Skip to main content
3 Biotech logoLink to 3 Biotech
. 2019 Jul 22;9(8):301. doi: 10.1007/s13205-019-1828-z

Transcriptomic profiles of human HaCaT cells in response to angelica polysaccharide

Chunshui Yu 1,, Linli Liu 1, Qian Liao 1, Hanwen Wang 1, Fei Ouyang 1, Hui Fang 1, Yan Wan 1, Qinlian Lu 1, Tingting Liu 1
PMCID: PMC6646613  PMID: 31355110

Abstract

The aim of this study was to explore the anti-psoriatic effect and potential mechanism of Angelica polysaccharide (APS) on an in vitro HaCaT cell model. MTS assay was performed to determine whether APS has the ability to inhibit the proliferation of HaCaT cells. RNA-sequencing (RNA-seq) was performed to investigate the underlying mechanism of APS. Quantitative real-time PCR (qRT-PCR) was used to verify the accuracy of RNA-seq data. Our MTS assay results demonstrated that APS time- and concentration-dependently inhibits the proliferation of HaCaT cells. The anti-proliferation property of APS suggests that APS may have anti-psoriatic effect. In the RNA-seq part, comparison between the CK group (i.e., Control group) and ASP groups revealed dramatic differences [468 differentially expressed genes (DEGs) for CK group vs. ASP50 group; 563 DEGs for CK group vs. ASP100 group; 532 DEGs for CK group vs. ASP200 group]. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrich analysis performed on all DEGs failed to find any significant enriched GO terms or KEGG pathways to explain the anti-proliferative effect of APS. All DEGs were then classified into 20 expression profiles by trend analysis. Interestingly, cell proliferation-related GO terms were mostly dispersed in the profile 2 and 17. DEGs enriched in these terms were then analyzed. After literature retrieval, DEGs such as SERPINE1, SMAD6, CTGF, and TGF-β were suspected to closely relevant to the anti-proliferation effect of APS. qRT-PCR results showed similar expression trend with RNA-seq data for 8 out of 10 genes, indicating our sequence data are reliable.

Electronic supplementary material

The online version of this article (10.1007/s13205-019-1828-z) contains supplementary material, which is available to authorized users.

Keywords: Angelica polysaccharide, Psoriasis, Transcriptome

Introduction

Psoriasis is a chronic inflammatory skin disease of unknown etiology, characterized by keratinocyte hyper-proliferation, presence of inflammatory cell infiltrate and neovascularization. Psoriasis affects about 2% of the general population and imposes substantial negative effects on patients’ quality of life because of its annoying symptoms such as pruritus, pain, redness, scaling, flaking and bleeding (Qu et al. 2014). Currently, there are many treatment options for psoriasis (Kushwaha 2017); however, none of them offers the opportunity to cure the disease. Conventional western medications, such as methotrexate, ciclosporin, and retinoids, have been widely used for treatment of psoriasis; unfortunately, they are limited for long-term use due to their potential toxic and side effects (Li et al. 2017; Keseroglu and Gönül 2014). Therefore, looking for safe and effective treatment methods for psoriasis is a critical public concern worldwide.

Traditional Chinese medicine (TCM) formulas have been widely used for treatment of psoriasis in China (Zhang et al. 2014; Farahnik et al. 2017); however, owing to their inherent characteristics, such as complex ingredients and unclear mechanism, the clinical use of TCM was questioned by lots of people. On the contrary, active components from TCM usually have less composition than formulas, making them more acceptable to users. Angelica polysaccharide (APS) is one of the most major active components isolated from the root of Angelica sinensis. Recent evidences suggested that APS may have therapeutic potential for psoriasis. For instance, Jing et al. demonstrated APS can increase apoptosis in psoriasis-like lesions of guinea pigs (Jing and Sheng 2006). Wang et al. reported that APS can alleviate LPS-induced HaCaT cell inflammatory injury (Wang et al. 2019).

The immortalized human keratinocyte cell line HaCaT was commonly used as an in vitro model to study psoriasis (Liang et al. 2017). In the present study, we used different concentrations of APS to detect the effect of APS on the proliferation of HaCaT cells; after then, RNA-sequencing (RNA-seq) was performed to further investigate the underlying mechanism of APS.

Materials and methods

Cell proliferation assay

HaCaT cells, purchased from ATCC (Teddington, UK), were cultured in minimum Eagle’s medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum and 1% penicillin–streptomycin at 37 °C in a 5% CO2 humidified environment. APS (yellowish amorphous powder, purity ≥ 95%), purchased from Ci Yuan Biotechnology Co., Ltd (Xi’an, Shanxi, China) and dissolved in phosphate buffered saline (PBS), was added to HaCaT cells at final concentrations of 50 mg/L (ASP50 group), 100 mg/L (ASP100 group) and 200 mg/L (ASP200 group), respectively. Same volume of PBS was added in the Control group (CK group). 12 h, 24 h and 36 h after stimulation, MTS assay [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt] was performed according to the manufacturer’s instructions to determine the effect of APS on the proliferation of HaCaT cells. The optical density (OD) value for each sample, determined in triplicate, was recorded at 490 nm using the Multiscan MK3 spectrophotometric microplate reader (Thermo Fisher Scientific, Waltham, MA, USA).

Sample preparation and RNA-seq

HaCaT cells were cultured as the above-mentioned method and stimulated with PBS and APS solutions (50 mg/L, 100 mg/L and 200 mg/L) for 36 h, respectively. After then, cells were collected and cryopreserved for further studies including RNA-seq and quantitative real-time PCR (qRT-PCR). RNA extraction, library construction and sequencing were performed by the Guangzhou Gene Denovo Co. (Guangzhou, China) as previously described (Huang et al. 2017).

RNA-seq data analysis

RNA-seq data analysis was performed as previously described (Huang et al. 2017). Briefly, raw reads were filtered using the FASTX Toolkit to remove reads that containing adaptors, reads that containing more than 10% of ambiguous nucleotides, and reads with low-quality that containing > 50% of bases with Q ≤ 20. Furthermore, clean reads were mapped to the ribosomal RNA (rRNA) database to remove rRNA mapped reads using the Bowtie2 tool. The remaining clean reads were then mapped to the reference genome by the TopHat2 tool. The reconstruction of transcripts was carried out with the Cufflinks software, together with the TopHat2 tool. The gene expression level was normalized using the fragments per kilobase of transcript per million mapped reads (FPKM) method. Genes with fold-change ≥ 2 and a false discovery rate (FDR) of < 0.05 were identified as significant differentially expressed genes (DEGs) using the edgeR package. The Short Time-series Expression Miner (STEM, version 1.2.2b) software was used to cluster DEGs. Profiles with P ≤ 0.05 were considered significantly enriched. All DEGs and DEGs in the significant trend were then subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.

Quantitative real-time PCR

To further confirm the results of RNA-seq, ten genes were selected for qRT-PCR analysis. Primers used for all tested genes are listed in Table 1. qRT-PCR was performed using the ABI Step One Plus Detection system (Applied Biosystems, Waltham, MA, USA) with the following condition: denaturation at 95 °C for 90 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 15 s and 72 °C for 20 s. GAPDH was used as the reference gene. Relative gene expression level was calculated using the comparative 2−△△Ct method.

Table 1.

Primers used for quantitative real-time PCR

Genes Sequence
HIST1H2BD
 Forward CGGCATCTCTTCCAAGGCAA
 Reverse AGAGCCTTTGGGATTAGGTGTA
HIST1H2BC
 Forward CCCGACACTGGCATCTCTT
 Reverse TGGAGCTGGTGTACTTGGTGA
CD74
 Forward GACAGTCACCTCCCAGAACC
 Reverse CCATACTTGGTGGCATTCTG
HIST1H2AE
 Forward GTGCTGGAATATCTGACGGC
 Reverse AGTAATCATTTCACTTGCCCTTG
HIST1H3H
 Forward CTACCAGAAGTCCACCGAGC
 Reverse ATGATAGTCACCCGCTTGGC
CSF2
 Forward TAAAGTTCTCTGGAGGATGTGG
 Reverse TACTCAGGTTCAGGAGACGC
HSPA1A
 Forward GGGCCTTTCCAAGATTGCTG
 Reverse AGAAATAGTCGTAAGATGGCAGTA
PLAT
 Forward CCTGTCAAAAGTTGCAGCGAG
 Reverse CAGCACTTCCCAGCAAATCC
IGFBP3
 Forward TTTGTGACTTAGGCGGCTGT
 Reverse TCCAATAGTCCCCAAGCAGTA
NUPR1
 Forward GGAAAGGTCGCACCAAGA
 Reverse GCCTCATCTCCAGCTCTGTC
GAPDH
 Forward CGGGAAACTGTGGCGTGA
 Reverse GTGCTCAGTGTAGCCCAGGAT

HIST1H2BD histone cluster 1 H2B family member D, HIST1H2BC histone cluster 1 H2B family member C, CD74 cluster of differentiation 74, HIST1H2AE histone cluster 1 H2A family member E, HIST1H3H histone cluster 1 H3 family member H, CSF2 colony stimulating factor 2, HSPA1A heat shock protein family A (Hsp70) member 1A, PLAT plasminogen activator, tissue type, IGFBP3 insulin like growth factor binding protein 3, NUPR1 nuclear protein 1, transcriptional regulator, GAPDH glyceraldehyde-3-phosphate dehydrogenase

Statistical analysis

MTS and qRT-PCR results are presented as the mean ± SD. Groups were compared with one-way analysis of variance (One-way ANOVA) using the SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). Differences were considered to be significant when P value < 0.05.

Results

APS time- and concentration-dependently inhibits the proliferation of HaCaT cells

Figure 1 shows the MTS results of different concentrations of APS on cultured HaCaT cells. From the results we can see that, APS exhibited significant anti-proliferative effect on HaCaT cells and this effect was time- and concentration-dependent. The inhibitory effect was most obvious at 36 h after stimulation; therefore, in the present study, this time point was chosen for the following experiments to explore the underlying mechanism of APS.

Fig. 1.

Fig. 1

APS time- and concentration-dependently inhibits the proliferation of HaCaT cells. Cell proliferation was determined by MTS assay. Data are presented as mean ± SD. **P < 0.01, compared with the CK group; △△P < 0.01, compared with the ASP50 group; ★★P < 0.01, compared with the ASP100 group

RNA-Seq data evaluation

The samples in the CK group and three APS treated groups were named CK-1, CK-2, CK-3, APS50-1, APS50-2, APS50-3, APS100-1, APS100-2, APS100-3, APS200-1, APS200-2, APS200-3, respectively. The major sequencing information for the 12 samples is summarized in Table 2. After filtering the raw reads, over 50 million clean reads were obtained per sample. Over 89% of clean reads were mapped to the reference genome. More than 14,000 genes containing over 800 new genes were obtained for each sample. Results from principal component analysis (PCA) and Pearson’s correlation coefficient analysis indicated that our RNA-Seq data were suitable for further analysis (Figure not shown).

Table 2.

Major sequencing information for each sample

Group Sample Clean reads Mapped ratio (%) All genes New genes Known genes
CK CK-1 56,457,592 89.0 14,879 815 14,064
CK-2 50,463,680 89.2 14,816 809 14,007
CK-3 57,959,838 89.2 14,914 825 14,089
APS50 APS50-1 60,694,838 90.3 14,672 820 13,852
APS50-2 53,102,402 90.3 14,615 801 13,814
APS50-3 57,190,644 90.8 14,622 818 13,804
APS100 APS100-1 56,230,804 90.0 14,695 816 13,879
APS100-2 56,218,244 90.3 14,649 813 13,836
APS100-3 66,590,600 90.2 14,767 821 13,946
APS200 APS200-1 53,346,416 90.4 14,618 809 13,809
APS200-2 54,468,214 90.3 14,632 817 13,815
APS200-3 54,298,784 90.5 14,701 807 13,894

CK, Control; ASP50, 50 mg/L ASP; ASP100, 100 mg/L ASP; ASP200, 200 mg/L ASP

Differentially expressed genes in all test groups

To compare the differential expression levels of genes between the CK group and all APS groups, up and down-regulated gene numbers were calculated (Fig. 2a). A total of 468 DEGs, including 52 up-regulated and 416 down-regulated genes, were identified in the comparison between the CK group and the APS50 group. Similarly, 563 DEGs, including 68 up-regulated and 495 down-regulated genes, were identified in the comparison between the CK group and the APS100 group. There were 532 DEGs, of which 49 were up-regulated and 483 were down-regulated, in the comparison between the CK group and the APS200 group. All DEGs are summarized in the supplemental Table S1. On the basis of the gene expression, a venn diagram was constructed and a total of 891 DEGs were identified in the three comparisons (Fig. 2b).

Fig. 2.

Fig. 2

Analysis of DEGs between test groups. a DEGs’ distribution between groups; b Venn diagram constructed with DEGs generated from the comparisons between the CK group and ASP groups

GO and KEGG pathway enrichment analysis of all differentially expressed genes

GO and KEGG pathway enrichment analysis were performed for all DEGs. In the GO enrichment analysis, DEGs were assigned into three categories: cellular component, molecular function, and biological process. The GO terms “cellular process”, “single-organism process” and “metabolic process” were most frequently enriched in biological process; “binding”, “catalytic activity” and “molecular transducer activity” represented the major proportion of the molecular function categories; while “cell”, “cell part” and “organelle” were most enriched in the cellular component. Among these subcategories, thirty five terms were significantly enriched, including 28 for biological process, two for molecular function and five for cellular component. Interestingly, some significantly enriched GO terms in the biological process were related to immune response, such as “mucosal immune response” (GO:0002385), “organ or tissue-specific immune response” (GO:0002251) and “immune response” (GO:0006955). Other GO terms, such as “regulation of cytokine production” (GO:0001817) and “negative regulation of cytokine production” (GO:0001818), were related to the process of cytokine production. Genes enriched in these terms may contribute to the immunomodulatory effect of APS (Supplemental Table S2).

To further investigate the function of these DEGs, KEGG enrichment analysis was performed, and pathways with Q value ≤ 0.05 were considered significantly enriched. Overall, 281 DEGs were assigned to KEGG pathways and 7 KEGG pathways were significantly enriched, including “Systemic lupus erythematosus” (ko05322), “Alcoholism” (ko05034), “Antigen processing and presentation” (ko04612), “Staphylococcus aureus infection” (ko05150), “Steroid hormone biosynthesis” (ko00140), “Inflammatory bowel disease (IBD)” (ko05321) and “Phagosome” (ko04145).

Trend analysis and gene expression clustering

Trend analysis and clustering of the 891 DEGs was performed using the STEM software, and 20 profiles were obtained, including seven significant expression profiles (profiles 2, 1, 0, 17, 4, 3, and 7) (Fig. 3).

Fig. 3.

Fig. 3

Trend profiles generated by STEM based on gene numbers. Colored profiles represent significant enrichment profiles with Q value ≤ 0.05. *ENSG00000070748 was treated as half gene and clustered in both profile two and five for it has same correlation coefficient with the two profiles

Profile 2 had 386 DEGs that were rapidly down-regulated after APS stimulation and maintained at a constant level in the three APS groups. GO enrichment data showed that 27 terms were significantly enriched, including 23 for biological process and four for cellular component (Supplemental Table S3).

Profile 17 included 49 DEGs that were rapidly up-regulated after APS treatment and maintained at a constant level in the three APS groups, which was opposite to the Profile 2. In this profile, 113 terms were significantly enriched, including 109 for biological process, 2 for cellular component and 2 for molecular function (Supplemental Table S3). Specially, some significantly enriched GO terms in this profile were related to cell growth and death, such as “positive regulation of programmed cell death” (GO:0043068), “positive regulation of cell death” (GO:0010942), “regulation of programmed cell death” (GO:0043067), “regulation of cell death” (GO:0010941), “cell proliferation” (GO:0008283), “positive regulation of cell proliferation” (GO:0008284), “regulation of cell proliferation” (GO:0042127) and “negative regulation of cell proliferation” (GO:0008285).

Profile 1 included 109 DEGs that were constantly decreased in the APS 50 and APS 100 groups (vs. the CK group) and slightly increased in the APS 200 group (vs. the APS 100 group). Profile 0 had 89 DEGs that showed decreased expression as the APS increased. 46 and 32 DEGs were included in profile 4 and 7, respectively. GO enrichment data showed that no term was significantly enriched for these four profiles.

In profile 3, 36 DEGs were included; only one term, namely, flavonoid metabolic process, was significantly enriched in this profile.

To better know the function of DEGs, KEGG enrichment analysis was performed in all seven significant profiles. Our results showed that seven pathways were significantly enriched, including five for profile 2 and two for profile 7. Five significantly enriched pathways in profile 2 included “Systemic lupus erythematosus” (ko05322), “Alcoholism” (ko05034), “Staphylococcus aureus infection” (ko05150), “Antigen processing and presentation” (ko04612) and “Inflammatiory bowel disease (IBD)” (ko05321). “Cytokine-cytokine receptor interaction” (ko04060) and “Intestinal immune network for IgA production” (ko04672) were significantly enriched in profile 7. No significantly enriched pathway was found in profile 1, 0, 17, 4 and 3.

qRT-PCR validation of DEGs

Ten genes from RNA-seq were randomly chosen to further be verified by qRT-PCR method. qRT-PCR results (Fig. 4a, b) and the FPKM data from RNA-seq (Fig. 4c, d) are shown in Fig. 4. From the figure we can see that, except for HIST1H3H and IGFBP3, other genes revealed similar expression trend in the qRT-PCR and RNA-seq results, indicating our sequence data are reliable.

Fig. 4.

Fig. 4

Comparison of the qRT-PCR results and FPKM values from RNA-Seq. a, b qRT-PCR results for 10 DEGs; c, d FPKM values for 10 DEGs

Discussion

Traditional Chinese medicine (TCM) is a complementary and alternative modality for treating psoriasis. TCM formulas, such as “Wen-qing-yin”, “Jia-wei-xiao-yao wan”, “Dang-gui-yin-zi” and “Xue-fu-zhu-yu-tang”, are commonly used in clinical treatment of psoriasis, especially by Chinese people (Weng et al. 2016). Angelica sinensis is one of the most commonly used drug in these formulas. APS is one of important active components isolated from Angelica sinensis. In a previous study, Jing et al. found that APS have a therapeutic effect on the psoriasis-like lesions in a guinea pigs model induced by propranolol ointment (Jing and Sheng 2006). In another study performed by Jing et al. authors found APS can decrease the expression of proliferating cell nuclear antigen (PCNA), one important protein related with cell proliferation and differentiation, in the psoriasis-like lesions (Jing et al. 2008). Our previous study reported that APS can inhibit proliferation of HaCaT cells by delaying cell cycle progression from G0/G1 phase to S phase (Chunshui et al. 2010). Based on these evidences, we suspect that APS may be useful for psoriasis treatment.

It is well known that psoriasis is a disease of epidermal hyperplasia resulted from the abnormal differentiation and hyper-proliferation of keratinocytes; therefore, many therapies had focused on the restrain of the hyper-proliferation of keratinocytes (Li et al. 2012; Tse et al. 2006). Natural products with anti-proliferative effects on HaCaT cells are potentially useful in the treatment of psoriasis (Zhang et al. 2017; Huang et al. 2019). In the present study, we confirmed that APS can time- and concentration-dependently inhibits the proliferation of HaCaT cells, which confirmed that APS have anti-psoriatic potential. To better know the underlying mechanism of this action, GO and KEGG enrichment analysis were performed on all DEGs; however, the results cannot plainly used to explain the anti-proliferative effect of APS. After then, trend analysis was performed on all 891 DEGs. Notablely, cell proliferation-related GO terms were mostly dispersed in the profile 2 and 17, including “regulation of MAPK cascade” (GO:0043408), “positive regulation of MAPK cascade” (GO:0043410), “cell proliferation” (GO:0008283), “positive regulation of cell proliferation” (GO:0008284), “regulation of cell proliferation” (GO:0042127) and “negative regulation of cell proliferation” (GO:0008285). Genes enriched in these terms are summarized in the supplemental table S4. After reviewing published literatures, we found that DEGs such as NOTCH3 (Ota et al. 2014), SERPINE1 (Man et al. 2015), GLI1 (Endo et al. 2006), SMAD6 (Yu et al. 2009), TGFB2 (Jiang et al. 2017), CYR61 (Wu et al. 2017) and FOSL1 (Sobolev et al. 2011) were previously reported in psoriasis studies. Among them, SERPINE1, SMAD6 and CTGF attracted our most concerns. SERPINE1 (also called PAI-1), an important EMT marker, was found significantly increased in the psoriatic epidermal keratinocytes (Man et al. 2015). In another study performed by Nielsen et al. authors found that the plasma level of PAI-1 was significantly elevated in psoriasis patients and significantly decreased during treatment (Nielsen et al. 2002). These evidences indicated that SERPINE1 may play a role in the pathogenesis of psoriasis. The Smad family includes eight different SMAD, namely SMAD1 to SMAD8. SMAD6 and 7, two inhibitory SMADs, represent a negative feedback loop inhibiting the TGF β-SMAD signaling pathway (Di Fusco et al. 2017). Considering that TGF-β is an important cytokine that negatively regulates keratinocyte proliferation and SMAD7 was proved positively regulates keratinocyte proliferation in psoriasis, we speculate that SMAD6 may has similar function with SMAD7, which making it a potential target for psoriasis treatment. Just like SERPINE1 and SMAD7, CTGF is a target gene of TGF-β (Saito et al. 2013). In a study performed by Hayakawa et al. authors used imiquimod to induce a murine psoriatic dermatitis model and found that increase of CTGF showed a tendency to suppress the psoriatic dermatitis through inhibition of suprabasal cells proliferation and macrophage infiltration in the skin; on the contrary, CTGF inhibition using an anti-CTGF antibody slightly worsened the dermatitis (Hayakawa et al. 2018). In the present study, SERPINE1 and SMAD6 were significantly decreased after APS treatment; while, CTGF was significantly increased after APS treatment. These genes, together with TGF-β, which was increased after APS treatment in our RNA-seq data, may closely relevant to the anti-proliferative effect of APS. However, this study has limitations. The most important one is lack of research depth. In the near future, cell and animal experiments are planned to take place to further confirm the underlying mechanism of APS in treating psoriasis.

Conclusions

The present study confirmed that APS can time- and concentration-dependently inhibits the proliferation of HaCaT cells in vitro; the anti-proliferation property of APS suggests that APS may have anti-psoriatic effect. SERPINE1, SMAD6, CTGF, and TGF-β may closely relevant to the anti-proliferation effect of APS.

Accession numbers

RNA-seq data of the present study has been deposited into the SRA database under accession number of PRJNA552662.

Electronic supplementary material

Below is the link to the electronic supplementary material.

13205_2019_1828_MOESM1_ESM.xlsx (182.8KB, xlsx)

Supplement table S1. All DEGs after APS treatment as compared with the CK group. Genes with log2(FC)>1 and FDR<0.05 were up-regulated; Genes with log2(FC) <-1 and FDR<0.05 were down-regulated. (XLSX 182 kb)

13205_2019_1828_MOESM2_ESM.xlsx (13.1KB, xlsx)

Supplement table S2. Significantly enriched GO terms for all DEGs (XLSX 13 kb)

13205_2019_1828_MOESM3_ESM.xlsx (21.1KB, xlsx)

Supplement table S3.Significantly enriched GO terms for DEGs in all profiles (XLSX 21 kb)

13205_2019_1828_MOESM4_ESM.xlsx (13.9KB, xlsx)

Supplement table S4. Genes relevant to cell proliferation (XLSX 13 kb)

Acknowledgements

This work was supported by grants from the Project of Sichuan Science and Technology Bureau (2016JY0214), the Scientific Research Project of Sichuan Health and Family Planning Commission (150243) and the Scientific Research Project of Suining Municipality (2015S23).

Compliance with ethical standards

Conflict of interest

The author declares that they have no competing interests.

References

  1. Chunshui Y, Yunzhu M, Jiangwei S, Fen X, Xiaojie D, Yan C, Xing C. Experimental study of angelica polysaccharide induced apoptosis on HaCaT Cells. Chin J Dermato Venerol Integ Trad W Med. 2010;9(3):143–145. [Google Scholar]
  2. Di Fusco D, Laudisi F, Dinallo V, Monteleone I, Di Grazia A, Marafini I, Troncone E, Colantoni A, Ortenzi A, Stolfi C. Smad7 positively regulates keratinocyte proliferation in psoriasis. Brit J Dermatol. 2017;177(6):1633–1643. doi: 10.1111/bjd.15703. [DOI] [PubMed] [Google Scholar]
  3. Endo H, Momota Y, Oikawa A, Shinkai H. Psoriatic skin expresses the transcription factor Gli1: possible contribution of decreased neurofibromin expression. Brit J Dermatol. 2006;154(4):619–623. doi: 10.1111/j.1365-2133.2005.06975.x. [DOI] [PubMed] [Google Scholar]
  4. Farahnik B, Sharma D, Alban J, Sivamani R. Oral (systemic) botanical agents for the treatment of psoriasis: a review. J Altern Complement Med. 2017;23(6):418–425. doi: 10.1089/acm.2016.0324. [DOI] [PubMed] [Google Scholar]
  5. Hayakawa K, Ikeda K, Fujishiro M, Yoshida Y, Hirai T, Tsushima H, Miyashita T, Morimoto S, Suga Y, Takamori K. Connective tissue growth factor neutralization aggravates the psoriasis skin lesion: the analysis of psoriasis model mice and patients. Ann Dermatol. 2018;30(1):47–53. doi: 10.5021/ad.2018.30.1.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Huang X, Lei Y, Guan H, Hao Y, Liu H, Sun G, Chen R, Song S. Transcriptomic analysis of the regulation of stalk development in flowering Chinese cabbage (Brassica campestris) by RNA sequencing. Sci Rep UK. 2017;7(1):15517. doi: 10.1038/s41598-017-15699-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Huang T-H, Lin C-F, Alalaiwe A, Yang S-C, Fang J-Y. Apoptotic or antiproliferative activity of natural products against keratinocytes for the treatment of psoriasis. Int J Mol Sci. 2019;20(10):2558. doi: 10.3390/ijms20102558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Jiang M, Sun Z, Dang E, Li B, Fang H, Li J, Gao L, Zhang K, Wang G. TGFβ/SMAD/microRNA-486-3p signaling axis mediates keratin 17 expression and keratinocyte hyperproliferation in psoriasis. J Invest Dermatol. 2017;137(10):2177–2186. doi: 10.1016/j.jid.2017.06.005. [DOI] [PubMed] [Google Scholar]
  9. Jing H, Sheng W. Influence of angelica polysaccharide on apoptosis in keratinocytes of psoriasis-like lesions of guinea pigs. Med J Wuhan Univ. 2006;3(27):377–379. [Google Scholar]
  10. Jing H, Sheng W, Duan D. The influence of angelica polysaccharide on the expression levels of PCNA in psoriasis-like lesions of guinea pigs. Chin J Dermatovenereol. 2008;22(1):11–13. [Google Scholar]
  11. Keseroglu HO, Gönül M. Traditional topical herbal therapies in psoriasis. TANG. 2014;4(4):13–20. [Google Scholar]
  12. Kushwaha A. A review on alternative treatment of Psoriasis. J Pharm Res. 2017;11(7):864–877. [Google Scholar]
  13. Li X-L, Wang Z-H, Zhao Y-X, Luo S-J, Zhang D-W, Xiao S-X, Peng Z-H. Purification of a polysaccharide from Gynostemma pentaphyllum Makino and its therapeutic advantages for psoriasis. Carbohyd Polym. 2012;89(4):1232–1237. doi: 10.1016/j.carbpol.2012.04.001. [DOI] [PubMed] [Google Scholar]
  14. Li N, Zhao W, Xing J, Liu J, Zhang G, Zhang Y, Li Y, Liu W, Shi F, Bai Y. Chinese herbal Pulian ointment in treating psoriasis vulgaris of blood-heat syndrome: a multi-center, double-blind, randomized, placebo-controlled trial. Bmc Complem Altern M. 2017;17(1):264. doi: 10.1186/s12906-017-1631-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Liang W, Lin Z, Zhang L, Qin X, Zhang Y, Sun L. Calcipotriol inhibits proliferation of human keratinocytes by downregulating STAT1 and STAT3 signaling. J Invest Med. 2017;65(2):376–381. doi: 10.1136/jim-2016-000176. [DOI] [PubMed] [Google Scholar]
  16. Man X, Chen X, Li W, Landeck L, Dou T, Chen J, Zhou J, Cai S, Zheng M. Analysis of epithelial–mesenchymal transition markers in psoriatic epidermal keratinocytes. Open Biol. 2015;5(8):1–8. doi: 10.1098/rsob.150032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Nielsen HJ, Christensen IJ, Svendsen M, Hansen U, Werther K, Brünner N, Petersen L, Kristensen J. Elevated plasma levels of vascular endothelial growth factor and plasminogen activator inhibitor-1 decrease during improvement of psoriasis. Inflamm Res. 2002;51(11):563–567. doi: 10.1007/PL00012428. [DOI] [PubMed] [Google Scholar]
  18. Ota T, Takekoshi S, Takagi T, Kitatani K, Toriumi K, Kojima T, Kato M, Ikoma N, Mabuchi T, Ozawa A. Notch signaling may be involved in the abnormal differentiation of epidermal keratinocytes in psoriasis. Acta Histochem Cytoc. 2014;47(4):175–183. doi: 10.1267/ahc.14027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Qu XA, Freudenberg JM, Sanseau P, Rajpal DK. Integrative clinical transcriptomics analyses for new therapeutic intervention strategies: a psoriasis case study. Drug Discov Today. 2014;19(9):1364–1371. doi: 10.1016/j.drudis.2014.03.015. [DOI] [PubMed] [Google Scholar]
  20. Saito A, Suzuki HI, Horie M, Ohshima M, Morishita Y, Abiko Y, Nagase T. An integrated expression profiling reveals target genes of TGF-β and TNF-α possibly mediated by microRNAs in lung cancer cells. PLoS One. 2013;8(2):e56587. doi: 10.1371/journal.pone.0056587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Sobolev V, Zolotorenko A, Soboleva A, Elkin A, Il’ina S, Serov D, Potekaev N, Tkachenko S, Minnibaev M, Piruzyan A. Effects of expression of transcriptional factor AP-1 FOSL1 gene on psoriatic process. B Exp Biol Med. 2011;150(5):632–634. doi: 10.1007/s10517-011-1208-0. [DOI] [PubMed] [Google Scholar]
  22. Tse W-P, Che C-T, Liu K, Lin Z-X. Evaluation of the anti-proliferative properties of selected psoriasis-treating Chinese medicines on cultured HaCaT cells. J Ethnopharmacol. 2006;108(1):133–141. doi: 10.1016/j.jep.2006.04.023. [DOI] [PubMed] [Google Scholar]
  23. Wang J, Chen G, Shi T, Wang Y, Guan C. Possible treatment for cutaneous lichen planus: an in vitro anti-inflammatory role of Angelica polysaccharide in human keratinocytes HaCaT. Int J Immunopathol Pharmacol. 2019;33:2058738418821837. doi: 10.1177/2058738418821837. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  24. Weng S, Chen B, Wang Y, Liu C, Sun M, Chang C, Lin J, Yen H. Traditional Chinese medicine use among patients with psoriasis in Taiwan: a nationwide population-based study. Evid Based Compl Alt. 2016;2:1–13. doi: 10.1155/2016/3164105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Wu P, Ma G, Zhu X, Gu T, Zhang J, Sun Y, Xu H, Huo R, Wang B, Shen B. Cyr61/CCN1 is involved in the pathogenesis of psoriasis vulgaris via promoting IL-8 production by keratinocytes in a JNK/NF-κB pathway. Clin Immunol. 2017;174:53–62. doi: 10.1016/j.clim.2016.11.003. [DOI] [PubMed] [Google Scholar]
  26. Yu H, Mrowietz U, Seifert O. Downregulation of SMAD2, 4 and 6 mRNA and TGFβ receptor I mRNA in lesional and non-lesional psoriatic skin. Acta Derm Venereol. 2009;89(4):351–356. doi: 10.2340/00015555-0634. [DOI] [PubMed] [Google Scholar]
  27. Zhang CS, Yu JJ, Parker S, Zhang AL, May B, Lu C, Xue CC. Oral Chinese herbal medicine combined with pharmacotherapy for psoriasis vulgaris: a systematic review. Int J Dermatol. 2014;53(11):1305–1318. doi: 10.1111/ijd.12607. [DOI] [PubMed] [Google Scholar]
  28. Zhang C, Xu Q, Tan X, Meng L, Wei G, Liu Y, Zhang C. Astilbin decreases proliferation and improves differentiation in hacat keratinocytes. Biomed Pharmacother. 2017;93:713–720. doi: 10.1016/j.biopha.2017.05.127. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13205_2019_1828_MOESM1_ESM.xlsx (182.8KB, xlsx)

Supplement table S1. All DEGs after APS treatment as compared with the CK group. Genes with log2(FC)>1 and FDR<0.05 were up-regulated; Genes with log2(FC) <-1 and FDR<0.05 were down-regulated. (XLSX 182 kb)

13205_2019_1828_MOESM2_ESM.xlsx (13.1KB, xlsx)

Supplement table S2. Significantly enriched GO terms for all DEGs (XLSX 13 kb)

13205_2019_1828_MOESM3_ESM.xlsx (21.1KB, xlsx)

Supplement table S3.Significantly enriched GO terms for DEGs in all profiles (XLSX 21 kb)

13205_2019_1828_MOESM4_ESM.xlsx (13.9KB, xlsx)

Supplement table S4. Genes relevant to cell proliferation (XLSX 13 kb)


Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES