Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jul 24.
Published in final edited form as: Cell Rep. 2019 Jul 9;28(2):325–331.e4. doi: 10.1016/j.celrep.2019.06.038

In Vivo Single-Cell Genotyping of Mouse Cortical Neurons Transfected with CRISPR/Cas9

André Steinecke 1,3, Nobuhiro Kurabayashi 1,2,3, Yasufumi Hayano 1,3, Yugo Ishino 1, Hiroki Taniguchi 1,4,*
PMCID: PMC6652230  NIHMSID: NIHMS1534198  PMID: 31291570

SUMMARY

CRISPR/Cas-based technologies have revolutionized genetic approaches to addressing a wide range of neurobiological questions. The ability of CRISPR/Cas to introduce mutations into target genes allows us to perform in vivo loss-of-function experiments without generating genetically engineered mice. However, the lack of a reliable method to determine genotypes of individual CRISPR/Cas-transfected cells has made it impossible to unambiguously identify the genetic cause of their phenotypes in vivo. Here, we report a strategy for single-cell genotyping in CRISPR/Cas-transfected neurons that were phenotypically characterized in vivo. We show that re-sectioning of cortical slices and subsequent laser microdissection allow us to isolate individual CRISPR/Cas-transfected neurons. Sequencing of PCR products containing a CRISPR/Cas-targeted genomic region in single reference neurons provided genotypes that completely correspond with those deduced from their target protein expression and phenotypes. Thus, our study establishes a powerful strategy to determine the causality between genotypes and phenotypes in CRISPR/Cas-transfected neurons.

In Brief

CRISPR/Cas9-based mutagenesis through NHEJ causes a variety of genotypes in individual cells, which make it difficult to determine the causality between genotypes and phenotypes. Steinecke et al. report a strategy for single-cell genotyping in CRISPR/Cas9-transfected neurons that were phenotypically characterized in vivo.

Graphical Abstract

graphic file with name nihms-1534198-f0001.jpg

INTRODUCTION

The recent invention of CRISPR/Cas genome editing technologies has revolutionized genetic approaches to neurobiology. In particular, the ability of CRISPR/Cas to efficiently introduce deletion and/or insertion mutations at target genomic sites via the non-homologous end-joining (NHEJ) pathway has been extremely useful for genetic dissection of various neurobiological questions (Adli, 2018; Incontro et al., 2014; Koukouli et al., 2017; Nguyen and Nicoll, 2018; Nishiyama, 2019; Park et al., 2015; Petersen et al., 2017; Shinmyo et al., 2017; Straub et al., 2014; Swiech et al., 2015). In combination with emerging technologies that reliably identify transcriptomes in different neuronal types under distinct conditions such as activity level and age (Hrvatin et al., 2018; Hu et al., 2017; Mayer et al., 2018; Mi et al., 2018; Paul et al., 2017; Tasic et al., 2016), CRISPR/Cas-based gene targeting holds promise for systematic understanding of the molecular basis underlying the assembly, function, and dysfunction of neural circuits.

NHEJ randomly creates different types of mutations such as deletions, substitutions, and insertions, which can result in hypomorph, loss-of-function, and gain-of-function alleles. In addition, the mutations in CRISPR/Cas-transfected cells could occur in a mono-allelic or bi-allelic manner, and no mutation may be found in some of them. This potential genotypic variability caused by NHEJ makes interpreting the genetic cause of phenotypes observed at single-cell levels uncertain. In order to employ CRISPR/Cas-based mutagenesis as the equivalent alternative to genetically engineered mouse lines, it is necessary to develop a method to reliably determine genotypes of CRISPR/Cas-transfected cells at a single-cell level in vivo.

Axon initial segments (AISs) are molecularly and functionally specialized subcellular domains of neurons that generate action potentials (Huang and Rasband, 2018; Nelson and Jenkins, 2017). In the cortex, AISs of pyramidal neurons (PNs) are vertically aligned and organized in a non-overlapping manner (Steinecke et al., 2017). Their relatively sparse distribution allows us to examine molecular expression and morphology of PN AISs at a single-cell level in vivo. Ankyrin-G (AnkG) is a cytoskeletal scaffolding protein that is localized in AISs of neurons throughout the nervous system (Huang and Rasband, 2018; Nelson and Jenkins, 2017). Cerebellar Purkinje cells in AnkG knockout (KO) mice are known to exhibit dramatic thickening of axons likely due to disruption of cell polarity (Sobotzik et al., 2009). These features enable us to unambiguously identify single AnkG KO PNs based on their loss of AnkG proteins and axonal phenotype. Thus, AnkG genes serve as ideal CRISPR/Cas targets in PNs to produce reference cells with deduced genotypes, which are useful for establishing an experimental pipeline to determine genotypes of CRISPR/Cas-transfected cells.

In this study, we describe an in vivo single-cell genotyping strategy combining laser microdissection (LMD) and single-cell PCR (scPCR). Re-sectioning of cortical slices and subsequent LMD enabled us to isolate individual PNs that were transfected with single guide RNAs (sgRNAs) targeting an AnkG genomic locus after the investigation of their AnkG protein expression and axonal morphology. Sequencing of scPCR products containing an sgRNA target region demonstrated that genotypes revealed by our approach correspond with those deduced from AnkG protein expression and axonal phenotypes. Furthermore, we validated the versatility of this technique by examining PNs transfected with sgRNAs targeting two more genetic loci: (1) the MeCP2 gene that encodes methyl-CpG-binding protein 2 underlying Rett syndrome and (2) the Satb2 gene that encodes a DNA-binding protein regulating higher-order chromatin configuration. Thus, our study establishes a powerful strategy to determine the causal relationship between genotypes and phenotypes in CRISPR/Cas-transfected cortical neurons in vivo.

RESULTS

To implement CRISPR/Cas9-based gene KO of AnkG in cortical PNs, we first designed sgRNAs targeting upstream coding regions of AnkG genes using an open-source program provided by the Broad Institute (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) and tested their activity using the Surveyor assay. We identified an sgRNA (AnkG-sgRNA) that efficiently generates mutations at an AnkG locus when introduced into Neuro2a cells together with plasmids containing Cas9 genes (Figure 1A). We next examined whether AnkG-sgRNAs efficiently induce homozygous KO mutations in PNs in vivo. Neural progenitor cells in the somatosensory cortex were co-electroporated with two kinds of plasmids, one containing an sgRNA and a gfp gene and the other containing a Cas9 gene. Electroporated animals were sacrificed at postnatal day 14 (P14), and 60-μm brain slices were immunostained with reliable anti-AnkG antibodies (Steinecke et al., 2017) (Figures 1B1D). We found that 72% of AnkG-sgRNA-transfected PNs exhibit loss of AnkG proteins in the AIS while 28% of them retain AnkG proteins at a level comparable to control LacZ-sgRNA-transfected PNs (Figures 1C1E; AnkG (+) PNs: F1/F0 = 5.01 ± 0.60, n = 14; AnkG (−) PNs: F1/F0 =1.06 ± 0.02, n = 16; LacZ-sgRNA-transfected PNs: F1/F0 = 3.79 ± 0.84, n = 5; Mann-Whitney test, p < 0.0001). All AnkG (−) PNs expressed Cas9, which is detected by antibodies against FLAG-tag, suggesting that loss of AnkG proteins caused by AnkG-sgRNAs is dependent on the presence of Cas9 (data not shown). Consistent with the fact that antigens detected by anti-phospho-IκB-α antibodies concentrate at the AIS in an AnkG-dependent manner (Buffington et al., 2012; Schultz et al., 2006), AnkG-sgRNA-transfected PNs lacking AnkG signals, but not those retaining AnkG signals, lost anti-phospho-IκB-α immunofluorescence (Figures 1C, 1D, and 1F; AnkG (+) PNs: F1/F0 = 3.72 ± 0.48, n = 14; AnkG (−) PNs: F1/F0 =1.02 ± 0.03, n = 16; Mann-Whitney test, p < 0.0001). To further validate that AnkG (−) PNs represent homozygous KO cells, we carried out a phenotypic analysis. As cerebellar Purkinje cells of AnkG KO mice are known to exhibit axon thickening (Sobotzik et al., 2009), AnkG (−) PNs were expected to have similar phenotypes. Indeed, AnkG (−) PNs exhibited striking thickening of axons, which can be clearly distinguished from basal dendrites based on their projection toward the cortical white matter (Figures 1B1D). On the other hand, the axons of AnkG-sgRNA-transfected AnkG (+) PNs and LacZ-sgRNA-transfected PNs appeared normal. A quantitative analysis verified that axons from AnkG (−) PNs are significantly thicker than those from AnkG (+) PNs and LacZ-sgRNA-transfected PNs (Figure 1G; AnkG (+) PNs: 0.64 ± 0.06 μm, n = 14; AnkG (−) PNs: 1.82 ± 0.17 μm, n = 16; LacZ-sgRNA-transfected PNs: 0.74 ± 0.08, n = 5; Mann-Whitney test, p < 0.0001). These results indicate that introduction of AnkG-sgRNAs into PNs reliably produces two types of reference cells whose genotypes can be deduced from their AnkG protein expression and axonal phenotypes; AnkG (+) and AnkG (−) PNs likely represent wild-type (WT) or heterozygous mutants and homozygous mutants, respectively. Thus, this experimental system provides an ideal platform to establish a general pipeline to determine genotypes in CRISPR/Cas9-transfected neurons in vivo.

Figure 1. AnkG-sgRNAs Induce Loss of AnkG/Phospho-IκB-α Proteins and Axonal Thickening in PNs In Vivo.

Figure 1.

(A) Validation of AnkG-sgRNA activity by the Surveyor assay. Arrowheads indicate digested DNA fragments suggesting the presence of mutations in the AnkG-sgRNA target site.

(B) Representative images of the entire cerebral wall (left three panels) of an AnkG-sgRNA-electroporated brain, with the boxed region magnified to the right. Filled arrowheads indicate an axon projecting to the white matter. Scale bars represent 200 μm (left panel) and 50 μm (right panel).

(C and D) Confocal projection images of AnkG-sgRNA-transfected PNs with (C) and without (D) AnkG signals in the AIS (green, GFP; red, AnkG; and blue, phospho-IκB-α). Filled and empty arrowheads indicate an AnkG (+) and an AnkG (−) axon, respectively. Scale bar, 20 μm.

(E–G) Immunofluorescence intensity of AnkG (E; AnkG (+): n = 14; AnkG (−): n = 16) and phospho-IκB-α (F; AnkG (+): n = 14; AnkG (−): n = 16), and index of axon thickness (G; AnkG (+): n = 14; AnkG (−): n = 16) in the AIS of AnkG (+) and AnkG (−) cells.

Three animals were analyzed. Mann-Whitney test: p < 0.0001. Data are presented as mean ± SEM.

In order to establish a method to determine genotypes of sgRNA-transfected neurons at a single-cell level after their phenotypic characterization in vivo, we aimed to sequence scPCR products containing the AnkG-sgRNA target site that were amplified from genomic DNAs of AnkG-sgRNA-transfected PNs. To isolate single sgRNA-transfected PNs from 60-μm brain slices, in which their phenotypic analyses were performed, we took advantage of LMD that allows us to precisely dissect out individual GFP-labeled neurons. As LMD requires thinner slices, we re-sectioned 60-μm brain slices into 25-μm slices (Figure 2A). When re-sectioning was successful, nearly all target sgRNA-transfected PNs were successfully reidentified in thinner slices based on their relative spatial position and dendritic geometry (Figures 2B and 2C). Twenty-one out of 22 reidentified PNs were successfully collected by LMD. Superimposing a hole generated by LMD on an image of a 25-μm slice with nuclear staining verified that LMD can strictly isolate a single reidentified PN (Figure 2D). The collected cells were subjected to the extraction of genomic DNAs, which were subsequently used as our scPCR templates. Two rounds of PCR using primer sets that flank a small genomic region encompassing the AnkG-sgRNA target site reliably produced DNA fragments with the expected size in 19 out of 21 recovered PNs. These amplicons were cloned into pBluescript vectors for sequencing. Genotypes of 11 AnkG (+) PNs and eight AnkG (−) PNs were examined by sequencing five clones of PCR products per cell (except for one AnkG (−) cell, where 10 clones were sequenced; see below) (Figures 3A3C). Seven out of eight AnkG (−) PNs showed two different frameshift mutations caused by deletion and/or insertion, suggesting that these AnkG (−) PNs have bi-allelic mutations. Of note, in one case, we detected only one kind of frameshift mutation caused by single-nucleotide insertion even after sequencing 10 clones of PCR products. There are at least two possible explanations for this exception: (1) both alleles have the same mutation, which is not uncommon in NHEJ repair given that the identical small number of nucleotides can be deleted or inserted at random deletion and/or insertion; and (2) a large deletion, greater than several hundred base pairs, was introduced into one allele, preventing amplification of DNA fragments encompassing the AnkG-sgRNA target site from this allele. All mutations caused premature stop codons in AnkG genes, consistent with loss of AnkG proteins. On the other hand, nine out of 11 AnkG (+) PNs exhibited only WT sequences, while two PNs showed a combination of a WT and a frameshift mutant sequence, suggesting that AnkG (+) PNs have either no or mono-allelic mutations. Additionally, we also examined genotypes of five LacZ-sgRNA PNs in the same way and found that none had mutant alleles in the AnkG-sgRNA target site, consistent with their normal AnkG protein expression and axonal morphology (Figures 3D and 3E). The perfect matching between genotypes determined by single-cell sequencing and those deduced from AnkG/phospho-IκB-α protein expression and axonal phenotypes suggests that our approach is unlikely to provide wrong sequences, which can be caused by contamination during single-cell isolation and/or PCR errors.

Figure 2. Isolation of Single sgRNA-Transfected PNs by Re-sectioning and Laser Microdissection (LMD).

Figure 2.

(A) Diagram of the procedure for our single-cell genotyping strategy combining LMD and single-cell PCR.

(B and C) AnkG-sgRNA-transfected PNs in a 60-μm-thick vibratome slice (B) and a 25-μm-thick section (C) obtained by re-sectioning of the vibratome slice are shown in lower (larger left panels) and higher magnification images (smaller right panels). The cells indicated by arrowheads in larger left panels are individually shown in smaller right panels (B′, B″, B″″, C′, C″, and C″″) (green, GFP; and red, AnkG). Filled and empty arrowheads in (B′)–(B″″) indicate an AnkG (+) and an AnkG (−) axon, respectively. Cells in (C′)–(C″″) correspond to those in (B′)–(B″″) respectively. Lower panels in (C′)–(C″″) indicate the precise LMD of target PNs. Scale bars represent 100 μm (left large panel) and 20 μm (right small panels).

(D) LMD allows for precise capture of single nuclei from sgRNA-transfected neurons (green, red circle) as shown with DAPI staining (blue) before (left panel) and after (right panel) LMD. Scale bar, 50 μm.

Figure 3. Single-Cell Genotyping Reliably and Precisely Determines Genotypes of AnkG-sgRNA-Transfected PNs.

Figure 3.

(A–D) Representative confocal projection images and AnkG gene sequences encompassing the sgRNA-target site of (A–C) AnkG-sgRNA- and (D) LacZ-sgRNA-transfected PNs. AnkG (+) and AnkG (−) PNs exhibit no (A), mono-allelic (B), and bi-allelic (C) mutations, respectively. LacZ-sgRNA-transfected PNs display no mutations at the AnkG locus (D) (green, GFP; red, AnkG; and blue, phospho-IκB-α). Filled and empty arrowheads indicate an AnkG (+) and an AnkG (−) axon, respectively. DNA sequences of single-cell PCR products are aligned with the wild-type (WT) sequence on the right side. The protospacer adjacent motif (PAM) sequence is marked in white. The numbers in parentheses indicate the number of nucleotide changes. Scale bar, 20 μm.

(E) Summary of AnkG/phospho-IκB-α protein expression and axonal phenotypes in genotyped single cells.

Data are presented as mean ± SEM.

To further validate the reliability of our approach, we performed single-cell genotyping of PNs transfected with sgRNAs targeting the MeCP2 or Satb2 gene, which were shown to efficiently create loss-of-function mutations in previous studies (Shinmyo et al., 2016; Swiech et al., 2015). Nuclear localization of these proteins enabled us to unambiguously determine their presence or absence in individual sgRNA-transfected PNs by immunohistochemical analysis (Figures 4A4D). As expected, we found that a majority of sgRNA-transfected PNs express no MeCP2 and Satb2 proteins (70% and 61%, respectively) (Figures 4A and 4C). sgRNA-mediated alterations account for the absence of target proteins in these sgRNA-transfected PNs, because a great majority of control LacZ-sgRNA-transfected PNs express MeCP2 and Satb2 proteins (92% and 95%, respectively). We collected MeCP2-sgRNA-transfected MeCP2 (−) PNs, Satb2-sgRNA-transfected Satb2 (−) PNs, and LacZ-sgRNA-transfected PNs with LMD and carried out scPCR and sequencing. All MeCP2-sgRNA-transfected MeCP2 (−) PNs and Satb2-sgRNA-transfected Satb2 (−) PNs displayed bi-allelic mutations with premature stop codons (five clones for each cell; MeCP2-sgRNA-transfected MeCP2 (−) PNs, n = 7; Satb2-sgRNA-transfected Satb2 (−) PNs, n = 5) (Figures 4A, 4C, 4E, and 4F), whereas none of the LacZ-sgRNA-transfected PNs showed mutations in MeCP2 and Satb2 loci (five clones for each cell; LacZ-sgRNA-transfected PNs (MeCP2), n = 5; LacZ-sgRNA-transfected PNs (Satb2), n = 5) (Figures 4B and 4D4F). Together, these results prove that our approach can reliably determine genotypes of single sgRNA-transfected neurons in vivo and thus serve as a versatile method to establish the causality between genotypes and CRISPR/Cas-induced mutant phenotypes.

Figure 4. Single-Cell Genotyping Reliably Determines Genotypes of MeCP2-sgRNA-and Satb2-sgRNA-Transfected PNs.

Figure 4.

(A–D) Representative confocal projection images, MeCP2 gene sequences encompassing the sgRNA-target site of MeCP2-sgRNA-transfected PNs and LacZ-sgRNA-transfected PNs (A and B), and Satb2 gene sequences encompassing the sgRNA-target site of Satb2-sgRNA-transfected PNs and LacZ-sgRNA-transfected PNs (C and D). MeCP2 (−) PNs and Satb2 (−) PNs exhibit bi-allelic mutations (A and C, respectively). LacZ-sgRNA transfected PNs display no mutations at the MeCP2 (B) or the Satb2 loci (D). GFP (green) and MeCP2/Satb2 (red). DNA sequences of single-cell PCR products are aligned with the WT sequence on the right side. The PAM sequence is marked in white. The numbers in parentheses indicate the number of nucleotide changes. Scale bar, 20 μm.

(E and F) Summary of MeCP2 (E) and Satb2 (F) protein expression in genotyped single cells.

Data are presented as mean ± SEM.

DISCUSSION

Although CRISPR/Cas-mediated mutagenesis methods have offered an opportunity to perform in vivo loss-of-function experiments without generating genetically engineered animals, the lack of a reliable method to determine genotypes of individual CRISPR/Cas-transfected cells has limited their efficient and expanded applications. Immunohistochemical analysis has been a standard, but not universal, method to verify gene KO in CRISPR/Cas-transfected cells in vivo, because it depends on the availability of good antibodies and may detect partial gene products from KO alleles. Although an alternative approach in which bi-allelic mutations are distinguished from others (a mono-allelic and no mutation) based on the co-expression of two different fluorescent markers separately inserted into target gene loci by CRISPR/Cas-mediated homology-directed repair (HDR) has been proposed (Tsunekawa et al., 2016), the low efficiency of HDR in both alleles makes this method impractical. In this study, we provide a powerful strategy in which sequencing of target genomic loci directly determines genotypes of single CRISPR/Cas9-transfected neurons in vivo. The ability of our strategy to determine not only zygosity but also genotype after phenotypic analysis allows us to definitively identify the causality between genotypes and phenotypes in CRISPR/Cas9-transfected neurons. This feature is particularly useful to determine less visually striking mutant phenotypes that can be detected only when mutant cells are exclusively grouped and compared with WT cells. In addition to NHEJ-mediated mutagenesis, CRISPR/Cas-based technologies can be used to introduce point mutations into target genes, which mimic those found in human patients with brain diseases, via HDR (Paquet et al., 2016), and to correct mutations in disease model mice through base-pair editing (Courtney et al., 2016; Shin et al., 2016). Single-cell genotyping should also be valuable to directly confirm alterations in target genomic sequences caused by these manipulations. Thus, our strategy will promote in vivo functional analysis of cortical genes by CRISPR/Cas-based technologies and contribute to understanding the molecular bases for function and dysfunction of cortical circuits. Beyond neurobiology, our approach will also be useful to other organs and tissues as well as organoids and/or explants where CRISPR/Cas-based genome engineering is feasible.

STAR★METHODS

LEAD CONTACT AND MATERIALS AVAILABILITY

Requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Hiroki Taniguchi (hiroki.taniguchi@mpfi.org).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

All studies on mice were approved by the Max Planck Florida Institute for Neuroscience Institutional Animal Care and Use Committee. Animals used in this study were under regular veterinarian supervision to guarantee their health. Wild-type Swiss Webster (SW) mice that did not undergo any prior experiments were used in this study. Both males and females were used at random. The mice were kept under 12/12 h light/dark cycles and housed in standard cages with water and food ad libitum. Embryonic day 0 (E0) and P0 are defined by the day when a plug was observed and the day when pups were born, respectively. The mice were subjected to analysis at P14.

METHOD DETAILS

Plasmid Generation and Usage

To construct AAV:ITR-U6-sgRNA (backbone)-pCBh-EGFP-WPRE-hGHpA-ITR, the coding sequence of Cre in AAV:ITR-U6-sgRNA (backbone)-pCBh-Cre-WPRE-hGHpA-ITR (Addgene plasmid # 60229) was replaced with that of GFP. To generate plasmids harboring LacZ-, AnkG-, MeCP2-, or Satb2-sgRNA, the annealed oligonucleotides containing a genomic target sequence were inserted into AAV:ITR-U6-sgRNA (backbone)-pCBh-GFP-WPRE-hGHpA-ITR. The sense sequences of sgRNA oligonucleotides are as follows: 5′- tgcga atacg cccac gcgat - 3′ (LacZ-sgRNA), 5′- tgcca ttgag aagct ccgcg –3′ (AnkG-sgRNA), 5′- ccattctgcagagccagcag –3′(MeCP2-sgRNA), and 5′- gggcgtctgtcacataactg –3′ (Satb2-sgRNA). The pSpCas9 (pX165) plasmid we used is available from Addgene (Addgene plasmid #48137).

Surveyor Assay

Neuro2a cells maintained in 10% FBS/IMDM were transiently transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. After culturing for one week, the cells were lysed with 100 μL of DirectPCR lysis reagent (Cell) (Viagen Biotech) containing proteinase K (final concentration, 0.1 mg/ml: Ambion). Using cell lysate as a template, the genomic region surrounding the sgRNA target site was PCR amplified. The PCR products were subjected to a re-annealing process for heteroduplex formation: 95°C for 10 min, 95°C to 85°C ramping at 2°C/sec, 85°C to 25°C at 0.3°C/sec, and holding at 25°C. After re-annealing, products were treated with SURVEYOR nuclease and SURVEYOR enhancer S (Transgenomic), and analyzed on 5% polyacrylamide gels. Primer sequences used were as follows: forward 5′-gacca ttccc aatcc aaatg gcac-3’; reverse 5′-gccat gcagc tcaca accat c-3′.

In utero Electroporation

Plasmid DNAs diluted in PBS were injected into the cerebral ventricles of mouse embryos at E14.5. Thereafter, electroporation [2 poring pulses (50 V, 50 ms duration, 450 ms interval, 10% decay) followed by 5 pulses (35 V, 50 ms duration, 450 ms interval, 10% decay); NEPA21 super electroporator, Nepa Gene] was carried out with forceps-type electrodes (CUY650P5; Nepa Gene). All following plasmids were electroporated at a final concentration of 2 μg/μl: AAV:ITR-U6-AnkG-sgRNA-pCBh-GFP-WPRE-hGHpA-ITR, AAV:ITR-U6-LacZ-sgRNA-pCBh-GFP-WPRE-hGHpA-ITR, AAV:ITR-U6-MeCP2-sgRNA-pCBh-GFP-WPRE-hGHpA-ITR, AAV:ITR-U6-Satb2-sgRNA-pCBh-GFP-WPRE-hGHpA-ITR, and pSpCas9.

Immunohistochemistry

Mice were perfused with saline and then 4% PFA in pH 7.4 PBS. Brains were excised and fixed in 2% PFA in pH 7.4 PBS overnight at 4°C. Sixty μm coronal sections were prepared using an automated vibratome (Leica VT1200 S). All sections were blocked in 10% Normal Donkey Serum/0.2% Triton-X/PBS for 30 min followed by overnight incubation with primary antibodies at 4°C in blocking solution. After washing in PBS, sections were then incubated with secondary antibodies overnight at 4°C and mounted in DAPI-containing media (DAPI Fluoromount-G, Southern Biotech, 0100–20).

The following primary antibodies were used in this study: mouse monoclonal anti-AnkG (1:500, UC Davis/NIH Neuromab, clone N106/36 75–146), mouse monoclonal anti-Satb2 (1:500, abcam, ab51502), rabbit monoclonal anti-MeCP2 (1:500, Cell Signaling Technology, #3456), and rabbit monoclonal anti-phospho-IκB-α (Ser32) (1:500, Cell Signaling Technology, #2859). The following secondary antibodies were used: Cy3-conjugated donkey anti-mouse IgG (H+L), Cy3-conjugated donkey anti-rabbit IgG (H+L), and Alexa Fluor 647-conjugated donkey anti-rabbit IgG (H+L) (1:1000, Jackson ImmunoResearch).

Imaging of Single Cells in 60 μm Brain Slices

Low-magnification fluorescent images were captured using an epifluorescent microscope equipped with a CCD camera [BX51 (OLYMPUS), 10x UPLSAPO, NA: 040 (OLYMPUS)]. For morphological and neurochemical analyses of AnkG, MeCP2 or Satb2-sgRNA-transfected pyramidal neurons (PNs), Zstack images were acquired using a confocal microscope [CLSM 880 (ZEISS), 63x Plan ApoChromat oil immersion, NA: 1.4 (ZEISS)].

Tissue preparation for laser microdissection

A couple of slices containing relatively sparsely distributed sgRNA-transfected PNs were selected per brain (three brains) and target AnkG (+) and AnkG (−) PNs as well as MeCP2 (−) and Satb2 (−) PNs were selected based on target protein expression. Glass slides containing 60 μm brain slices were immersed in PBS and coverslips were carefully removed. Brain slices were gently detached from slides and then cryo-protected in 30% sucrose in PBS overnight at 4°C. Twenty-five micrometer-thick slices were prepared by resectioning detached slices using a freezing sliding microtome (Leica SM 2010 R), and were directly mounted on polyethylene naphthalene (PEN) foil slides (Leica) and dried. The slides were rinsed twice with distilled water and dried at 42°C before they were subjected to laser microdissection (LMD).

Laser microdissection of Single Neuronal Nuclei

A Leica Laser Microdissection system (LMD7000) was used to isolate single GFP-labeled PNs. We re-identified single target PNs that had been previously analyzed in 60 μm-thick slices in the re-sectioned 25 μm-thick sections, based on their relative spatial position and dendritic geometry. PEN slides (Leica) were loaded onto the microscope with a 63 × objective (HCX PL FLUOTAR NA: 0.7, Leica) and contours of target single cells were hand-drawn onto the slice image displayed on the computer monitor using a tablet and a stylus. The laser was directed along the border of single cell, and the isolated cell was collected into a lid of 0.5 mL tubes. Laser parameters were adjusted as follows: power 40, aperture 1, speed 1, specimen balance 25, head current 80%, pulse frequency 1019, and offset 210.

Single Cell Genotyping

To extract genomic DNAs that were used in subsequent single cell PCR as templates, cells were lysed with 5 μL of DirectPCR lysis reagent (Cell) (Viagen Biotech) containing proteinase K (final concentration, 0.1 mg/ml: Ambion). In the first round of PCR, approximately 500 bp PCR products encompassing an sgRNA target site were amplified in a total reaction volume of 25 μL using ExTaq HS polymerase (Takara Bio Inc.). It should be noted that at this stage PCR bands are invisible in agarose gels. By using the first round PCR solution (0.5 μl) as templates, the second round of PCR with nested primers was performed to get approximately 150 bp amplicons, which were visible in agarose gels. The DNA fragments were gel-purified and cloned into sequencing vectors (pBluescript) using Infusion cloning reactions (Clontech). Five plasmid clones were randomly selected and subjected to DNA sequencing with M13 forward primer (Operon). Zygosity was classified into three groups as follows: no mutation: all five clones show a wild-type sequence; mono-allelic mutation; five clones include both a wild-type sequence and a frameshift mutation; bi-allelic mutations: five clones include two different kinds of frameshift mutations. Sequences used in the first PCR were as follows: forward 5′-gacca ttccc aatcc aaatg gcac-3′; reverse 5′-gccat gcagc tcaca accat c-3′ (AnkG), 5′- ggtctcatgtgtggcactca-3′; reverse 5′- tgtccaaccttcaggcaagg-3′ (MeCP2), and 5′- cttgacattgaacaactggaaggg-3′; reverse 5′- ggacccaatgcttcagatgctatg-3′ (Satb2). Primer sequences used in the second PCR were as follows: forward 5′-cgggc ccccc ctcga gaacg gagag acctg gaa-3′; reverse 5′-cgggc tgcag gaatt ctcac ccact tcacc ctgtc-3′ (AnkG), forward 5′- cgggccccccctcgatcagagacaagccactgaagtt-3′; reverse 5′- cgggctgcaggaattggtccccggtcacg gataat-3′ (MeCP2), and forward 5′- cgggccccccctcgatttactgtgcttttcttccctgc-3′; reverse 5′- cgggctgcaggaattaagcggagacagcct ttcag-3′ (Satb2).

QUANTIFICATION AND STATISTICAL ANALYSIS

Quantification of Single Cell Phenotypes

Projection images generated from confocal z stacks were analyzed using FIJI image analysis software. We first determined reference positions along axons that were used to draw lines or regions for measurement, using AnkG-sgRNA-transfected AnkG (+) PNs. The start point of the axon was defined as the distal end of an ellipse that encircles the soma of a pyramidal neuron. Then, a centerline was drawn along the axon and a plot profile of AnkG immunofluorescent intensity was generated along this line. The profile was smoothed, averaging the intensity every 10 pixels along the line. The peak point and the 10% point of AnkG signals were defined as the points that show the highest level and 10% of the maximum level, respectively. We calculated the average distances from the start point to the peak point and from the peak point to the 10% point, defining the average positions of the peak point and the 10% point, respectively.

For the comparison of axonal thickness between AnkG (+) and AnkG (−) PNs, lines perpendicular to the axons were drawn at the average position of the peak point and plot profiles of GFP signal intensity were generated. The full width at half maximum, which is defined as the distance between points on the curve at which the function reaches half its maximum value, of plot profiles was used as an index reflecting axonal thickness. The data of plot profiles generated using FIJI were transferred to MATLAB, where the peak of the intensity and the full width at half maximum were automatically determined using the function ‘findpeaks’.

For the comparison of AnkG and phospho-IκB-α expression in AISs between AnkG (+) and AnkG (−) PNs, the average intensity (F1) of their immunofluorescent signals in defined axonal segments was measured. Axonal segments for measurement start from the average position of the peak point spanning half the length of segments between the average positions of the peak point and the 10% point. The background signal was determined by measuring the average intensity in a non-AIS area with the same shape as the axonal segment defined for F1 measurement next to the axon of interest (F0). F1/F0 was calculated for each cell and the averaged number (F1/F0-Avg.) was used as an index reflecting the intensity of AnkG and phospho-IκB-α.

For the comparison between MeCP2 (+) and MeCP2 (−) PNs or Satb2 (+) and Satb2 (−) PNs, the soma of sgRNA-transfected PNs was encircled with an ellipse and the average intensity (F1) of the immunofluorescent signal was determined. The background signal (F0) was determined by measuring the average intensity in a non-stained area with the same shape. F1/F0 was calculated for each cell and the averaged number (F1/F0-Avg.) was used as an index reflecting the intensity of MeCP2 and Satb2.

Statistical Analysis

Data are presented as the mean ± SEM throughout experiments. “n” represents the number of single cells from three animals and the exact value of n can be found in the figure legend. All statistical analyses were performed using Prism 6 software. We tested Gaussian distribution using the D’Agostino & Pearson test and distributions were found to be non-Gaussian in all the datasets. Statistical significance was therefore tested using Mann-Whitney test. P values of less than 0.05 were considered significant. Statistical significance was presented in figures in the following manner: ****p < 0.0001.

DATA AND CODE AVAILABILITY

This study did not generate custom code. All original data are available from the lead contact upon request.

Supplementary Material

1
2

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Mouse anti-AnkG UC Davis/NIH Neuromab N106/36 75–146; RRID: AB_10673030
Mouse anti-Satb2 Abcam Ab51502; RRID: AB_882455
Rabbit anti-MeCP2 Cell Signaling Technologies #3456; RRID: AB_2143849
Rabbit anti phospho-IκB-α (Ser32) Cell Signaling Technologies #2859; RRID: AB_561111
Rabbit anti-FLAG Sigma-Aldrich F7425; RRID: AB_439687
Cy3-conjugated donkey anti-mouse IgG Jackson ImmunoResearch 715–165–150; RRID: AB_2340813
Cy3-conjugated donkey anti-rabbit IgG Jackson ImmunoResearch 711–165–152; RRID: AB_2307443
Alexa Fluor 647-conjugated donkey anti-rabbit IgG Jackson ImmunoResearch 711–605–152; RRID: AB_2492288
Bacterial and Virus Strains
Stellar competent cells Takara 636763
Chemicals, Peptides, and Recombinant Proteins
Ex Taq HS polymerase Takara RR006
Proteinase K Ambion AM2546
DAPI Fluoromount-G SouthernBiotech 0100–20
Critical Commercial Assays
Surveyor assay Transgenomic (IDT) 706020
Infusion cloning reactions Takara 638911
DirectPCR lysis reagent (Cell) Viagen Biotech 302-C
Lipofectamine 3000 Invitrogen L3000015
NucleoSpin Gel and PCR Clean-up MACHEREY-NAGEL 740609
NucleoSpin Plasmid MACHEREY-NAGEL 740588
Experimental Models: Cell Lines
Neuro2a cells ATCC ATCC CCL-131
Experimental Models: Organisms/Strains
Wild-type Swiss Webster mice The Jackson Laboratory 000689
Oligonucleotides
See Table S1 N/A n/a
Recombinant DNA
AAV:ITR-U6-sgRNA(backbone) Platt et al., 2014 Addgene Plasmid #60229
pSpCas9 Ran et al., 2013 Addgene Plasmid #48137
Software and Algorithms
Prism 6 GraphPad N/A
Fiji Schindelin et al., 2012 https://fiji.sc/
MATLAB R2013b Mathworks N/A
Other
NEPA21 super electroporator Nepa Gene CUY650P5
LMD7000 Leica N/A
BX51 microscope Olympus N/A
CLSM880 Zeiss N/A
PEN-membrane slides Leica 11505158
Vibratome (VT1200 S) Leica N/A
Freezing sliding microtome (SM 2010 R) Leica N/A

Highlights.

  • Re-sectioning of brain slices allows laser microdissection of preexamined neurons

  • Laser microdissection enables isolation of single CRISPR/Cas9-transfected neurons

  • Single-cell PCR and sequencing reveal genotypes of CRISPR/Cas9-transfected neurons

  • Single-cell genotyping links genotype to phenotype in CRISPR/Cas9-transfected neurons

ACKNOWLEDGMENTS

We would like to thank Ryohei Yasuda and Taniguchi lab members for careful reading of the manuscript and comments. We would like to thank the Flow Cytometry Core Facility at Scripps Florida for their technical support for the LMD. The Fitzpatrick lab at MPFI generously provided the Freezing Sliding Microtome. This work was supported by the Max Planck Florida Institute for Neuroscience and NIH grant MH115917 (to H.T.). N.K. was supported by a fellowship from the Uehara Memorial Foundation. A.S. was supported by a NARSAD Young Investigator Grant from the Brainc Behavior and Research Foundation.

Footnotes

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.celrep.2019.06.038.

REFERENCES

  1. Adli M (2018). The CRISPR tool kit for genome editing and beyond. Nat. Commun 9, 1911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Buffington SA, Sobotzik JM, Schultz C, and Rasband MN (2012). IκBα is not required for axon initial segment assembly. Mol. Cell. Neurosci 50, 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Courtney DG, Moore JE, Atkinson SD, Maurizi E, Allen EH, Pedrioli DM, McLean WH, Nesbit MA, and Moore CB (2016). CRISPR/Cas9 DNA cleavage at SNP-derived PAM enables both in vitro and in vivo KRT12 mutation-specific targeting. Gene Ther. 23, 108–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Hrvatin S, Hochbaum DR, Nagy MA, Cicconet M, Robertson K, Cheadle L, Zilionis R, Ratner A, Borges-Monroy R, Klein AM, et al. (2018). Single-cell analysis of experience-dependent transcriptomic states in the mouse visual cortex. Nat. Neurosci 21, 120–129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hu P, Fabyanic E, Kwon DY, Tang S, Zhou Z, and Wu H (2017). Dissecting cell-type composition and activity-dependent transcriptional state in mammalian brains by massively parallel single-nucleus RNA-seq. Mol. Cell 68, 1006–1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Huang CY, and Rasband MN (2018). Axon initial segments: structure, function, and disease. Ann. N Y Acad. Sci 1420, 46–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Incontro S, Asensio CS, Edwards RH, and Nicoll RA (2014). Efficient, complete deletion of synaptic proteins using CRISPR. Neuron 83, 1051–1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Koukouli F, Rooy M, Tziotis D, Sailor KA, O’Neill HC, Levenga J, Witte M, Nilges M, Changeux JP, Hoeffer CA, et al. (2017). Nicotine reverses hypofrontality in animal models of addiction and schizophrenia. Nat. Med 23, 347–354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Mayer C, Hafemeister C, Bandler RC, Machold R, Batista Brito R, Jaglin X, Allaway K, Butler A, Fishell G, and Satija R (2018). Developmental diversification of cortical inhibitory interneurons. Nature 555, 457–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Mi D, Li Z, Lim L, Li M, Moissidis M, Yang Y, Gao T, Hu TX, Pratt T, Price DJ, et al. (2018). Early emergence of cortical interneuron diversity in the mouse embryo. Science 360, 81–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Nelson AD, and Jenkins PM (2017). Axonal Membranes and Their Domains: Assembly and Function of the Axon Initial Segment and Node of Ranvier. Front. Cell. Neurosci 11, 136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Nguyen QA, and Nicoll RA (2018). The GABAA receptor beta subunit is required for inhibitory transmission. Neuron 98, 718–725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Nishiyama J (2019). Genome editing in the mammalian brain using the CRISPR-Cas system. Neurosci. Res 141, 4–12. [DOI] [PubMed] [Google Scholar]
  14. Paquet D, Kwart D, Chen A, Sproul A, Jacob S, Teo S, Olsen KM, Gregg A, Noggle S, and Tessier-Lavigne M (2016). Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Nature 533, 125–129. [DOI] [PubMed] [Google Scholar]
  15. Park CY, Halevy T, Lee DR, Sung JJ, Lee JS, Yanuka O, Benvenisty N, and Kim DW (2015). Reversion of FMR1 methylation and silencing by editing the triplet repeats in fragile X iPSC-derived neurons. Cell Rep. 13, 234–241. [DOI] [PubMed] [Google Scholar]
  16. Paul A, Crow M, Raudales R, He M, Gillis J, and Huang ZJ (2017). Transcriptional architecture of synaptic communication delineates GABAergic neuron identity. Cell 171, 522–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Petersen MA, Ryu JK, Chang KJ, Etxeberria A, Bardehle S, Mendiola AS, Kamau-Devers W, Fancy SPJ, Thor A, Bushong EA, et al. (2017). Fibrinogen activates BMP signaling in oligodendrocyte progenitor cells and inhibits remyelination after vascular damage. Neuron 96, 1003–1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, et al. (2014). CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell 159, 440–455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ran FA, Hsu PD, Wright J,Agarwala V, Scott DA, and Zhang F (2013). Genome engineering using the CRISPR-Cas9 system. Nat. Protoc 8, 2281–2308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Schultz C, König HG, Del Turco D, Politi C, Eckert GP, Ghebremedhin E, Prehn JH, Kögel D, and Deller T (2006). Coincident enrichment of phosphorylated IkappaBalpha, activated IKK, and phosphorylated p65 in the axon initial segment of neurons. Mol. Cell. Neurosci 33, 68–80. [DOI] [PubMed] [Google Scholar]
  22. Shin JW, Kim KH, Chao MJ, Atwal RS, Gillis T, MacDonald ME, Gusella JF, and Lee JM (2016). Permanent inactivation of Huntington’s disease mutation by personalized allele-specific CRISPR/Cas9. Hum. Mol. Genet 25, 4566–4576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Shinmyo Y, Tanaka S, Tsunoda S, Hosomichi K, Tajima A, and Kawasaki H (2016). CRISPR/Cas9-mediated gene knockout in the mouse brain using in utero electroporation. Sci. Rep 6, 20611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shinmyo Y, Terashita Y,Dinh Duong TA, Horiike T, Kawasumi M, Hosomichi K, Tajima A, and Kawasaki H (2017). Folding of the cerebral cortex requires Cdk5 in upper-layer neurons in gyrencephalic mammals. Cell Rep. 20, 2131–2143. [DOI] [PubMed] [Google Scholar]
  25. Sobotzik JM, Sie JM, Politi C, Del Turco D, Bennett V, Deller T, and Schultz C (2009). AnkyrinG is required to maintain axo-dendritic polarity in vivo. Proc. Natl. Acad. Sci. USA 106, 17564–17569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Steinecke A, Hozhabri E, Tapanes S, Ishino Y, Zeng H, Kamasawa N, and Taniguchi H (2017). Neocortical chandelier cells developmentally shape axonal arbors through reorganization but establish subcellular synapse specificity without refinement. eNeuro 4, ENEURO.0057–17.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Straub C, Granger AJ, Saulnier JL, and Sabatini BL (2014). CRISPR/Cas9-mediated gene knock-down in post-mitotic neurons. PLoS ONE 9, e105584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, and Zhang F (2015). In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat. Biotechnol 33, 102–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tasic B, Menon V, Nguyen TN, Kim TK, Jarsky T, Yao Z, Levi B, Gray LT, Sorensen SA, Dolbeare T, et al. (2016). Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci 19, 335–346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tsunekawa Y, Terhune RK, Fujita I, Shitamukai A, Suetsugu T, and Matsuzaki F (2016). Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain. Development 143, 3216–3222. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

Data Availability Statement

This study did not generate custom code. All original data are available from the lead contact upon request.

RESOURCES