Skip to main content
NCBI home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2019 Jun 4;25(4):953–964. doi: 10.1007/s12298-019-00682-4

Genetic diversity and population structure of Indian soybean (Glycine max (L.) Merr.) as revealed by microsatellite markers

Sharad Tiwari 1,2,✉, Niraj Tripathi 1, Koji Tsuji 3,4, Keerti Tantwai 1
PMCID: PMC6656831  PMID: 31402819

Abstract

The genetic structure and diversity of 148 soybean genotypes were analyzed using 26 simple sequence repeat (SSR) markers. SSR analysis showed distinctive polymorphism among the 148 lines. A total of 71 alleles were detected with an average of 2.8 alleles per SSR locus. Polymorphism information content varied from 0.118 to 0.699 with an average of 0.369. These soybean genotypes were divided into 3 subgroups based on STRUCTURE analysis. Further comparison showed that the arithmetic average (UPGMA) and STRUCTURE subgroups in fact were highly coherent, as genotypes in their subsequent classified group exhibited consistency with their origins or pedigree. This analysis provided a deep insight into the genetic structure of soybeans in India and will help us to improve the breeding strategies.

Keywords: Genetic diversity, Microsatellites, Soybean, Polymorphism, Population structure

Introduction

Soybean (Glycine max (L.) Merrill) belongs to family Fabaceae, subfamily Papilionoideae tribe Phaseoleae and subtribe Glycininea with the genome size of ~ 1100 Mb. Soybean is one of the most important oilseed cash crops, particularly in the state of Madhya Pradesh which contributes 70% of soybean production of India followed by Maharashtra, Rajasthan and Karnataka. Apart from its use as food oil, soybean oil is considered as a future source of fuel and its protein is an important dietary supplement. Diverse uses of soybean make it a more widely desired crop plant with rapidly increasing demand. During the recent past, soybean yield enhancement has been achieved only by 1.3% per year.

Different studies on assessment of genetic diversity in soybean have been carried out using morphological characteristics (Almeida et al. 2011; Cunha et al. 2013) and molecular markers (Tomar et al. 2011; Bisen et al. 2015). Previous reports are very useful in the utilization of soybean resources and establishing breeding strategies. However, most of these works focus on the genetic diversity of soybean or wild soybean germplasm.

In this study, genetic structure and diversity of 148 soybean genotypes of India have been analysed using simple sequence repeat (SSR) markers. These results will assist in gaining insights into the genetic structure of Indian soybean germplasm and thereby planning further breeding strategies.

Materials and methods

Plant materials

Genotypes under study include olden days and present-day cultivars as well as promising fixed mutant lines of some very popular varieties namely JS 335, JS 93-05 and NRC 37. Genotype identity, parentage and different morphological traits such as hypocotyl colour, flower colour, presence of hairs, color of hairs and growth type for five plants of each genotype were used for characterization of 148 soybean genotypes listed in Table 1.

Table 1.

Soybean genotypes and their characteristics used in present analysis

S. Genotype Parentage Recommended regions Developed by HC FC PH CH GT
1 AGS 2 Exotic selection – – Violet Violet Present Tawn S
2 AGS 16 Exotic selection – – Violet Violet Present Tawn S
3 AGS 32 Exotic selection – – Violet Violet Present Tawn S
4 AGS 48 Exotic selection – – Violet Violet Present Tawn S
5 Bragg Jackson × D49-22491 Throughout India Introduction from USA Green White Present Tawn S
6 BR-4 – – – Green White Present Tawn S
7 B 323 – – – Green White Present Tawn S
8 KDS 321 Sel. From EC 45371 Southern India MPKV, Rahuri Violet Violet Present Tawn S
9 EC 250348 Exotic selection – – Green White Present Tawn S
10 EC 250608 Exotic selection – – Violet Violet Present Tawn S
11 EC 251358 Exotic selection – – Violet Violet Present Tawn S
12 EC 325099 Exotic selection – – Violet Violet Present Tawn S
13 Himso 1521 – North India HPKVV, Palampur Violet Violet Present Grey S
14 IC 24541 Exotic selection – – Violet Violet Present Tawn S
15 IC 39220 Exotic selection – – Violet Violet Present Grey S
16 IC 313230 Exotic selection – – Violet Violet Present Grey S
17 JS 2 EC 14437 × Bragg Central India JNKVV, Jabalpur Violet Violet Present Tawn S
18 JS 335 JS 78-77 × JS 71-5 Central India JNKVV, Jabalpur Violet Violet Absent Absent S
19 JS 93-05 Sec. selection from PS 73-22 Central India JNKVV, Jabalpur Violet Violet Absent Absent S
20 JS 95-60 Sec. selection from PS 73-22 Central India JNKVV, Jabalpur Violet Violet Absent Absent D
21 JS 96-31 DS76-1-29 × JS79-277 Central India JNKVV, Jabalpur Green White Present Grey S
22 JS 97-51 Sel. from EC 34117 Central India JNKVV, Jabalpur Violet Violet Present Tawn S
23 JS 97-52 PK 327 × L129 Central India JNKVV, Jabalpur Green White Present Tawn S
24 JS 97-55 Sel. from EC 241811 Central India JNKVV, Jabalpur Violet Violet Present Grey I
25 JS 98-61 Moretta × Bragg Central India JNKVV, Jabalpur Green White Present Tawn I
26 JS 98-66 DSbl × AGS 79 Central India JNKVV, Jabalpur Green White Present Tawn I
27 JS 98-67 DSb1 × AGS 79 Central India JNKVV, Jabalpur Violet Violet Present Tawn I
28 JS 99-80 DSbl × AGS 79 Central India JNKVV, Jabalpur Green White Present Tawn I
29 JS 99 -88 JS 94-67 × JS 90-41 Central India JNKVV, Jabalpur Violet Violet Present Tawn I
30 JS 20-1 JS335 × EC 109541 Central India JNKVV, Jabalpur Violet Violet Present Tawn S
31 JS 20-05 JS 94-65 × JS 94-74 Central India JNKVV, Jabalpur Violet Violet Present Tawn S
32 JS 20-06 DSbl × SL 603 Central India JNKVV, Jabalpur Green White Present Tawn S
33 JS 20-09 JSM 246 × NRC 37300 Central India JNKVV, Jabalpur Violet Violet Absent Grey S
34 JS 20-14 JS94-65 × JS GY 94-67 Central India JNKVV, Jabalpur Violet Violet Present Tawn D
35 JS 20-15 JS 335 × PK 1308 Central India JNKVV, Jabalpur Green White Absent Absent S
36 JS 20-16 JS94-67 × JS 90-41 Central India JNKVV, Jabalpur Violet Violet Present Tawn I
37 JS 20-18 JS 98-61 × SL 659 Central India JNKVV, Jabalpur Green White Present Tawn D
38 JS 20-19 MACS 330 × L129 Central India JNKVV, Jabalpur Green White Present Tawn D
39 JS 20-20 JS 98-61 × EC 333922 Central India JNKVV, Jabalpur Green White Present Tawn D
40 JS 20-21 JS 335 × SL 637 Central India JNKVV, Jabalpur Green White Present Tawn D
41 JS 20-23 JS98-61X SL 633 Central India JNKVV, Jabalpur Green White Present Tawn D
42 JS 20-25 JS 98-62 × SL 633 Central India JNKVV, Jabalpur Green White Present Tawn D
43 JS 20-29 JS 97-52 × JS 95-56 Central India JNKVV, Jabalpur Green White Present Tawn S
44 JS 20-32 JS 98-63 × JS 93-05 Central India JNKVV, Jabalpur Violet Violet Absent Absent D
45 JS 20-34 JS98-63 × PK 768 Central India JNKVV, Jabalpur Green White Absent Absent D
46 JS 20-41 JS 97-52 × JS 20-02 Central India JNKVV, Jabalpur Green White Absent Absent S
47 JS 20-50 JS 97-52 × JSM 286 Central India JNKVV, Jabalpur Green White Present Tawn S
48 JS 20-53 JS 97-52 × JS 20-02 Central India JNKVV, Jabalpur Violet Violet Present Tawn S
49 JS 20 -59 JS 97-52 × JSM 52 Central India JNKVV, Jabalpur Green White Absent Absent D
50 JS 20-62 JS 97-52 × JS 95-56-B1 Central India JNKVV, Jabalpur Green White Present Tawn S
51 JS 20-63 JS 97-52 × JS 95-56-B2 Central India JNKVV, Jabalpur Green White Present Tawn S
52 JS 20-64 JS 97-52 × JS(IS)90-5-12-1 Central India JNKVV, Jabalpur Violet Violet Present Tawn S
53 JS 20-65 JS 97-52 × JS(IS)90-5-12-1 Central India JNKVV, Jabalpur Violet Violet Present Tawn D
54 JS 20-68 JSM 240 × JSM 189 Central India JNKVV, Jabalpur Green White Absent Absent D
55 JS 20-69 JS 97-52 × SL710 Central India JNKVV, Jabalpur Green White Present Tawn S
56 JS 20-70 JS 97-52 × JSM 120A Central India JNKVV, Jabalpur Green White Absent Absent D
57 JS 20-71 JS 97-52 × JS(15)90-5-12-1 Central India JNKVV, Jabalpur Green White Present Tawn S
58 JS 20-72 JS 99-81 × JS 99-83 Central India JNKVV, Jabalpur Green White Present Tawn D
59 JS 20-73 JS 97-52 × JS 95-56 Central India JNKVV, Jabalpur Green White Present Tawn S
60 JS 20-74 JS 97-52 × SL-710 Central India JNKVV, Jabalpur Green White Present Tawn D
61 JS 20-75 JS 97-52 × JSM 52 Central India JNKVV, Jabalpur Green White Absent Absent S
62 JS 20-76 JS 97-52 × SL 710 Central India JNKVV, Jabalpur Green White Present Tawn D
63 JS 20-77 JS 98-67 × SL 633 Central India JNKVV, Jabalpur Green White Present Tawn I
64 JS 20-78 JS 98-61 × EC-333922 Central India JNKVV, Jabalpur Green White Present Tawn D
65 JS 20-79 JS 97-52 × JS(15)90-5-12-1 Central India JNKVV, Jabalpur Violet Violet Present Tawn S
66 JS 20-80 JS 97-52 × JSM 52 Central India JNKVV, Jabalpur Violet Violet Absent Absent S
67 JS 20-81 JS 98-62 × SL 633 Central India JNKVV, Jabalpur Green White Present Tawn D
68 JS 20-82 JS 97-51 × EC251348 Central India JNKVV, Jabalpur Violet Violet Present Tawn D
69 JS 20-83 JS95-60 × JS-83 Central India JNKVV, Jabalpur Green White Absent Absent D
70 JS 20-84 JS 98-63 × PK 768 Central India JNKVV, Jabalpur Green White Absent Absent D
71 JS 20-85 JS 335 × PK 1308 Central India JNKVV, Jabalpur Green White Present Tawn S
72 JS 20-86 JS20-04 × Brazil Central India JNKVV, Jabalpur Green White Absent Absent S
73 JS 20-87 JS 9752 × JS(15)90-5-12-1 Central India JNKVV, Jabalpur Violet Violet Present Tawn D
74 JS 20-88 JS 97-52 × JSM 299 Central India JNKVV, Jabalpur Green White Present Tawn I
75 JS 20-89 JS 97-52 × JSM 286 Central India JNKVV, Jabalpur Green White Present Tawn S
76 JS 20-90 JS 97-52 × JS 95-56 Central India JNKVV, Jabalpur Green White Present Tawn D
77 JS 20-91 JSM 146 × JSM 1525 Central India JNKVV, Jabalpur Green White Present Tawn S
78 JS(SH) 200-3 JS (SH) 88-66 × JS 335 Central India JNKVV, Jabalpur Green White Present Tawn S
79 MACS 1188 JS (SH) 93-01 × MACS 13 Southern India ARI, Pune Green White Present Tawn S
80 NRC 2 Mutant of Bragg Central India DSR, Indore Green White Present Tawn S
81 NRC 7 Sel. From S-69-96 Central India DSR, Indore Violet Violet Present Tawn S
82 NRC 12 Mutant of Bragg Central India DSR, Indore Violet Violet Present Tawn S
83 NRC 37 Gaurav × Pb-1 Central India DSR, Indore Green White Present Tawn S
84 NRC 57 JS 335 × DS 369 Central India DSR, Indore Violet Violet Present Tawn S
85 NRC 86 RKS 15 × EC 481309 Central India DSR, Indore Violet Violet Present Tawn S
86 NRC 2320 NA Central India DSR, Indore Violet Violet Present Tawn S
87 P-955 NA North India – Violet Violet Present Grey S
88 PB-1 Sel. From Nanking variety North India – Violet Violet Present Tawn D
89 PS 1225 PK 515 × PK 327 North India GBPU A&T, Pantnagar Green White Present Grey S
90 PS 673 NA North India GBPU A&T, Pantnagar Violet Violet Present Tawn S
91 PS 1308 T 49 × PS 1024 North India GBPU A&T, Pantnagar Green White Present Tawn D
92 PS 73-22 D-69-3881 North India GBPU A&T, Pantnagar Violet Violet Present Grey D
93 PLSO 79 – – – Violet Violet Present Tawn D
94 PLSO 90 – – – Violet Violet Present Grey D
95 RKS-24 PK 472 × PK 1024 Central India ZARS, Kota, Rajasthan Green White Present Tawn S
96 SL 96 Botato × JS-3 North India PAU, Ludhiana Green White Present Tawn D
97 SL 525 PK 416 × PK 1023 North India PAU, Ludhiana Green White Present Tawn D
98 SL 599 PK 416 × SL 269 North India PAU, Ludhiana Green White Present Tawn S
99 SL 738 SL 317 × E 4 North India PAU, Ludhiana Green White Present Tawn D
100 SL 742 SL 457 × SL 459 North India PAU, Ludhiana Green White Present Tawn D
101 SL 747 SL 517 × SL 295 North India PAU, Ludhiana Green White Present Tawn D
102 SISTA 194 – – NA Violet Violet Present Tawn S
103 VLS-58 DS 54 × VLS 2 North India VPKAS, Almora Green White Present Tawn S
104 VLS-73 PRS 8901 × PK 564 North India VPKAS, Almora Violet Violet Absent Absent D
105 WT-89 – – NA Violet Violet Present Tawn D
106 JSM 184 JS 335 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
107 JSM 119 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
108 JSM 120 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
109 JSM 122 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Green White Absent Absent S
110 JSM 185 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn D
111 JSM 188 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
112 JSM 189 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
113 JSM191 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn I
114 JSM 195 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
115 JSM 265 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
116 JSM 266 JS 335 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
117 JSM -30 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Green White Absent Absent D
118 JSM -131 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
119 JSM 139 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
120 JSM 203 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
121 JSM 207 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Green White Absent Absent D
122 JSM 269 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
123 JSM 271 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn D
124 JSM 275 JS 93-05 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
125 JSM-104 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
126 JSM-154 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
127 JSM-155 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
128 JSM-220 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn I
129 JSM-223 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn I
130 JSM-224 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
131 JSM-225 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
132 JSM-226 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
133 JSM-227 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
134 JSM-228 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
135 JSM-236 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
136 JSM-276 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
137 JSM-277 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn D
138 JSM-284 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Absent Absent S
139 JSM-298 NRC 37 (250 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
140 JSM-115 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn D
141 JSM-155 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
142 JSM-171 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Absent Absent S
143 JSM-239 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
144 JSM-250 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
145 JSM-258 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn S
146 JSM-285 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
147 JSM-294 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Green White Present Tawn S
148 JSM-306 NRC 37 (300 GY) Mutant line JNKVV, Jabalpur Violet Violet Present Tawn D
Open in a new tab

HC hypocotyl colour, FC flower colour, PH presence of hairs, CH colour of hairs, GT growth type (D determinate, I indeterminate, S semideterminate), S. serial number

SSR analysis

Genomic DNA was isolated from pooled young leaves of five plants of each genotype selected as representative plants for morphological analysis using CTAB protocol (Saghai Maroof et al. 1984) with necessary modifications. The quality of DNA was checked by horizontal submarine gel electrophoresis on 0.8% agarose gel along with the λ Hind-III standard DNA. Fifty four SSRs markers evenly distributed on 20 soybean genetic linkage groups (Cregan et al. 1999) were firstly screened for polymorphism among some genotypes. Twenty six of them (Table 2) with clearly amplified polymorphic bands were further used in the genotyping of all the genotypes. Information of these SSR primers is available at http://www.soybase.org.

Table 2.

Details of SSR markers used for diversity analysis among 148 soybean genotypes and their characterization

S. Primer Primer sequence 5′–3′ Trait associated LG Motif References
1. Satt119 F: TGTGCCAGTGTTGATAGTTA Seed fucose 1-1 A2 (ATT)13 Cregan et al. (1999)
R: CTGATCCCCAATAAATCTG
2. Satt245 F: AACGGGAGTAGGACATTTTATT Pubescence density M (ATT)13(ATG) Cregan et al. (1999)
R: GCGCCTCCTGAATTTCAAAGAATGAAGA
3. Satt281 F: AAGCTCCACATGCAGTTCAAAAC Seed yield C2 (ATT)19 Cregan et al. (1999)
R: TGCATGGCACGAGAAAGAAGTA
4. Sat_246 F: GCGCATGGTTTACAGATTACTTTATTTTCTA Seed weight C2 (AT)22(GT) Cregan et al. (1999)
R: GCGGCAATCATTTAAATTTATAATGATATAT
5. Satt433 F: ATCAGCTGCATAAGTAAAGATACA Photoperiod insensitivity C2 (ATT)16 Cregan et al. (1999)
R: ACATGCTTGCAGAGGTGAATA
6. Satt177 F: CGTTTCATTCCCATGCCAATA Seed weight A2 (ATT)16 Cregan et al. (1999)
R: CCCGCATCTTTTTCAACCAC
7. Satt527 F: GCGGTTACATCTTGCAAACTAAATTAAC Plant height, seed weight L (ATT)17 Cregan et al. (1999)
R: GCGGAATTTTGCACATAAATTAATAACT
8. Satt448 F: GCGCTAAGGGCAATTTTATTCAA Phytoph 9-6 L (ATT)15 Cregan et al. (1999)
R: GCGCAGCCTGTTCAGTTTTTCTTTTGTC
9. Satt160 F: TCCCACACAGTTTTCATATAATATA Hypocotyl length, seed coat cracking F (ATT)30 Cregan et al. (1999)
R: CATCAAAAGTTTATAACGTGTAGAT
10. Sat_228 F: GCGTGACTACGGGAAGTTGGAAC Seed palmitic F (AT)24 Song et al. (2004)
R: GCGTTGGCGGTAAGAGCACTATA
11. Satt686 F: ACGGAAAATAAATGAAACTAAGA Flowering time J (ATT)14 Cregan et al. (1999)
R: GCGCTATCAGATAGAGAAGCAGAAGAAT
12. Satt184 F: GCGCTATGTAGATTATCCAAATTACGC Flowering time, seed weight D1a (ATT)13 Cregan et al. (1999)
R: GCCACTTACTGTTACTCAT
13. Satt236 F: GCGTGCTTCAAACCAACAAACAACTTA Flowering time G (ATT)19 Cregan et al. (1999)
R: GCGGTTTGCAGTACGTACCTAAAATAGA
14. Satt235 F: GCGGGCTTTGCCAAGAAGTTT Plant height G (ATT)16 Cregan et al. (1999)
R: GCGGTGAGGCTGGCTATAAG
15. Satt418 F: GCGAAAGCACATATGGGTTTGAAT Plant height L (ATT)27 Cregan et al. (1999)
R: GCGAGGGCATATATATGATGAGGTA
16. Satt518 F: GCGCATATCAAATTGCATATAAAAATACG Plant height D2 (ATT)19 Cregan et al. (1999)
R: GCGGGAATATAAAATAAAAATGCTCACTT
17. Satt154 F: AGATACTAACAAGAGGCATAAAACT 100 Seed weight D2 (ATT)20 Cregan et al. (1999)
R: AAAGAAACGGAACTAATACTACATT
18. Satt442 F: CCTGGACTTGTTTGCTCATCAA 100 Seed weight H (ATT)35 Cregan et al. (1999)
R: GCGGTTCAAGGCTTCAAGTAGTCAC
19. Satt042 F: GACTTAATTGCTTGCTATGA Number of nodes A1 (ATT)27 Cregan et al. (1999)
R: GTGGTGCACACTCACTT
20. Satt130 F: TAAACGAAATTTAGTTTTAAGACT Maximum internode length G (ATT)14 Cregan et al. (1999)
R: TGAATGGCTAAAAACGTGATT
21. Satt292 F: GCGGAATTAGAACTCCAGTAAAGA 100 Seed weight, Pod maturity D1b (ATT)16 Cregan et al. (1999)
R: GCGAGGCCAACATTGAAAAGT
22. Satt280 F: GCGGAATCTGCTTATTCATTGTGTG Days to maturity J (ATT)14 Cregan et al. (1999)
R: GCGCCATGCTGTAACACGTCAAT
23. Satt275 F: GCGGGATAATTGGTTTTACGAAAATGC Plant height G (ATT)11 Chang et al. (2011)
R: GCGCCTAATCACCTAAAAAAACGTTTA
24. Satt114 F: GGGTTATCCTCCCCAATA 100 Seed weight F (ATT)17 Cregan et al. (1999)
R: ATATGGGATGATAAGGTGAAA
25. Satt510 F: GCGAGTTTCGCCGTTACCACCTCAGCTT 100 Seed weight, seed protein F (ATT)21 Cregan et al. (1999)
R:CCCTCTTATTTCACCCTAAGACCTACAA
26. Sat_076 F: GCGTAATTAACACCAATATATGACATG Seed coat cracking C2 (AT)40 Cregan et al. (1999)
R: GCGGGGTTAAAAATTCAAAATGT
Open in a new tab

S. serial number, LG linkage group

The PCR reaction was conducted in a reaction volume of 10 μl containing 1× PCR buffer, 100 μM dNTPs, 0.4 μM of each primer, 1.2 mM MgCl2, 0.5 units Taq DNA polymerase (recombinant) and 25 ng template DNA. PCR amplification was performed with initial denaturation at 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 45–65 °C for 30 s, 72 °C for 45 s and final extension at 72 °C for 5 min before cooling down to 4 °C.

The PCR products for SSR were resolved by electrophoresis on 3% (w/v) agarose gels stained with ethidium bromide (10 mg/ml) and photographed under UV-light in Syngene Multigenious Bioimager. Molecular size of bands was estimated using a wide range 100 bp ladder (Fermentas Life Sciences, USA).

Analyses of genetic diversity and population structure

Amplified fragments of different sizes were considered as different alleles. DNA bands that were amplified by a given primer were scored as present (1) or absent (0) for all the samples under study. In order to determine the utility of these markers, number of amplicons/alleles per marker, major allele frequency, polymorphic information content (PIC), effective multiplex ratio (EMR)/resolving power (RP), discrimination power (DP) and marker index (MI) were calculated. The PIC value of individual primer was calculated by the formula PIC = 1 − ∑ni= 1 P2ij (Jain et al. 2004). MI, a product of information content, as measured by PIC and EMR was calculated (Powell et al. 1996). RP and DP of each primer combination were calculated using standard methods proposed by Anderson et al. (1993) and Prevost and Wilkinson (1999) respectively. Dendrogram was generated using software PowerMarker version 3.25 (Liu and Muse 2005) to estimate the unweighted pair group method with arithmetic average (UPGMA) and the Nei’s genetic distances (Nei 1972) between genotypes.

Population structure of these 148 genotypes was estimated using STRUCTURE V2.3.4 software (Pritchard et al. 2000). Admixture and independent allele frequencies model was used in estimating proper subgroups. The number of subgroups (K) was set from 1 to 10 with 10 runs performed separately. In the present analysis, the burn-in period of 50,000 and Monte Carlo Markov Chain replicates of 100,000 and allele frequencies in correlation was used (Pritchard and Wen 2003). The maximum likelihood run was applied to allocate individual genotypes into a specific group. Further, the genotypes were assigned their groups according to affiliation probabilities (inferred ancestry). The genotypes with 80% affiliation probabilities or more were grouped to a separate group in comparison to those with < 80%. According to grouping, the genotypes with < 80% affiliation probability were considered as admixture which means the genotypes give the impression to have a mixed parentage belonging to dissimilar gene pools or sources. The importance of population delineation clustered by STRUCTURE 2.3.4 was additionally investigated by performing a testing of molecular variance (AMOVA) with Arlequin 3.5 (Excoffier and Lischer 2010). The FST values were calculated using Arlequin software.

Results and discussion

Availability of genetic diversity within the crop species provides a base for its improvement. The cultivated soybean varieties are the results of the selection from diverse sources available in various environments. Soybean improvement involves recognition of vastly dissimilar germplasm with decidedly polymorphic molecular markers which are important for the mapping of genes/QTLs for significant traits and their consequent use in molecular breeding. Identification of dissimilar genotypes with molecular markers is helpful over the conventional breeding. SSRs molecular markers find its application in analysis of genetic diversity, identification of genotypes and population structure assessment in soybean (Bisen et al. 2015; Torres et al. 2015).

Diversity in the soybean collection

All the 148 soybean accessions were categorized on the basis of their morphological characteristics and UPGMA clustering grouped them accordingly (Fig. 1). In addition, they were genotyped with 26 traits linked microsatellite markers (Table 2) and were categorized on the basis of their ability to generate amplicons, polymorphism level and reliability of the pattern. Out of 26 traits linked microsatellite markers, all were found to be polymorphic revealing more than one allele in all the genotypes. As an example, gel picture showing banding pattern of 148 genotypes of soybean with Satt527 marker is given in Fig. 2. All the amplified 71 allele were found to be polymorphic (100%) with an average of 2.73 polymorphic alleles per primer (Table 2). Similar results have been observed by different groups working on soybean genetic diversity based on microsatellite markers as 53 soybean cultivars with 53 SSR markers amplified alleles with an average of 2.34 per locus (Vieira et al. 2009). In one of our earlier studies, 94% polymorphic alleles with an average of 2.10 per primer were obtained (Tomar et al. 2011). In another study, 97% polymorphic alleles with an average of 3.21 have been reported (Bommi and Ferguson 2005) while 95% alleles amplified by SSR markers were found to be polymorphic among 40 soybean genotypes (Narvel et al. 2000).

Fig. 1.

Fig. 1

Open in a new tab

UPGMA dendrogram showing relationship among 148 soybean genotypes based on morphological data. Colours indicate groups and subgroups of soybean genotypes

Fig. 2.

Fig. 2

Open in a new tab

Electrophoretic illustration of marker Satt527 showing banding pattern with 148 soybean genotypes

Genetic diversity for specific locus was evaluated by polymorphic information content (PIC). PIC value is an indication of allelic diversity and frequency among the genotypes analyzed and in the present study, eight markers exhibited PIC values greater than 0.5. Highest PIC value (0.69) was observed for the primer Satt245 and lowest PIC value (0.01) was recorded for the primer Satt527 (Table 3) with an average of 0.375. However, in an earlier study, PIC ranging from 0.7447 (Satt423) to 0.8585 (Satt155) with an average of 0.8040 was obtained from 178 accessions of Korean soybean using 9 microsatellite markers (Velusamy et al. 2013). In our study, all the primers were polymorphic. This high rate of SSR polymorphism may be attributed to the selected set of SSR markers which were already tested for polymorphism among a set of genotypes (Tomar et al. 2011). The highest genetic diversity in the present study among soybean genotypes supports previous statement (Powell et al. 1996) that SSRs have elevated discriminatory power compared to other molecular markers.

Table 3.

List of microsatellite markers used for genotyping soybean genotypes along with their genetic diversity parameters

S. Primer NA MAF PIC MI RP DP
1. Satt119 3 0.81 0.26 0.70 0.76 0.38
2. Satt245 5 0.49 0.69 1.49 0.96 0.68
3. Satt281 4 0.42 0.55 1.28 0.82 0.44
4. Sat_246 3 0.52 0.32 0.98 0.78 0.42
5. Satt433 3 0.92 0.12 0.38 0.83 0.54
6. Satt177 3 0.73 0.31 0.71 0.46 0.29
7. Satt527 3 0.99 0.01 0.30 0.65 0.36
8. Satt448 3 0.58 0.45 1.03 0.71 0.55
9. Satt160 4 0.51 0.54 1.39 0.88 0.51
10. Sat_228 2 0.73 0.31 0.33 0.39 0.19
11. Satt686 3 0.81 0.25 0.68 0.77 0.23
12. Satt184 4 0.39 0.68 1.29 0.84 0.39
13. Satt236 4 0.42 0.55 1.26 0.79 0.41
14. Satt235 3 0.52 0.52 0.97 0.44 0.42
15. Satt418 3 0.92 0.22 0.46 0.49 0.39
16. Satt518 2 0.73 0.31 0.31 0.38 0.20
17. Satt154 3 0.99 0.21 0.44 0.68 0.37
18. Satt442 4 0.58 0.45 0.89 0.95 0.56
19. Satt042 4 0.51 0.54 1.07 0.92 0.49
20. Satt130 3 0.73 0.31 0.88 0.83 0.41
21. Satt292 3 0.89 0.26 0.69 0.73 0.33
22. Satt280 2 0.73 0.32 0.31 0.66 0.28
23. Satt275 3 0.93 0.21 0.38 0.87 0.42
24. Satt114 4 0.55 0.46 0.99 0.91 0.51
25. Satt510 4 0.50 0.55 1.37 0.72 0.44
26. Sat_076 2 0.67 0.34 0.31 0.56 0.29
Total 71 18.78 9.74 20.89 17.57 10.5
Average 2.73 0.722 0.375 0.803 0.676 0.404
Open in a new tab

NA number of alleles, MAF major allele frequency, PIC polymorphism information content, MI marker index, RP resolving power, DP discrimination power

In genotypic characterization, UPGMA cluster analysis grouped soybean genotypes initially into two groups (Fig. 3). Group A contained ten mutant soybean lines derived from NRC 37 and group B had one hundred thirty eight genotypes with some mutant lines derived from JS 335 and JS 93-05. Group A further divided into two subgroups A1 and A2. Subgroup A1 had only two genotypes while A2 had eight genotypes. Group B was further divided into two subgroups B1 and B2. Subgroup B1 contained twenty seven genotypes including the genotypes of exotic selection, while B2 had 111 remaining genotypes. Group B contained all the varieties released by Jawaharlal Nehru Agriculture University, Jabalpur, India and Directorate of Soybean Research, ICAR, Indore, India. This similarity among group B can be attributed to the use of common ancestors for the development of these genotypes. Subgroup B2 was further divided into C and D. Subgroup C contained sixty one genotypes while subgroup D had fifty genotypes. Subgroup C had two parts C1 and C2. Part C1 contained only nine genotypes and part C2 had fifty two genotypes. Among a total of 43 mutant lines, 33 were grouped in part C2. Subgroup D was divided into D1 and D2. Part D1 contained forty one genotypes while part D2 had only nine genotypes.

Fig. 3.

Fig. 3

Open in a new tab

UPGMA dendrogram showing relationship among 148 soybean genotypes based on SSR data

The relevant values for genetic variation across all the 148 genotypes obtained after application of trait linked markers in the form of polymorphism information content, resolving power, major allele frequency, discrimination power and marker index are given in Table 3. The MI values ranged from 0.30 to 1.49 with an average of 0.84. The RP is an attribute of marker that represents the discriminatory potential of the primer and it ranged from 0.38 to 0.96 with an average of 0.72 for polymorphic marker. Major allele frequency ranged from 0.39 to 0.99 among polymorphic markers with an average of 0.68 (Table 3 and Fig. 4). Whereas, the DP values ranged from 0.19 to 0.68 with an average of 0.40. The allele number per locus varied from 2 to 5 with an average of 2.73 alleles per locus (Table 3).

Fig. 4.

Fig. 4

Open in a new tab

Major allele frequency of polymorphic SSR markers used for population STRUCTURE analysis of 148 soybean genotypes

Population structure

Admixture model based structure simulations were performed by shifting K from 1 to 10 with 10 iterations using all the 148 genotypes and 26 polymorphic markers. The entire population was divided into three groups A, B and C indicating 33.78% (50), 23.65% (35), and 42.57% (63) of genotype correspondingly and the inferred population structure is given in Fig. 5. Availability of genetic dissimilarity in groups was tested using Fst statistics. The groups (A, B and C) showed Fst values of 0.7626, 0.7809 and 0.9735 respectively with an average of 0.8398 representing high population structure. Therefore, most structured group was C followed by B and A. The group A and B consisted genotypes of mixed origins however, group C consisted most of the mutant lines developed at Jawaharlal Nehru Agriculture University, Jabalpur.

Fig. 5.

Fig. 5

Open in a new tab

Assignment of 148 soybean into three subpopulations (a, b and c) using STRUCTURE 2.3.4 software

Three groups generated from structural analysis in the present study were also subjected to analysis of variance (AMOVA) to assess the percentage of diversity among populations and within population. In the total genetic variance among group, 31.39% was accredited to the populations on the basis of structure, and the remaining 69.61% was due to divergence among the individual within a group (Table 4). The results of AMOVA and Fst analysis confirm the results obtained through cluster analysis, similarity coefficient distribution and structure analysis indicating the presence of statistically moderate genetic diversity with high population structure. The results obtained through structure analysis and distance-based clustering are in agreement with each other except few of the mutant genotypes. This confirmation is a decisive factor before carrying out association mapping (AM) analysis.

Table 4.

Analysis of molecular variance (AMOVA)

Source of variation d.f. Sum of squares Variance components Percentage variation
Among groups 2 148.308 1.17324 31.39
Within groups 148 522.366 1.78527 69.61
Total 150 522.366 2.95851
Open in a new tab

Conclusion

Results of the present study indicated the studied Indian soybean germplasm has moderate diverse genetic base and high population structure. Hence, the highly diverse genotypes found in this study can be utilized for the future soybean breeding programmes. Also, the genetically variable genotypes and highly polymorphic SSR markers identified throughout this study can be used for the association mapping (AM), QTLs/genes identification for different quality traits of soybean.

Acknowledgements

Research was conducted in “Technical Cooperation Project for Maximization of Soybean Production in Madhya Pradesh” supported by Japan International Cooperation Agency (JICA), Japan.

Compliance with ethical standards

Conflict of interest

Authors declare that they have no conflicts of interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Almeida RD, Peluzio JM, Afferri FS. Divergência genética entre cultivares de soja, sob condições de várzea. Rev Ciênc Agron. 2011;42:108–115. doi: 10.1590/S1806-66902011000100014. [DOI] [Google Scholar]
  2. Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrells ME. Optimizing parental selection for genetic linkage maps. Genome. 1993;36:181–186. doi: 10.1139/g93-024. [DOI] [PubMed] [Google Scholar]
  3. Bisen A, Khare D, Nair P, Tripathi N. SSR analysis of 38 genotypes of soybean (Glycine max (L.) Merr.) genetic diversity in India. Physiol Mol Biol Plants. 2015;21:109–115. doi: 10.1007/s12298-014-0269-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bommi P, Ferguson DL. Soybean cultivars Identification within a selected group using only an agarose gel system with simple sequence repeats DNA markers. Soybean Genet Newsl. 2005;32:1–7. [Google Scholar]
  5. Chang SH, Teng TT, Ismail N. Screening of factors influencing Cu (II) extraction by soybean oil-based organic solvents using fractional factorial design. J Environ Manage. 2011;92(10):2580–2585. doi: 10.1016/j.jenvman.2011.05.025. [DOI] [PubMed] [Google Scholar]
  6. Cregan PB, Jarvik T, Bush AL, Shoemaker RC, Lark KG, Kahler AL, Kaya N, VanToai TT, Lohnes DG, Chung J, Specht JE. An integrated genetic linkage map of the soybean. Crop Sci. 1999;39:1464–1490. doi: 10.2135/cropsci1999.3951464x. [DOI] [Google Scholar]
  7. Cunha MCG, Hamawaki OT, Sousa LB. Genetic variability among 79 soybean progenies from UFU breeding program. Biosci J. 2013;29:340–349. [Google Scholar]
  8. Excoffier L, Lischer HEL. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10:564–567. doi: 10.1111/j.1755-0998.2010.02847.x. [DOI] [PubMed] [Google Scholar]
  9. Jain S, Jain RK, McCouch SR. Genetic analysis of Indian aromatic and quality rice (Oryza sativa) germplasm using panels of fluorescently-labeled microsatellite markers. Theor Appl Genet. 2004;109:965–977. doi: 10.1007/s00122-004-1700-2. [DOI] [PubMed] [Google Scholar]
  10. Liu K, Muse S (2005) Power marker: new genetic data analysis software. Release 3.0. http://powermarker.net; verified 9 September
  11. Narvel JM, Fehr WR, Chu WC, Grant D, Shoemaker RC. Simple sequence repeats diversity among soybean plant introductions and elite genotypes. Science. 2000;40:1452–1458. [Google Scholar]
  12. Nei M. Genetic distance between populations. Am Nat. 1972;106:283–292. doi: 10.1086/282771. [DOI] [Google Scholar]
  13. Powell W, Machray GC, Provan J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996;1:215–222. doi: 10.1016/S1360-1385(96)86898-0. [DOI] [Google Scholar]
  14. Prevost A, Wilkinson MJ. A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theor Appl Genet. 1999;98:107–112. doi: 10.1007/s001220051046. [DOI] [Google Scholar]
  15. Pritchard JK, Wen W (2003) Documentation for STRUCTURE software: Version 2. Available from http://pritch.bsd.uchicago.edu
  16. Pritchard JK, Stephens P, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–959. doi: 10.1093/genetics/155.2.945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Saghai Maroof MA, Soliman KM, Jorgensen RA, Allard RW. Ribosomal DNA spacer—length polymorphism in barley: Mendelian inheritance, chromosomal location and population dynamics. Proc Natl Acad Sci (USA) 1984;81:8014–8018. doi: 10.1073/pnas.81.24.8014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Song QJ, Marek LF, Shoemaker RC, Lark KG, Concibido VC, Delannay X, Specht JE, Cregan PB. A new integrated genetic linkage map of the soybean. Theor Appl Genet. 2004;109(1):122–128. doi: 10.1007/s00122-004-1602-3. [DOI] [PubMed] [Google Scholar]
  19. Tomar J, Saini N, Goyal BS, Tripathi N, Shrivastava AN, Verma RK, Tiwari S. Assessment of genetic diversity among Rhizoctonia root rot resistant soybean. J Food Leg. 2011;24:267–272. [Google Scholar]
  20. Torres AR, Grunvald AK, Martins TB, Santos MAD, Lemos NG, Silva LAS, Hungria M. Genetic structure and diversity of a soybean germplasm considering biological nitrogen fixation and protein content. Sci Agric. 2015;7:47–52. doi: 10.1590/0103-9016-2014-0039. [DOI] [Google Scholar]
  21. Velusamy V, Lee KJ, Ha BK, Kim JB, Kim SH, Ahn JW, Kang SY, Kim DS. Evaluation of genetic diversity in Korean soybean landraces by protein banding patterns using high-throughput screening. J Crop Sci Biotechnol. 2013;16:189–195. doi: 10.1007/s12892-013-0068-8. [DOI] [Google Scholar]
  22. Vieira ESN, Schuster I, Silva RB, Oliveira MAR. Variabilidade genética em cultivares de soja determinada com marcadores microssatélites em gel de agarose. Pesq Agropec Bras. 2009;44:1460–1466. doi: 10.1590/S0100-204X2009001100013. [DOI] [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES