Skip to main content
ACS Omega logoLink to ACS Omega
. 2019 Feb 21;4(2):3881–3886. doi: 10.1021/acsomega.8b03376

Highly Sensitive Detection of Uracil-DNA Glycosylase Activity Based on Self-Initiating Multiple Rolling Circle Amplification

Lijuan Dong 1, Xuange Zhang 1, Yaru Li 1, Fangjie E 1, Jiangyan Zhang 1,*, Yongqiang Cheng 1,*
PMCID: PMC6648713  PMID: 31459598

Abstract

graphic file with name ao-2018-03376r_0001.jpg

Sensitive detection of uracil-DNA glycosylase (UDG) activity is very important in the study of many fundamental biochemical processes and clinical applications. Here, we develop a novel assay for the detection of UDG activity by using the self-initiating multiple rolling circle amplification (SM-RCA) strategy. We first design a trigger probe modified with NH2 at its 3′-terminal and uracil base in the middle of sequence, which is complementary to a cyclized padlock probe. In the presence of UDG, a uracil base can be excised by UDG to generate an apurinic/apyrimidinic (AP) site. The AP site is recognized and cleaved by endonuclease IV (Endo IV), releasing the primer with 3′-OH. The primer can trigger the rolling circle amplification (RCA) reaction, producing a long and repeated DNA strand embedded some uracil bases. These uracil bases can be cleaved by UDG and Endo IV again, and then, more primers are generated to initiate SM-RCA reaction, producing large amounts of DNA product. Afterward, the DNA product is measured by a specific DNA fluorescence dye for quantitative detection of UDG activity. The linear range of the method is 5 × 10–5 to 1.25 × 10–3 U/mL, and the detection limit is 1.7 × 10–5 U/mL. This method not only utilizes the target UDG itself to trigger RCA but also further induces SM-RCA reaction, providing a simple, sensitive, and cost-effective strategy for the detection of glycosylase and clinical diagnosis.

1. Introduction

DNA glycosylases are a class of enzymes that remove the damaged nitrogenous base while leaving the sugar–phosphate backbone intact in DNA, creating an apurinic/apyrimidinic (AP) site.1 As the damaged base leaves the double-helix DNA, the N-glycosidic bond is cleaved to initiate the base excision repair (BER) pathway, which is an essential DNA repair pathway for maintaining genome stability.24 There are many kinds of DNA glycosylases in organisms, and different DNA glycosylases are responsible for different base excision repair pathways, respectively.59 Uracil-DNA glycosylase (UDG) is a protein enzyme that specifically recognizes and removes uracil lesions in both double- and single-stranded DNAs, leaving an AP site in DNA to trigger the downstream repairing process.1013 UDG plays key roles in maintaining genomic integrity in cell cycle regulation, apoptosis, virus proliferation, and so on.14 The abnormal expression of DNA glycosylases is closely related to various human diseases, such as human immunodeficiency, bloom syndrome, cancers, and so on.1519 Therefore, detection of UDG is vital especially for studying mechanisms and functions of many basic biochemical processes and disease diagnosis.20,21

Commonly, the activity of UDG is measured by enzyme-linked immunosorbent assay (ELISA),22 gel-based methods,23 electrochemical assays,24 and colorimetric methods.25,26 However, these methods generally suffered from complex steps and low sensitivity. Furthermore, to improve the sensitivity of UDG detection, many amplification strategies have been developed, including hybridization chain reaction (HCR),27 catalyzed hairpin assembly (CHA),28 exponential amplification reaction (EXPAR),29 strand displacement amplification (SDA),30,31 and rolling circle amplification (RCA),32,33 and so on. HCR and CHA are simple and rapid for detection of UDG resulting from their enzyme-free amplification mechanism, but their sensitivities are limited. The isothermal EXPAR, SDA, and RCA have high sensitivity to detect UDG activity. However, these methods suffer from the complex probe designs and reaction steps. Among them, the RCA-based UDG detection utilized a probe containing uracil (U) base, which can be excised by UDG to produce an AP site and then cleaved by endonuclease IV (Endo IV). The cleaved probe subsequently served as a template to ligate and cyclize the padlock probe (PLP) by DNA ligase to trigger RCA. Furthermore, to improve the sensitivity of UDG detection, a nicking enzyme was usually used to induce the multiple RCA, which was sophisticated and costly.33

In this paper, we take full advantage of the characteristics of UDG and Endo IV and develop a self-initiating multiple RCA (SM-RCA) strategy for the detection of UDG activity. The cyclized padlock probe (cPLP) is preprepared, and the cPLP is directly used during the UDG detection, which greatly reduces the complexity and saves time. A trigger probe (TP) is designed with a uracil base in the middle of TP sequence. Only in the presence of UDG, the uracil base in TP can be excised by UDG to form an AP site that can be cleaved by Endo IV. Then, the cleaved TP can act as a primer to trigger RCA. By introduction of dUTP in RCA reaction, the DNA product of RCA contains many of the uracil bases, which can be recognized and cleaved by UDG and Endo IV again, leading to more primers for further inducing SM-RCA. Therefore, UDG activity can be detected by measuring the DNA product using a specific DNA fluorescence dye. In the SM-RCA reaction, the target UDG first triggers the RCA reaction with the assistance of Endo IV and then initiates the multiple RCA reaction, which is simple, sensitive, and cost-effective for the detection of UDG activity.

2. Results and Discussion

2.1. Principle of the SM-RCA Strategy for UDG Activity Detection

Figure 1 shows the SM-RCA strategy for UDG activity detection. First, we design a padlock probe (PLP), which can be ligated with template DNA by using T4 DNA ligase to form cPLP. The preparation of the cPLP was characterized by gel electrophoresis analysis (Figure S1). Moreover, TP with a uracil base in the middle of sequence and NH2 modification at 3′-terminal is designed to perfectly complementary to cPLP. When TP only hybridizes with cPLP, no amplification reaction takes place owing to the NH2 modification at 3′-terminal of TP. In the presence of UDG, the U base in TP is excised, generating an AP site. The AP site can be recognized and cleaved by Endo IV to generate the truncated TP with 3′-OH, which serves as a primer to trigger the RCA reaction, producing a long-repeated single-strand DNA (ssDNA). At the same time, because of the addition of dUTP in RCA reaction, many of the U bases are randomly bound to the long-strand DNA product, which can subsequently be excised by UDG to produce many of the AP sites. A large amount of UDG recognition sites is provided after RCA initiation, UDG can find its substrates easily and perform its activity with greatly improved efficiency. After cleaved by Endo IV, there will be several primers on each cPLP, multiple replication forks simultaneously work on a cPLP to enlarge RCA amplification. The long RCA product can also hybridize with more cPLP, producing new primers and initiating new RCA reaction. Moreover, some RCA products are disassociated during the extension, and the above process is repeated. In these RCA reactions, U bases are continuously introduced to form SM-RCA. Ultimately, the UDG activity can be detected through quantitation of the DNA from SM-RCA by the enhanced fluorescence signal of a specific DNA fluorescence dye, SYBR Green I. This method only combines UDG with Endo IV to achieve the SM-RCA, providing a simple, cost-efficient, and highly sensitive strategy for UDG activity detection.

Figure 1.

Figure 1

Schematic representation of the detection of UDG activity by SM-RCA.

To verify the feasibility of the method, real-time fluorescence signals under different conditions were measured. As shown in Figure 2a, in the absence of UDG and/or Endo IV, the fluorescence intensities increased a little in curves 1, 3, and 4. These results are due to the fact that TP cannot be cleaved to produce a primer in solution without UDG and/or Endo IV, and the 3′-terminal NH2-modified TP cannot initiate the RCA reaction. The weak fluorescence signals in solution mainly come from the nonspecific amplification of DNA. For curve 5, the fluorescence intensity was only slightly enhanced. This is ascribed to the fact that when both UDG and Endo IV coexist in reaction solution, the TP can be cleaved to release the primer. The new primer only initiates linear RCA with low amplification efficiency, and the multiple RCA reaction cannot be formed in the solution without the addition of dUTP. In contrast, for curve 2, the fluorescence intensities increased remarkably with the addition of dUTP in RCA reaction in the presence of UDG and Endo IV. The result is attributed to the fact that the U base in TP is first cleaved by UDG and Endo IV, triggering RCA reaction to generate a long-strand DNA containing U bases. The multiple U bases can be cleaved by UDG and Endo IV to release more primers, inducing multiple RCA to produce large amounts of DNA. These results indicate that the combination of UDG and Endo IV in RCA can initiate the SM-RCA and significantly enhance the sensitivity of UDG detection.

Figure 2.

Figure 2

(a) Real-time fluorescence detection UDG under different conditions: (1) negative control test only containing TP, cPLP, and dNTPs (including dUTP) without UDG and Endo IV in RCA reaction, (2) positive test with UDG and Endo IV in RCA reaction, (3) negative control test with UDG but no Endo IV in RCA reaction, (4) negative control test with Endo IV but no UDG in RCA reaction, and (5) negative control test without dUTP in RCA reaction. (b). Agarose gel electrophoresis results of RCA products, lanes 1–5 correspond to curves 1–5 in (a), respectively. The concentrations of reagents were 0.01 U UDG, 1 nM TP, 10 nM cPLP, 10 U Endo IV, 10 U phi29 DNA polymerase, 1 mM dNTP (with or without 1:9 dTTP/dUTP ).

Furthermore, we also performed agarose gel electrophoresis to investigate the feasibility of the method. As shown in Figure 2b, no distinct DNA product bands were found in lanes 1, 3, 4, and 5. The results in lanes 1, 3, and 4 were attributed to the fact that no RCA reaction occurred in these reaction solutions. For lane 5, because there was no dUTP in the RCA mixture, the combination of UDG and Endo IV only initiated linear RCA, producing a little amount of DNA. By comparison, a bright band and a series of dispersion bands with different molecular weights of DNA were clearly observed in lane 2, suggesting that the multiple RCA was successfully performed with the addition of dUTP in the RCA mixture. These results are identical with those in Figure 2a, which further indicates that combining UDG with Endo IV in RCA can achieve SM-RCA to detect UDG activity sensitively.

2.2. Quantitative Detection of UDG Activity

Under the optimal experimental conditions (Figure S2), the activity of UDG was detected by the SM-RCA strategy. As shown in Figure 3a, the fluorescence intensities increased gradually with the increase of the concentration of UDG from 5 × 10–5 to 5 × 10–3 U/mL. Figure 3b showed that the relative fluorescence intensities were linearly dependent on the concentration of UDG in a range of 5 × 10–5 to 1.25 × 10–3 U/mL. The correlation equations were ΔIF = 14.71 + 49.94C (10–4 U/mL) with a correlation coefficient of R2 = 0.9937, where ΔIF is the relative fluorescence intensity. According to the 3σ rule, the detection limit was calculated as 1.7 × 10–5 U/mL, which was comparable to that of exonuclease-assisted signal amplification in combination with magnetic separation (2 × 10–5 U/mL)8 and had been improved by three order of magnitude as compared with those of the G-quadruplex-based luminescent assay (0.02 U/mL)34 and the label-free colorimetric assay (0.02 U/mL),35 and two order of magnitude as compared with that of RCA-based assay (0.002 U/mL).36

Figure 3.

Figure 3

(a) Fluorescence emission spectra of SM-RCA strategy with various concentrations of UDG from 5 × 10–5 to 5 × 10–3 U/mL. (b) The linear relationship between the relative fluorescence intensities and the concentration of UDG. Error bars were obtained from three repetitive measurements.

2.3. Specificity of the Proposed Method

The specificity of this method mainly relied on the specific uracil excision by UDG. To evaluate the detection specificity, we used nonspecific exonuclease III (Exo III) and human alkyladenine glycosylase (hAAG) as the negative controls. Exo III cannot recognize and excise a uracil base from a DNA substrate, so it cannot trigger the RCA. The hAAG can only excise alkylated and oxidative DNA-damaged sites, including 3-methyladenine, 7-methylguanine, 1,N6-ethenoadenine, and hypoxanthine; however, it cannot produce the AP sites and primers used in this research. As shown in Figure 4, the fluorescence signal of UDG was much stronger than those of Exo III and hAAG that were almost equivalent to the signal value of the blank solution. The results show that the proposed SM-RCA method possesses the good specificity for the detection of UDG activity.

Figure 4.

Figure 4

Specificity experiment for the detection of UDG activity by SM-RCA. Error bars were obtained from three repetitive measurements.

2.4. UDG Inhibition Assay

To demonstrate the feasibility of the proposed method for UDG inhibition assay, we selected uracil glycosylase inhibitor (UGI) as a model inhibitor. UGI can bind with UDG at a rate of 1:1 in mol and form a tight and physiologically irreversible complex.37 As shown in Figure 5, as the concentration of UGI increased, the relative activity of UDG gradually decreased in a dose-dependent manner, and a IC50 value (the UGI concentration resulting in 50% inhibition of UDG activity) of 2.4 × 10–4 U/mL was obtained, which is consistent with that reported in the literature.21,29 This result indicates that the proposed method could provide a potential platform for the screening of UDG inhibitors.

Figure 5.

Figure 5

Inhibition effect of different concentrations of UGI on the UDG activity. The concentration of UDG was 5 × 10–4 U/mL. Error bars were obtained from three repetitive measurements.

2.5. Real Sample Detection

To study the applicability of our proposed method, we examined the activity of UDG in HeLa cell lysates. We further studied the relationship between fluorescence intensity and number of HeLa cells. Figure 6 showed that the fluorescence intensity increased with the increasing number of HeLa cells. Notably, the fluorescence intensity showed a linear correlation with the number of HeLa cells in the range from 0.5 to 10 cells. The correlation equation was ΔIF = 44.20N + 79.41, with a correlation coefficient of R2 = 0.9968, where ΔIF is the relative fluorescence intensity and N is the number of HeLa cells. The detection limit was calculated to be 0.2 cells, which was comparable to that obtained by enzyme-assisted isothermal amplification-based fluorescent assay (three cells).38,39

Figure 6.

Figure 6

Linear relationship between the relative fluorescence intensities and the number of HeLa cells. Error bars were obtained from three repetitive measurements.

Furthermore, a recovery test was used to evaluate the accuracy of the proposed method by a real sample of HeLa cells spiked with two different concentrations of UDG. The recoveries were in the range of 86.0–105.0%, and the corresponding RSD was 1.6–5.1% (Table S1). These results indicated that the proposed SM-RCA strategy can be used for the determination of UDG in real samples.

3. Conclusions

In summary, we develop a novel, simple, and sensitive method for the detection of UDG by taking full of the characteristics of UDG and End IV, which directly initiate SM-RCA. The preprepared cPLP is directly used during the UDG detection, which greatly reduces the complexity and saves time. By introduction of dUTP in the RCA reaction, the long-strand DNA generated from RCA contains some uracil bases brokenly. The uracil bases in DNA can be recognized and excised continuously by combining UDG with Endo IV, which generates more primers to initiate the multiple RCA, leading to the enhanced sensitivity of UDG detection. In the method, a large amount of UDG recognition sites is provided after RCA initiation, where UDG can find its substrates easily and perform its activity with greatly improved efficiency. The target UDG itself is not only used to trigger the RCA but also further induced the SM-RCA reaction with the assistance of Endo IV, which is simple and cost-effective as compared with the other nicking enzyme-mediated RCA methods.28,29 In addition, as the large amounts of DNA generated from SM-RCA can be detected by various methods, such as fluorescence, chemiluminescence, or electrochemisty, the SM-RCA provides a simple, sensitive, and universal analysis platform for glycosylase and clinical diagnosis.

4. Experimental Section

4.1. Materials and Reagents

Uracil-DNA glycosylase (UDG), human alkyladenine glycosylase (hAAG), uracil glycosylase inhibitor (UGI), T4 DNA ligase, exonuclease I (Exo I), exonuclease III (Exo III), endonuclease IV (Endo IV), and 10× NEBuffer 2 (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 10 mM dithiothreitol) were purchased from New England Biolabs (Ipswich, MA, USA). Dr. GenTLE Precipitation Carrier was purchased from Takara Biotechnology Co., Ltd. (Dalian, China). GelRed was purchased from Biotium (Shanghai, China). 10× SYBR Green I was purchased from Zeesan (Xiamen, China). SYBR Gold was purchased from Invitrogen (CA, USA). NxGen phi29 DNA polymerase was purchased from Lucigen (WI, USA). TRAPeze 1× CHAPS lysis buffer was purchased from Millipore Corp. (Billerica, MA, USA). All other chemicals were analytical grade and used as received. All ultrapure water (18.2 MΩ) used in this work was acquired through a Milli-Q water purification system (Billerica, MA). All oligonucleotides used in the assay in Table 1 were synthesized by Takara Biotechnology Co., Ltd. (Dalian, China).

Table 1. Sequences of the Oligonucleotides.

oligonucleotide sequence (5′ → 3′)
template TCTTCTCGACAGCTTGCTGAAGATTT
triger probe TCTTCTCGACAGCTTGCUGAAGA-NH2
padlock probea CTGTCGAGAAGATTCATCCACATACTTATCAGCTTAAGGAACCTATACGGCACACCCATCATCTTCAGCAAG
a

The 5′-terminal of padlock probe was phosphorylated.

4.2. Instruments

The fluorescence spectra were measured by a Hitachi F-7000 fluorescence spectrophotometer (Tokyo, Japan) at an excitation wavelength of 480 nm, and a fluorescence intensity at 523 nm was recorded for further data analysis. The real-time fluorescence intensity curves were monitored at a StepOne Real-Time PCR system (Applied Biosystems, USA). Isothermal RCA reaction was performed with a 2720 thermal cycler (Applied Biosystems, USA).

4.3. Preparation of the cPLP

Reaction system (40 μL) containing 0.2 μM template DNA, 0.2 μM PLP probe, and 1× T4 DNA ligase buffer was first heated at 90 °C for 5 min and cooled gradually to 16 °C for 30 min. Then, 1 μL of 400 U/μL T4 DNA ligase was added to the solution to cyclize PLP, which was performed by incubation at 25 °C overnight and inactived at 65 °C for 20 min. Moreover, 20 U Exo I and 200 U Exo III were added to the reaction solution to degrade the excess PLP probe and template DNA at 37 °C for 3 h and then inactived at 80 °C for 15 min. After that, the reaction product was purified by Dr.GenTLE Precipitation Carrier kit according to the manufacturer’s protocol. Finally, the obtained cPLP was quantified with a nanodrop, confirmed by gel electrophoresis analysis, and then reserved at −20°C.

4.4. Detection of UDG Activity by SM-RCA

The SM-RCA reaction was carried out in a volume of 10 μL containing 0.01 nM TP, 10 nM cPLP, 1 μL of 10× NEBuffer 2, 5 U phi29 DNA polymerase, 5 U Endo IV, 100 μM dNTPs including a certain amount of dUTP and a certain concentration of UDG. The reaction was incubated at 37 °C for 1 h and then stopped at 75 °C for 20 min. Then, 2 μL of 10× SYBR Green I dye and 188 μL of sterilized water were added into the solution. The fluorescence measurement was performed using a Hitachi F-7000 fluorescence spectrometer with excitation and emission wavelengths at 480 and 523 nm, respectively.

For real-time fluorescence detection, the SM-RCA reaction solution in a volume of 10 μL containing 0.01 nM TP, 10 nM cPLP, 1 μL of 10× NEBuffer 2, 5 U phi29 DNA polymerase, 5 U Endo IV, 100 μM dNTPs including a certain amount of dUTP, 1 μL of 10× SYBR Green I dye, and a certain concentration of UDG. The real-time fluorescence intensity curves were monitored at StepOne Real-Time PCR system (Applied Biosystems, USA) at an interval of 1 min selecting the SYBR Green I channel for 90 cycles.

4.5. Assay of Inhibition of UDG

For UDG inhibitor screening, 1 μL of 10× NEBuffer 2, 1 nM TP, 10 nM cPLP, 10 U phi29 DNA polymerase, 10 U Endo IV, 100 μM dNTPs with dUTP, and different concentrations of UGI were mixed. Then, UDG was added to the mixture with certain sterile water, and the concentration of UDG is 5 × 10–4 U/mL. The following procedures were the same as the detection of UDG activity experiment.

4.6. Gel Electrophoresis Analysis

The RCA reaction products for different reaction systems were analyzed using 1.5% agarose gel, which was stained by 1 μL of SYBR Gold. The gel electrophoresis was carried out at a constant voltage of 100 V for 40 min in 1× TAE buffer after loading 5 μL of each sample into the lanes. The preparation of the cPLP was confirmed using 7% denaturing polyacrylamide gel electrophoresis (PAGE) containing 7 M urea. The gel electrophoresis was carried out at a constant voltage of 110 V for 90 min in 1× TBE buffer. After electrophoresis, the gel was colored with the 0.1 M NaCl solution containing 3× Super GelRed for 30 min. The image of the gel was visualized in an Azure Biosystems C150 Gel imaging system (USA).

4.7. Cell Lysate Preparation

After trypsinization, approximately 1.0 × 107 HeLa cell samples were distributed into a 1.5 mL centrifuge tube and centrifuged at 800 rpm for 5 min to remove the culture medium. Then, the cells were washed with PBS for three times and centrifuged at 2000 rpm at 4 °C for 10 min. After that, the cells were suspended in 500 μL of CHAPS lysis buffer in each tube, incubated on ice for 30 min, and then, the mixture was centrifuged at 12,000 rpm for 30 min at 4 °C The collected supernate was stored at −80 °C for further UDG analysis.

Acknowledgments

The authors are grateful for the financial support of the National Natural Science Foundation of China (Nos. 21475031 and 21605034) and the Natural Science Foundation of Hebei Province (No. B2018201049).

Supporting Information Available

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsomega.8b03376.

  • Gel electrophoresis analysis of the preparation of the cPLP, optimization of experimental conditions, and real sample detection (PDF)

Author Contributions

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

The authors declare no competing financial interest.

Supplementary Material

ao8b03376_si_001.pdf (483.4KB, pdf)

References

  1. Lord C. J.; Ashworth A. The DNA Damage Response and Cancer Therapy. Nature 2012, 481, 287–294. 10.1038/nature10760. [DOI] [PubMed] [Google Scholar]
  2. Hoeijmakers J. H. J. Genome Maintenance Mechanisms for Preventing Cancer. Nature 2001, 411, 366–374. 10.1038/35077232. [DOI] [PubMed] [Google Scholar]
  3. Wood R. D. Nucleotide Excision Repair in Mammalian Cells. J. Biol. Chem. 1997, 272, 23465–23468. 10.1074/jbc.272.38.23465. [DOI] [PubMed] [Google Scholar]
  4. Róna G.; Scheer I.; Nagy K.; Pálinkás H. L.; Tihanyi G.; Borsos M.; Békési A.; Vértessy B. G. Detection of Uracil within DNA Using a Sensitive Labeling Method for in Vitro and Cellular Applications. Nucleic Acids Res. 2016, 44, e28. 10.1093/nar/gkv977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Tye B. K.; Nyman P. O.; Lehman I. R.; Hochhauser S.; Weiss B. Transient Accumulation of Okazaki Fragments As a Result of Uracil Incorporation into Nascent DNA. Proc. Natl. Acad. Sci. U. S. A. 1977, 74, 154–157. 10.1073/pnas.74.1.154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Wist E.; Unhjem O.; Krokan H. Accumulation of Small Fragments of DNA in Isolated HeLa Cell Nuclei Due to Transient Incorporation of dUMP. Biochim. Biophys. Acta, Nucleic Acids Protein Synth. 1978, 520, 253–270. 10.1016/0005-2787(78)90225-3. [DOI] [PubMed] [Google Scholar]
  7. Lindahl T.; Nyberg B. Heat-Induced Deamination of Cytosine Residues in Deoxyribonucleic Acid. Biochemistry 1974, 13, 3405–3410. 10.1021/bi00713a035. [DOI] [PubMed] [Google Scholar]
  8. Li C.-C.; Zhang Y.; Tang B.; Zhang C.-Y. Integration of Single-molecule Detection with Magnetic Separation for Multiplexed Detection of DNA Glycosylases. Chem. Commun. 2018, 54, 5839–5842. 10.1039/C8CC01695J. [DOI] [PubMed] [Google Scholar]
  9. Wang L.-J.; Wang Z.-Y.; Zhang Q.; Tang B.; Zhang C.-Y. Cyclic Enzymatic Repairing-Mediated Dual-Signal Amplification for Real-Time Monitoring of Thymine DNA Glycosylase. Chem. Commun. 2017, 53, 3878–3881. 10.1039/C7CC00946A. [DOI] [PubMed] [Google Scholar]
  10. Schärer O. D. Chemistry and Biology of DNA Repair. Angew. Chem., Int. Ed. 2003, 42, 2946–2974. 10.1002/anie.200200523. [DOI] [PubMed] [Google Scholar]
  11. Stivers J. T.; Jiang Y. L. A Mechanistic Perspective on the Chemistry of DNA Repair Glycosylases. Chem. Rev. 2003, 103, 2729–2760. 10.1021/cr010219b. [DOI] [PubMed] [Google Scholar]
  12. Kunkel T. A.; Erie D. A. DNA Mismatch Repair. Annu. Rev. Biochem. 2005, 74, 681–710. 10.1146/annurev.biochem.74.082803.133243. [DOI] [PubMed] [Google Scholar]
  13. Aravind L.; Walker D. R.; Koonin E. V. Conserved Domains in DNA Repair Proteins and Evolution of Repair Systems. Nucleic Acids Res. 1999, 27, 1223–1242. 10.1093/nar/27.5.1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Xiao X.; Liu Y.; Zhao M. Endonuclease IV Discriminates Mismatches Next to the Apurinic/Apyrimidinic Site in DNA Strands: Constructing DNA Sensing Platforms with Extremely High Selectivity. Chem. Commun. 2013, 49, 2819–2821. 10.1039/c3cc40902c. [DOI] [PubMed] [Google Scholar]
  15. Pulukuri S. M. K.; Knost J. A.; Estes N.; Rao J. S. Small Interfering RNA-directed Knockdown of Uracil DNA Glycosylase Induces Apoptosis and Sensitizes Human Prostate Cancer Cells to Genotoxic Stress. Mol. Cancer Res. 2009, 7, 1285–1293. 10.1158/1541-7786.MCR-08-0508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Imai K.; Slupphaug G.; Lee W.-I.; Revy P.; Nonoyama S.; Catalan N.; Yel L.; Forveille M.; Kavli B.; Krokan H. E.; Ochs H. D.; Fischer A.; Durandy A. Human Uracil–DNA Glycosylase Deficiency Associated with Profoundly Impaired Immunoglobulin Class-Switch Recombination. Nat. Immunol. 2003, 4, 1023–1028. 10.1038/ni974. [DOI] [PubMed] [Google Scholar]
  17. Sousa M. M. L.; Krokan H. E.; Slupphaug G. DNA-uracil and Human Pathology. Mol. Aspects Med. 2007, 28, 276–306. 10.1016/j.mam.2007.04.006. [DOI] [PubMed] [Google Scholar]
  18. Seal G.; Brech K.; Karp S. J.; Cool B. L.; Sirover M. A. Immunological Lesions in Human Uracil DNA Glycosylase: Association with Bloom Syndrome. Proc. Natl. Acad. Sci. U. S. A. 1988, 85, 2339–2343. 10.1073/pnas.85.7.2339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lindahl T. Instability and Decay of the Primary Structure of DNA. Nature 1993, 362, 709–715. 10.1038/362709a0. [DOI] [PubMed] [Google Scholar]
  20. Dianov G. L. Monitoring Base Excision Repair By in Vitro Assays. Toxicology 2003, 193, 35–41. 10.1016/S0300-483X(03)00288-9. [DOI] [PubMed] [Google Scholar]
  21. Du Y.-C.; Cui Y.-X.; Li X.-Y.; Sun G.-Y.; Zhang Y.-P.; Tang A.-N.; Kim K.; Kong D.-M. Terminal Deoxynucleotidyl Transferase and T7 Exonuclease-Aided Amplification Strategy for Ultrasensitive Detection of Uracil-DNA Glycosylase. Anal. Chem. 2018, 90, 8629–8634. 10.1021/acs.analchem.8b01928. [DOI] [PubMed] [Google Scholar]
  22. Seal G.; Arenaz P.; Sirover M. A. Purification and Properties of the Human Placental Uracil DNA Glycosylase. Biochim. Biophys. Acta, Gen. Subj. 1987, 925, 226–233. 10.1016/0304-4165(87)90113-9. [DOI] [PubMed] [Google Scholar]
  23. Ischenko A. A.; Saparbaev M. K. Alternative Nucleotide Incision Repair Pathway for Oxidative DNA Damage. Nature 2002, 415, 183–187. 10.1038/415183a. [DOI] [PubMed] [Google Scholar]
  24. McWilliams M. A.; Anka F. H.; Balkus K. J.; Slinker J. D. Sensitive and Selective Real-Time Electrochemical Monitoring of DNA Repair. Biosens. Bioelectron. 2014, 54, 541–546. 10.1016/j.bios.2013.11.034. [DOI] [PubMed] [Google Scholar]
  25. Nguyen V.-T.; Le D.-V.; Nie C.; Zhou D.-M.; Wang Y.-Z.; Tang L.-J.; Jiang J.-H.; Yu R.-Q. Enzyme-catalyzed Assembly of Gold Nanoparticles for Visualized Screening of DNA Base Excision Repair. Talanta 2012, 100, 303–307. 10.1016/j.talanta.2012.07.065. [DOI] [PubMed] [Google Scholar]
  26. Nie H.; Wang W.; Li W.; Nie Z.; Yao S. A Colorimetric and Smartphone Readable Method for Uracil-DNA Glycosylase Detection Based on the Target-Triggered Formation of G-Quadruplex. Analyst 2015, 140, 2771–2777. 10.1039/C4AN02339K. [DOI] [PubMed] [Google Scholar]
  27. Xi Q.; Li J.-J.; Du W.-F.; Yu R.-Q.; Jiang J.-H. A highly Sensitive Strategy for Base Excision Repair Enzyme Activity Detection Based on Graphene Oxide Mediated Fluorescence Quenching and Hybridization Chain Reaction. Analyst 2016, 141, 96–99. 10.1039/C5AN02255J. [DOI] [PubMed] [Google Scholar]
  28. Xu X.; Wang L.; Wu Y.; Jiang W. Uracil Removal-Inhibited Ligase Reaction in Combination with Catalytic Hairpin Assembly for the Sensitive and Specific Detection of Uracil-DNA Glycosylase Activity. Analyst 2017, 142, 4655–4660. 10.1039/C7AN01666B. [DOI] [PubMed] [Google Scholar]
  29. Wang L.-J.; Ren M.; Zhang Q.; Tang B.; Zhang C.-Y. Excision Repair-Initiated Enzyme-Assisted Bicyclic Cascade Signal Amplification for Ultrasensitive Detection of Uracil-DNA Glycosylase. Anal. Chem. 2017, 89, 4488–4494. 10.1021/acs.analchem.6b04673. [DOI] [PubMed] [Google Scholar]
  30. Wu Y.; Wang L.; Jiang W. Toehold-Mediated Strand Displacement Reaction-Dependent Fluorescent Strategy for Sensitive Detection of Uracil-DNA Glycosylase Activity. Biosens. Bioelectron. 2017, 89, 984–988. 10.1016/j.bios.2016.10.053. [DOI] [PubMed] [Google Scholar]
  31. Du Y.-C.; Jiang H.-X.; Huo Y.-F.; Han G.-M.; Kong D.-M. Optimization of Strand Displacement Amplification-Sensitized G-Quadruplex DNAzyme-Based Sensing System and Its Application in Activity Detection of Uracil-DNA Glycosylase. Biosens. Bioelectron. 2016, 77, 971–977. 10.1016/j.bios.2015.10.080. [DOI] [PubMed] [Google Scholar]
  32. Zhang P.; Wang L.; Zhao H.; Xu X.; Jiang W. Self-Primer and Self-Template Recycle Rolling Circle Amplification Strategy for Sensitive Detection of Uracil-DNA Glycosylase Activity. Anal. Chim. Acta 2018, 1001, 119–124. 10.1016/j.aca.2017.11.036. [DOI] [PubMed] [Google Scholar]
  33. Xu Y.; Cui Y.-X.; Zhao Q.-G.; Tang A.-N.; Kong D.-M. Label-Free and Sensitive Detection of Uracil-DNA Glycosylase Using Exponential Real-Time Rolling Circle Amplification. Anal. Methods 2018, 10, 2405–2410. 10.1039/C8AY00742J. [DOI] [Google Scholar]
  34. Leung K.-H.; He H.-Z.; Ma V. P.-Y.; Zhong H.-J.; Chan D. S.-H.; Zhou J.; Mergny J.-L.; Leung C.-H.; Ma D.-L. Detection of Base Excision Repair Enzyme Activity Using a Luminescent G-Quadruplex Selective Switch-On Probe. Chem. Commun. 2013, 49, 5630–5632. 10.1039/c3cc41129j. [DOI] [PubMed] [Google Scholar]
  35. Liu X.; Chen M.; Hou T.; Wang X.; Liu S.; Li F. Label-Free Colorimetric Assay for Base Excision Repair Enzyme Activity Based on Nicking Enzyme Assisted Signal Amplification. Biosens. Bioelectron. 2014, 54, 598–602. 10.1016/j.bios.2013.11.062. [DOI] [PubMed] [Google Scholar]
  36. Zhang L.; Zhao J.; Jiang J.; Yu R. A Target-Activated Autocatalytic DNAzyme Amplification Strategy for the Assay of Base Excision Repair Enzyme Activity. Chem. Commun. 2012, 48, 8820–8822. 10.1039/C2CC34531E. [DOI] [PubMed] [Google Scholar]
  37. Kaushal P. S.; Talawar R. K.; Krishna P. D. V.; Varshney U.; Vijayan M. Unique Features of the Structure and Interactions of Mycobacterial Uracil-DNA Glycosylase: Structure of a Complex of the Mycobacterium Tuberculosis Enzyme in Comparison with Those From Other Sources. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2008, 64, 551–560. 10.1107/S090744490800512X. [DOI] [PubMed] [Google Scholar]
  38. Zhang Y.; Li Q.-n.; Li C.-C.; Zhang C.-Y. Label-Free and High-Throughput Bioluminescence Detection of Uracil-DNA Glycosylase in Cancer Cells through Tricyclic Cascade Signal Amplification. Chem. Commun. 2018, 54, 6991–6994. 10.1039/C8CC03769H. [DOI] [PubMed] [Google Scholar]
  39. Zhang Y.; Li C.-C.; Tang B.; Zhang C.-Y. Homogeneously Sensitive Detection of Multiple DNA Glycosylases with Intrinsically Fluorescent Nucleotides. Anal. Chem. 2017, 89, 7684–7692. 10.1021/acs.analchem.7b01655. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ao8b03376_si_001.pdf (483.4KB, pdf)

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES