Abstract
Objective
IL‐1 receptor‐like 1 (IL1RL1) and thymic stromal lymphopoietin (TSLP) play important roles in asthma in various ways. IL1RL1 rs3771180 and TSLP rs1837253 single nucleotide polymorphisms (SNPs) are associated with asthma in some European nationals but not in Zhuang people. Accordingly, this study aimed to determine the associations of IL1RL1 rs3771180 and TSLP rs1837253 with asthma in Zhuang people.
Methods
We performed a case‐control study to observe the association between the two polymorphisms and asthma in a Guangxi Zhuang cohort consisting of 123 asthmatic patients and 100 healthy controls. These individuals were recruited from the Department of Respiration of the First Affiliated Hospital of Guangxi Medical University. Multiplex PCR assay was used to identify the genotype of rs3771180 and rs1837253. Data were analyzed with SPSS 22.0 and SHEsis.
Results
rs1837253 showed significant differences between asthmatic and control groups in allele comparison (OR = 2.15; 95% CI = 1.27‐3.63; P = 0.004), as well as in the homozygote (OR = 4.83; 95% CI = 1.47‐16.47; P = 0.012), heterozygote (OR = 2.69; 95% CI = 1.20‐6.00; P = 0.016), and dominant (OR = 3.01; 95% CI = 1.39‐6.52; P = 0.005) genetic models. However, the genotype frequencies of rs3771180 did not obviously differ.
Conclusion
rs1837253 is associated with asthma susceptibility and may increase the risk of asthma in Zhuang people in Guangxi.
Keywords: asthma, IL1RL1, polymorphism, TSLP, Zhuang population
1. INTRODUCTION
Asthma is a complex disorder characterized by hyper‐responsiveness and chronic airway inflammation. The disease is often manifested by wheezing, shortness of breath, chest tightness, coughing, and reversible airflow limitation over time. The prevalence of asthma has significantly increased worldwide and highly contributes to incidence and medical costs. More than 300 million people suffer from asthma, and the disease still claims 346 000 lives every year.1 Moreover, the prevalence of asthma is believed to be higher in low‐income countries.2 Several factors account for asthma, including infection, neuromodulation, and genetics. However, the specific pathogenesis of asthma remains unclear. As a polygene hereditary disease, an increasing number of studies are focusing on genetic factors, with some studies suggesting that numerous genes are associated with asthma, and different gene variants are involved among different ethnic groups.3
Genome‐wide association studies (GWAS), a genetic approach to identifying complex traits, have discovered some variants on the IL‐1 receptor‐like 1 (IL1RL1) and thymic stromal lymphopoietin (TSLP) genes are associated with asthma. The IL1RL1 gene, also known as ST2, is a potential candidate gene for asthma and atopy. A GWAS for eosinophil counts related to sequence variants discovered a variant (rs1420101), and the first locus associated with asthma on the IL1RL1 gene was found in 9392 Icelanders and was successfully replicated in 12 118 Europeans and 5212 East Asians (P = 5.3 × 10−14).4 As a member of the Toll‐IL‐1 receptor superfamily, IL1RL1 is a receptor on mast and Th2 cells and also exists in serum in a soluble form. The complex formed by soluble IL1RL1 and IL‐33 regulates Th2 cells through Toll‐like receptor pathways to play an important role in the development and progression of asthma.5 The TSLP gene encodes a cytokine released from infected airway epithelial cells, which is bound up with inflammation response by activating T cells. The overexpression of TSLP protein can be found in the epithelium and lamina propria of the airway of asthmatic patients, especially in severe ones.6 By far, substantial research has indicated that IL1RL1 and TSLP are critical to the immune pathogenesis of asthma.
Single nucleotide polymorphisms (SNPs) located in the IL1RL1 and TSLP genes have recently been authenticated to be evidently associated with asthma among different races, such as Europeans and Africans.7 A variant (rs1420101) in IL1RL1 is related to asthma among nine European and one East Asian sample set (P = 5.5 × 1012),4 but shows weak association with the disease among Australians (P = 0.46).8 Another SNP (rs1837253) located in TSLP is a locus of protection from asthma with a P value of 0.0058.9 But two variants (rs2289276 and rs2289278) in the TSLP gene have been demonstrated to be related to asthma among the Chinese Han population.10 The genetic background of various peoples differs because of their ethnic customs and habits. Therefore, verifying an SNP in different ethnic groups and identifying various loci in a candidate gene are necessary. In view of the new trend in asthma GWAS, some relative genetic researches on asthma among the Chinese population have concentrated on Han people but only a few has paid attention to the Zhuang population in Guangxi. This ethnic group lives in southern China and comprises about 15 million of the population. Their lifestyle is extremely unique because of endogamy. They have the least contact with the outside world because of their uniqueness and geographical location. Two variants (rs3771180 in IL1RL1 and rs1837253 in TSLP) associated with asthma among North Americans3 have never been replicated in Zhuang people. Therefore, this research aims to identify the relationship between the two variants and asthma and the two variants' related phenotypes among the Zhuang population from Guangxi.
2. MATERIALS AND METHODS
2.1. Subjects
A total of 123 asthmatic patients and 100 healthy controls were recruited in this study. All patients were diagnosed based on the Global Initiative for Asthma (2008). The controls had no history of allergic diseases, including asthma, allergic rhinitis, and atopic eczema. Both groups were recruited from the Department of Respiration in the First Affiliated Hospital of Guangxi Medical University, Guangxi, China, from February 2010 to April 2013. All participants were not of kin, and three or more than three generations are Zhuang people. The Ethics Committee of the First Affiliated Hospital, Guangxi Medical University, approved the study, and informed consent was obtained from all participants.
2.2. DNA extraction and genotyping
Peripheral blood was collected in EDTA‐treated evacuated tubes. Genomic DNA was extracted using a Blood DNA extract kit (Tiangen) and then stored at −80°C for genotype analysis.
Primers were designed using Primer3 Online, with technical support from the Shanghai Biowing Applied Biotechnology Company. The primer sequences are shown in Table 1. The destination DNA sequences were amplified via the multiplex PCR method on a 20 µL reaction comprising 1 µL of genomic DNA, 2 µL of buffer, 0.6 µL of Mg2+ (3.0 mmol/L), 2 µL of dNTP (2.0 mmol/L), 0.2 µL of 1 U Taq enzyme, 12.2 µL of ddH2O, and 2 µL of primer mixture. The amplification was performed using a GeneAmp PCR system 9600 with a pre‐denaturation at 95°C for 2 minutes and then 40 cycles of denaturation at 94°C for 30 seconds, annealing at 53°C for 90 seconds, and extensions at 65°C for 30 seconds and for 10 minutes. For multiple LDR reaction, 4 µL of multiplex PCR product, comprising 1 µL of buffer, 1 µL of each probe mix (2 pmol/µL; probe sequences are listed in Table 2), 0.05 µL Taq DNA ligase (2 U), and 4 µL ddH2O, was used. The fluorescent products of LDR were distinguished via an ABI sequencer 3730.
Table 1.
Primer DNA sequences of two SNPs
| Primer name | Upper | Lower | PCR length |
|---|---|---|---|
| rs3771180 | TGGCCAAATCTATGACTTGTT | TCCTCTCAAGGGATTACTCAATG | 116 |
| rs1837253 | AGGGCTACCCCTTGACTCAC | CCAACCAGGATTTGCAAGAA | 136 |
Table 2.
Probe sequences of LDR
| Probe | Sequence (5′‐3′) | LDR length |
|---|---|---|
| rs3771180_modify | P‐CACCAGCATTTTTGAACAAGTCATATTTTTTTTTTTTTTTT | |
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT‐FAM | ||
| rs3771180_A | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | 155 |
| TTTTTTTTACATCAAGAATTCTTAGTACATGATT | ||
| rs3771180_C | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | 157 |
| TTTTTTTTTTTACATCAAGAATTCTTAGTACATGATG | ||
| rs1837253_modify | P‐TTGTTTATGTATAAAAGGATCTTTTTTTTTTTTTTTTTTTTT | |
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT‐FAM | ||
| rs1837253_C | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | 175 |
| TTTTTTTTTTTTTTTTTTTTTGTAATTTGCTTCATAGTTTAGACACG | ||
| rs1837253_T | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | 177 |
| TTTTTTTTTTTTTTTTTTTTTGTAATTTGCTTCATAGTTTAGACACA |
2.3. Statistical analysis
The gene frequency distribution in the control group was tested via the Hardy‐Weinberg equilibrium, and the comparison of genotype frequencies between the cases and controls was confirmed via the chi‐square test. The pertinence among the genetic models (variant allele, homozygote and heterozygote genotypes, and dominant and recessive models) of the two SNPs and asthma was unveiled via logistic regression analysis. The odds ratios (OR) with corresponding 95% confidence intervals (CI) were calculated. Statistical significance was set at P < 0.05 (two‐tailed), and statistical analyses were conducted using SPSS software version 22.0 with adjustments in sex, age, and weight (Table 5). Allelic association analysis in a replication study was performed via the SHEsis (http://www.bio-x.cn/analysis/).
Table 5.
The relativity between loci and asthma in different genetic models
| SNP | Genetic model | OR* | 95% CI* | P * |
|---|---|---|---|---|
| rs3771180 | ||||
| A/C | 1.820 | 0.505‐6.552 | 0.360 | |
| AA/CC | — | — | — | |
| AC/CC | 1.873 | 0.506‐6.934 | 0.348 | |
| AA+AC/CC | 1.873 | 0.506‐6.934 | 0.348 | |
| AA/AC+CC | — | — | — | |
| rs1837253 | ||||
| C/T | 2.147 | 1.268‐3.633 | 0.004 | |
| CC/TT | 4.831 | 1.417‐16.468 | 0.012 | |
| CT/TT | 2.686 | 1.202‐6.001 | 0.016 | |
| CC+CT/TT | 3.007 | 1.387‐6.517 | 0.005 | |
| CC/CT+TT | 2.712 | 0.884‐8.316 | 0.081 |
Adjustments for sex, age, and weight.
3. RESULTS
3.1. Characteristics of subjects
The genders and weights of the case and control subjects were well matched (P ＞ 0.05), but the patients in this study were nearly 10 years older than the control subjects (P ＜ 0.05; Table 3).
Table 3.
Characteristics of control subjects and cases
| Group | Cases (n = 123) | Control subjects (n = 100) | P |
|---|---|---|---|
| Gender | |||
| Male | 50 (40.7%) | 52 (52.0％) | 0.091 |
| Female | 73 (59.3％) | 48 (48.0％) | |
| Age (y) | 39.06 ± 12.33 | 28.34 ± 3.31 | 0.000 |
| Weight (kg) | 54.98 ± 10.31 | 55.48 ± 10.00 | 0.736 |
3.2. Genotype and allele frequencies of SNPs
The genotype data from rs3771180 and rs1837253 of the control group were consistent with the Hardy‐Weinberg equilibrium (P values were 0.677 and 0.618, respectively). The genotypic distributions of the loci, as shown in Table 4, demonstrated that a statistical difference exists between the case and control groups in terms of rs1837253 but not for rs3771180. The contributions of genetic polymorphisms to asthma were demonstrated by comparing the genetic models of two loci (Table 5). Figures indicated that rs1837253 was correlated with asthma. All genetic models of rs1837253 showed evident association with asthma except for the recessive model (OR = 2.71; 95% CI = 0.88‐8.32, P = 0.081). Results are as follows: allele comparison (OR = 2.15; 95% CI = 1.27‐3.63; P = 0.004); homozygote genotype comparison (OR = 4.83; 95% CI = 1.47‐16.47; P = 0.012); heterozygote genotype comparison (OR = 2.69; 95% CI = 1.20‐6.00; P = 0.016); and dominant model comparison (OR = 3.01; 95% CI = 1.39‐6.52; P = 0.005). Each genetic model of rs3771180 had no correlation with asthma (P ＞ 0.05).
Table 4.
The genotypic distributions of the SNPs
| SNPs ID | Genotype | Cases (n = 123) | Control (n = 100) | χ 2 | P |
|---|---|---|---|---|---|
| rs3771180 | 1.491 | 0.222 | |||
| CC | 106 (86.89) | 92 (92.00) | |||
| AC | 16 (13.11) | 8 (8.00) | |||
| AA | 0 (0.00) | 0 (0.00) | |||
| rs1837253 | 13.469 | 0.001 | |||
| TT | 30 (24.60) | 48 (48.00) | |||
| CT | 69 (56.60) | 41 (41.00) | |||
| CC | 23 (18.90) | 11 (11.00) |
4. DISCUSSION
To the best of our knowledge, this study is the first to focus on the genetic associations between SNPs in TSLP and IL1RL1 and asthma among the Zhuang population in Guangxi. We found that rs1837253 was significantly associated with asthma patients, whereas rs3771180 showed no difference between patients and controls not only in genotype and allele frequencies but also in the different genetic models.
Substantial research has shown significant genetic associations between the two loci and asthma in distinctive ethnicities. A SNP (rs3771180), located at the IL1RL1 proximal promoter, was found to be associated with atopic asthma among French Canadians and ordinary asthma among European Americans, African Americans, and Latin Americans3, 11 and related to asthma and hay fever in Swedish twins.12 No research has been conducted on this locus among Asian populations. In contrast to findings from previous studies, our research demonstrated no association between rs3771180 and asthma among Zhuang people. For rs1837253, presenting the upstream of the transcription start site of the TSLP gene showed a significant association with adult asthma among the Japanese population (P = 0.023).13 Jian‐Qing H found that the A allele of rs1837253 was associated with protection from asthma and airway hyper‐responsiveness among Canadian and Australian populations, whereas Bunyavanich discovered that the T allele of rs1837253 was inversely associated with allergic rhinitis in boys with asthma in Costa Rica.14 Interestingly, a study in Costa Rica showed that the T allele of rs1837253 was associated with a reduced risk of asthma in men, but the T allele of another TSLP SNP rs2289276 was associated with a reduced risk of asthma in women.15 As in the previous experiments, we obtained the same results; rs1837253 was associated with asthma susceptibility and may increase the risk of asthma among Zhuang people. Analyzing the risk and protective mutant alleles was difficult because of the lack of SNP haplotype profiles.
As is usually the case in studies of this sort, results are inconsistent with other studies possibly because of small samples, technology hiccups, and the distinction of ethnic groups. In general, the result of a study is better when the sample size is increased. However, we can only contact some of the Zhuang people. Moreover, whether these patients can represent the Zhuang population and whether the sample size is large enough are unclear. Furthermore, experimental error and data dealing error are inevitable incidents. The differences between Zhuang people and other nationalities reflect the contrast of genes among ethnic groups in various environments, with diverse genetic backgrounds and social and cultural habits. In summary, a larger sample is necessary for a better GWAS.
Although several GWAS allow us to recognize the polymorphisms of most genes, we still do not know the specific functions or biologic effects of these loci on disease pathogenesis. Asthma‐associated SNPs can reportedly achieve functional alterations in some pathways through several mechanisms, such as changing the level of mRNA expression or altering protein functions via amino acid substitutions. Shimizu et al16 validated functional SNP rs6543116 in the ST2 distal promoter region regulating ST2 expression, which activated the Th2 response. IL1RL1 gene SNP rs11693697 played its biologic role primarily by regulating IL1RL1 mRNA levels.17 In Brazilians, the A allele of IL1RL1 rs1041973 was positively associated with IL‐5 production and Ig E levels; expression quantitative trait loci analysis also suggested that polymorphism regulated the expression of the IL1RL1 gene via amino acid substitution.18 TSLP SNP rs1837253 showed correlation with TSLP protein secretion in human nasal epithelium but not with TSLP mRNA levels.19, 20 In recent years, a new technology called Hi‐C has been widely applied by researchers worldwide to reveal various epigenomic mechanisms of various diseases. This technology can potentially be used for asthma pathogenesis.
In conclusion, TSLP rs1837253 was successfully duplicated among Zhuang people in our study, whereas replication of IL1RL1 rs3771180 was unsuccessful. This study had limited samples, and experimental errors were still observed; thus, further studies and larger samples are necessary for future replication.
Sun Y, Wei X, Deng J, et al. Association of IL1RL1 rs3771180 and TSLP rs1837253 variants with asthma in the Guangxi Zhuang population in China. J Clin Lab Anal. 2019;33:e22905 10.1002/jcla.22905
Funding information
Guangxi Natural Science Foundation (2017GXNSFAA198104). Young and Middle Teachers' Basic Capacity Improvement Project of Guangxi Higher Education Institutions (2017KY0101). Middle Teachers' Basic Capacity Improvement Project of Guangxi Higher Education Institutions (2018KY0137).
Yan Sun and Xuan Wei are co‐first authors.
REFERENCES
- 1. Lozano R, Naghavi M, Foreman K, et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. The Lancet. 2012;380(9859):2095‐2128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Cruz ÁA, Stelmach R, Ponte EV. Asthma prevalence and severity in low‐resource communities. Curr Opin Allergy Clin Immunol. 2017;17(3):188‐193. [DOI] [PubMed] [Google Scholar]
- 3. Torgerson DG, Ampleford EJ, Chiu GY, et al. Meta‐analysis of genome‐wide association studies of asthma in ethnically diverse North American populations. Nat Genet. 2011;43(9):887‐892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Gudbjartsson DF, Bjornsdottir US, Halapi E, et al. Sequence variants affecting eosinophil numbers associate with asthma and myocardial infarction. Nat Genet. 2009;41(3):342‐347. [DOI] [PubMed] [Google Scholar]
- 5. Brint EK, Xu D, Liu H, et al. ST2 is an inhibitor of interleukin 1 receptor and Toll‐like receptor 4 signaling and maintains endotoxin tolerance. Nat Immunol. 2004;5(4):373‐379. [DOI] [PubMed] [Google Scholar]
- 6. Shikotra A, Choy DF, Ohri CM, et al. Increased expression of immunoreactive thymic stromal lymphopoietin in patients with severe asthma. J Allergy Clin Immunol. 2012;129(1):104. [DOI] [PubMed] [Google Scholar]
- 7. Demenais F, Margaritte‐Jeannin P, Barnes KC, et al. Multiancestry association study identifies new asthma risk loci that colocalize with immune‐cell enhancer marks. Nat Genet. 2018;50(1):42‐53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Ferreira M, McRae AF, Medland SE, et al. Association between ORMDL3, IL1RL1 and a deletion on chromosome 17q21 with asthma risk in Australia. Eur J Hum Genet. 2011;19(4):458‐464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. He J‐Q, Hallstrand TS, Knight D, et al. A thymic stromal lymphopoietin gene variant is associated with asthma and airway hyperresponsiveness. J Allergy Clin Immunol. 2009;124(2):222‐229. [DOI] [PubMed] [Google Scholar]
- 10. Liu W, Xu L‐S, Liu Q‐J, et al. Two single nucleotide polymorphisms in TSLP gene are associated with asthma susceptibility in Chinese Han population. Exp Lung Res. 2012;38(8):375‐382. [DOI] [PubMed] [Google Scholar]
- 11. Lavoiecharland E, Bérubé JC, Boulet LP, Bossé Y. Asthma susceptibility variants are more strongly associated with clinically similar subgroups. J Asthma Res. 2016;53(9):907‐913. [DOI] [PubMed] [Google Scholar]
- 12. Ullemar V, Magnusson P, Lundholm C, et al. Heritability and confirmation of genetic association studies for childhood asthma in twins. Allergy. 2016;71(2):230. [DOI] [PubMed] [Google Scholar]
- 13. Hirota T, Takahashi A, Kubo M, et al. Genome‐wide association study identifies three new susceptibility loci for adult asthma in the Japanese population. Nat Genet. 2011;43(1):17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Bunyavanich S, Soto-Quiros M, Avila L, et al. ATS 2010 International Conference New Orleans, May 14–19, 2010. NY Am J Respir Crit Care Med. 2010;181:A1331. [Google Scholar]
- 15. Hunninghake GM, Soto‐Quirós ME, Avila L, et al. TSLP polymorphisms are associated with asthma in a sex‐specific fashion. Allergy. 2010;65(12):1566‐1575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Shimizu M, Matsuda A, Yanagisawa K, et al. Functional SNPs in the distal promoter of the ST2 gene are associated with atopic dermatitis. Hum Mol Genet. 2005;14(19):2919. [DOI] [PubMed] [Google Scholar]
- 17. Grotenboer NS, Ketelaar ME, Koppelman GH, Nawijn MC. Decoding asthma: translating genetic variation in IL33 and IL1RL1 into disease pathophysiology. J Allergy Clin Immunol. 2013;131(3):856‐865.e9. [DOI] [PubMed] [Google Scholar]
- 18. Sr G, Costa RS, Carneiro VL, et al. IL1RL1 variants rs1041973 and rs873022 are associated with allergy markers and soluble ST2 production in a Brazilian population. J Allergy Clin Immunol. 2017;139(2):AB4. [Google Scholar]
- 19. Hui CC, Yu A, Heroux D, et al. Thymic stromal lymphopoietin (TSLP) secretion from human nasal epithelium is a function of TSLP genotype. Mucosal Immunol. 2014;8(5):AB100. [DOI] [PubMed] [Google Scholar]
- 20. Li X, Hastie AT, Hawkins GA, et al. eQTL of bronchial epithelial cells and bronchial alveolar lavage deciphers GWAS‐identified asthma genes. Allergy. 2015;70(10):1309‐1318. [DOI] [PMC free article] [PubMed] [Google Scholar]