew susceptibility in Arabidopsis enhanced disease susceptibility mutants. Plant J. 16, 473–485. [DOI] [PubMed] [Google Scholar]
  26. Sanz‐Alferez, S. , Mateos, B. , Alvarado, R. and Sanchez, M. (2008) SAR induction in tomato plants is not effective against root‐knot nematode infection. Eur. J. Plant Pathol. 120, 417–425. [Google Scholar]
  27. Seo, P.J. , Lee, A.K. , Xiang, F.N. and Park, C.M. (2008) Molecular and functional profiling of Arabidopsis pathogenesis‐related genes: insights into their roles in salt response of seed germination. Plant Cell Physiol. 49, 334–344. [DOI] [PubMed] [Google Scholar]
  28. Sijmons, P.C. , Grundler, F.M.W. , Von Mende, N. , Burrows, P.R. and Wyss, U. (1991) Arabidopsis thaliana as a new model host for plant parasitic nematodes. Plant J. 1, 245–254. [Google Scholar]
  29. Slusarenko, A.J. , Fraser, R.S.S. and van Loon, L.C. (2000) Mechanisms of Resistance to Plant Diseases. Dordrecht: Kluwer Academic Publisher. [Google Scholar]
  30. Sobczak, M. , Avrova, A. , Jupowicz, J. , Phillips, M.S. , Ernst, K. and Kumar, A. (2005) Characterization of susceptibility and resistance responses to potato cyst nematode (Globodera spp.) infection of tomato lines in the absence and presence of the broad‐spectrum nematode resistance Hero gene. Mol. Plant–Microbe Interact. 18, 158–168. [DOI] [PubMed] [Google Scholar]
  31. Staswick, P.E. , Yuen, G.Y. and Lehman, C.C. (1998) Jasmonate signaling mutants of Arabidopsis are susceptible to the soil fungus Pythium irregulare . Plant J. 15, 747–754. [DOI] [PubMed] [Google Scholar]
  32. Szakasits, D. , Heinen, P. , Wieczorek, K. , Hofmann, J. , Wagner, F. , Kreil, D. , Sykacek, P. , Grundler, F.M.W. and Bohlmann, H. (2009) The transcriptome of syncytia induced by the cyst nematode Heterodera schachtii in Arabidopsis roots. Plant J. 57, 771–784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tao, Y. , Xie, Z. , Chen, W. , Glazebrook, J. , Chang, H.S. , Han, B. , Zhu, T. , Zou, G. and Katagiri, F. (2003) Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae . Plant Cell, 15, 317–330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Thomma, B.P.H.J. , Eggermont, K. , Penninckx, I.A.M.A. , Mauch‐Mani, B. , Vogelsang, R. , Cammue, B.P.A. and Broekaert, W.F. (1998) Separate jasmonate‐dependent and salicylate‐dependent defense‐response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl. Acad. Sci. USA, 95, 15 107–15 111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Thomma, B.P.H.J. , Penninckx, I.A.M.A. , Broekaert, W.F. and Cammue, B.P.A. (2001) The complexity of disease signaling in Arabidopsis . Curr. Opin. Immunol. 13, 63–68. [DOI] [PubMed] [Google Scholar]
  36. Uknes, S. , Winter, A.M. , Delaney, T. , Vernooij, B. , Morse, A. , Friedrich, L. , Nye, G. , Potter, S. , Ward, E. and Ryals, J. (1993) Biological induction of systemic acquired resistance in Arabidopsis . Mol. Plant–Microbe Interact. 6, 692–698. [Google Scholar]
  37. Van Loon, L.C. , Rep, M. and Pieterse, C.M.J. (2006) Significance of inducible defense‐related proteins in infected plants. Annu. Rev. Phytopathol. 44, 135–162. [DOI] [PubMed] [Google Scholar]
  38. Vijayan, P. , Shockey. J. , Levesque, C.A. , Cook, R.J. and Browse, J. (1998) A role for jasmonate in pathogen defense of Arabidopsis . Proc. Natl. Acad. Sci. USA, 95, 7209–7214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Wubben, M.J.E. , Jin, J. and Baum, T.J. (2008) Cyst nematode parasitism of Arabidopsis thaliana is inhibited by salicylic acid (SA) and elicits uncoupled SA‐independent pathogenesis‐related gene expression in roots. Mol. Plant–Microbe Interact. 21, 424–432. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES