Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2019 Jul 24;9(8):305. doi: 10.1007/s13205-019-1842-1

Effectiveness of Bacillus pumilus PDSLzg-1, an innovative Hydrocarbon-Degrading Bacterium conferring antifungal and plant growth-promoting function

Kun Hao 1,2, Hidayat Ullah 2,3, Xinghu Qin 4, Hongna Li 1, Feng Li 1, Ping Guo 1,✉
PMCID: PMC6656838  PMID: 31355114

Abstract

Genome of the hydrocarbon-degrading bacterium Bacillus pumilus PDSLzg-1 was analyzed. A group of gene clusters and pathways associated with nitrogen fixation, plant-bacterial interactions, plant growth-promoting hormone synthesis, antibiotics, secondary metabolite, and disease resistance were identified. In addition, 0.06 mg/L of 3-indoleacrylic acid (IAA) and 2 mg/L of gibberellin (GA) were, respectively, detected in PDSLzg-1 fermentation broth by high-performance liquid chromatography (HPLC). Up-regulated expression levels of 11 key genes related to GA and IAA biosynthesis pathways were detected after the induction of 0.2% n-hexadecane. Furthermore, bioassays showed that PDSLzg-1 fermentation could significantly promote the length and biomass of the stems and roots of Triticum aestivum L., while inhibited Colletotrichum truncatum colonization. Results indicated that B. pumilus PDSLzg-1 had plant growth-promoting and antifungal functions, besides its potential applications in phyto-microbial bioremediation combinations for oil-contaminated soil.

Electronic supplementary material

The online version of this article (10.1007/s13205-019-1842-1) contains supplementary material, which is available to authorized users.

Keywords: Antifungal, Plant hormones, Phyto-microbial remediation, Plant growth-promoting rhizobacteria

Introduction

Oil-contaminated soil is a serious global environmental problem that ultimately affects human health via the food chain. In recent years, combinations of phyto-microbial applications for oil-contaminated soil bioremediation have garnered wide-spread attention of researchers and industrialists (Xu et al. 2014; Vergani et al. 2017). Plants, which play an important role in the removal of pollutants either directly or indirectly, are hyper-accumulators and accelerators that can bio-accumulate, accelerate biodegradation and decrease the toxicity level of contaminants in soil (Cunningham et al. 1995). Plants can also enhance the survival and activity of rhizosphere microorganisms that accelerate the biodegradation of pollutants. On the other hand, plant growth promoting rhizobacteria (PGPR) can enhance phytoremediation by increasing plant phytotoxicity threshold and greatly enhancing the biomass accumulation (Gurska et al. 2009; Sampaio et al. 2019). Accordingly, there is a dire need to find PGPR that can effectively degrade crude oil.

Bacillus pumilus, which consume carbon sources from plant rhizosphere, provides protection; serve as growth promoter, and nitrogen source for plants (Tsavkelova et al. 2006; Hernandez et al. 2009; Das et al. 2015). Bacillus species are thought to promote plant growth through the synthesis of many compounds (He et al. 2013), such as 1-amino-cyclopropane-1-carboxylic acid (ACC), siderophores, 3-indoleacrylic acid (IAA) and gibberellin (GA). Bacillus species that can also produce certain lipopeptide antibiotics that are regarded as strong biosurfactants and antifungal substance (Stein 2005; Khanna et al. 2011). Therefore, this species is often applied as predominant plant-growth promoter and bio-control agent in certain plants and field vegetables (Kang et al. 2013; Ren et al. 2013; Anith et al. 2015; Heidarzadeh and Baghaee-Ravari 2016).

Relationship between oil degradation and plant growth promotion in PGPR is still not clear besides the fact that many Bacillus strains have been proved to utilize crude oil as a carbon and energy resource (Kafilzadeh et al. 2013), and a significant number of crude oil degrading Bacillus species have been isolated (Feitkenhauer et al. 2003; Kato et al. 2010; Chettri et al. 2016). Furthermore, the mechanism by which PGPR utilize long-chain alkanes to promote plant growth has to be clearly addressed. Accordingly, a comprehensive genome-based study of this multifunctional crude oil-degrading bacterium is needed. In the present study, we mainly investigated plant hormone biosynthesis and plant growth-promoting function of B. pumilus PDSLzg-1 via genome analysis, HPLC, real-time PCR and bioassay. The results of this study will aid in the development of a better understanding of how PGPR interacts with plants on oil-contaminated land and generate insights for the potential application of combined phyto-microbial bioremediation with B. pumilus PDSLzg-1.

Materials and methods

Bacterial strain and bio-informatic analysis

The long-chain alkane degrading B. pumilus strain PDSLzg-1 was isolated from oily sludge from the bottom of flotation tanks located in the Shengli oil field of Shandong province (37°39′N, 118°23′E), People’s Republic of China in 2015 and transported to the research laboratory.

The genome of B. pumilus PDSLzg-1 was sequenced and annotated accordingly. Complete annotated genome and plasmid sequences were deposited in GenBank under accession numbers CP016784 and CP016785, respectively (Hao et al. 2016). Additionally, a whole genome BLAST search (E value less than 1 e−5 and minimal alignment length percentage larger than 40%) was performed against Pathogen Host Interactions (PHI), Antibiotic Resistance Genes Database (ARDB) and Carbohydrate-Active EnZymes Database (CAZy) (Cantarel et al. 2008; Liu and Pop 2008; Vargas et al. 2012). Secretory proteins were detected on the genome assembly via SignalP (Petersen et al. 2011). Type I–VII secretion system-related proteins were extracted from the annotation results and secondary metabolite gene clusters were predicted via antibiotics & Secondary Metabolite Analysis SHell (antiSMASH) as per available protocol (Blin et al. 2013).

High-performance liquid chromatography

Standard compounds obtained from Sigma London Ltd., including 3-Indoleacrylic acid (IAA) (≥ 98%, HPLC) and gibberellin A3 basis (GA of total gibberellins) (≥ 90%). HPLC grade solvents (water, acetonitrile and methanol) were obtained from Merck KgA (Darmstadt, Germany).

Analysis was performed on a Dionex Ultimate 3000 HPLC system (Dionex, Germany) equipped with a pump (LPG 3X00), auto sampler (ACC-3000), column oven, and diode array UV/VIS detector [DAD-3000 (RS)]. The output signal of the detector was recorded using a Dionex Chromeleon™ Chromatography Data System. Separation was executed on a XCAPCELL PAK SG 300 C 18 column (250 mm × 4.6 mm × 5 μm) (Shiseido, Japan). The mobile phase was composed of 15% acetonitrile, 40% methanol and 45% water (pH 4.0) with a 20 min gradient elution system at a flow rate of 1.0 mL/min. The injection volume was 10 μL using detection UV wavelength of 210 nm and with a column temperature of 25 °C.

Five concentrations of GA and IAA mixed solutions (GA: 50 mg/L, 40 mg/L, 30 mg/L, 20 mg/L and 10 mg/L; IAA: 10 mg/L, 6 mg/L, 3 mg/L, 1.5 mg/L and 0.8 mg/L) were used to establish calibration curves, which were found to be y = 0.207x + 0.0627 with R2 = 0.9999 and y = 1.1911x + 0.0499 with R2 = 0.9996, respectively (Figure S1). The stock solutions were stored at 4 °C. B. pumilus PDSLzg-1 was incubated with 50 mL of Luria–Bertani (LB) medium at 30 °C on a rotatory shaker (180 rpm) for 72 h with 3 replications. After incubation, the media were centrifuged for 10 min (5000g at 4 °C) and bacteria were removed. Samples were extracted from the fermentation broth twice with equal volumes of ethyl acetate. The ethyl acetate layer was evaporated to dryness at below 40 °C in a rotary evaporator, after which the residue was dissolved in 2 mL of methanol and stored at 4 °C. The sample solution was then filtered through a 0.22 μm filter before injecting to HPLC. The GA/IAA concentration of the fermentation broth was equal to the determined concentration divided by 25. The results were expressed as means ± the standard error (SE) of the replicates. Significant differences between concentrations were identified using the Student’s t test with a p-value threshold of 0.05.

The expression profiles by real-time PCR

Two samples, 0.2% n-hexadecane treated B. pumilus PDSLzg-1 (24 h) and blank control by the above-described methods were used to extract total RNA. Total RNA was extracted by MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) and was analyzed on a Nanodrop 2000 (Thermo Scientific Inc., Pittsburg, PA, USA) to determine RNA concentration and immediate use for cDNA synthesis. Total RNA from each sample was converted into first-strand cDNA using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). Genes related to plant hormone biosynthesis were used to design specific primers (Table 1) and then validated using quantitative real-time PCR (qPCR). The real-time PCR was performed with the SYBR Premix ExTaq™ (TaKaRa, Dalian, China) on the ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The 16S rDNA was used as a reference control. The reaction was performed using the following conditions: denaturation at 95 °C 60 s, followed by 40 cycles of amplification (95 °C 15 s, 60 °C 50 s). Each plate was repeated thrice in independent runs for all reference and selected genes. Gene expression was evaluated by the 2−ΔΔCt method (Livak and Schmittgen 2001).

Table 1.

List of specific primers used in real-time PCR

Gene name Primer name Primer sequences
N-acetyltransferase BEN31_RS18030 F1 GCTTAGAGACAGGTGCGATGT
BEN31_RS18030 R1 TATGAACCGAAAGGCGGA
L-2,4-diaminobutyrate decarboxylase BEN31_RS10560 F1 GCAGAGGTGATGGTGAGTTC
BEN31_RS10560 R1 CCGCTTGTAAATGTCCCA
Bifunctional P-450/NADPH-P450 reductase BEN31_RS07480 F1 GGCGATGATTTACTGTCCCT
BEN31_RS07480 R1 TTGTTGTTTCGTGCCCAG
Hydrolase BEN31_RS14025 F1 AGAAGCCATCCATCAGCAG
BEN31_RS14025 R1 TGCGTTCACCGTTTACATCT
Cytochrome P450_1 BEN31_RS16020 F1 CATCTCTTATCCGCTTCCTGT
BEN31_RS16020 R1 ACATCCTCCTCATCTTCGCT
Cytochrome P450_2 BEN31_RS06780 F1 TGCTGGTAATGAGACAACGAC
BEN31_RS06780 R1 TTGAGGAATAAGAGAGCGGTC
1-Deoxy-d-xylulose-5-phosphate synthase BEN31_RS05160 F1 GCGGATGTTTGATGTAGGAA
BEN31_RS05160 R1 GCACTTGGTCATAGGCTCTTT
1-Deoxy-d-xylulose 5-phosphate reductoisomerase BEN31_RS08025 F1 TCAGGTGGTAGTTTCCGAGA
BEN31_RS08025 R1 CCTTTATTCATCATCGTCGC
2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase BEN31_RS15165 F1 GGCACCTTACATTCAACCAA
BEN31_RS15165 R1 ATTCCTTCGCCTCTTCCTG
2-C-methyl-d-erythritol 4-phosphate cytidylyltransferase BEN31_RS15170 F1 CATACACAGATTGACTTGCTCG
BEN31_RS15170 R1 TGTTCCACTTTGCCTTCTTG
4-Diphosphocytidyl-2-C-methyl-D-erythritol kinase BEN31_RS15475 F1 TCCAGTCGCAGCAGGTTTA
BEN31_RS15475 R1 AAGGACACATCTGAGCCGA
16S rDNA 16SrDNA F1 AACCTGCCTGTAAGACTGGGAT
16SrDNA R1 GCGGGTCCATCTGTAAGTGA
Open in a new tab

Antifungal activity of PDSLzg-1 fermentation

To test the excretion of antifungal metabolites by endophytic bacteria, PDSLzg-1 was transferred to a 15 mL tube with 4 mL of LB liquid media. The solution was then incubated in shaking flasks at 180 rpm for 24 h at 30 °C. Next, 1:10 (v:v) solution of PDSLzg-1 fermentation and LB medium were added into potato dextrose agar (PDA) medium. Following removal of the endophytic cells by centrifugation of the culture broth at 6000g for 10 min and filtration through 0.22 μm membrane filter, 1 mL of the culture filtrate was mixed with 14 mL of PDA medium containing ampicillin (400 μg/mL) and then poured into a Petri dish (9 cm in diameter). Later on, 1 mL of LB medium into PDA containing ampicillin (400 μg/mL) as control was added. Once the medium had cooled, discs (7 mm in diameter) of the Colletotrichum truncatum, taken from the fresh margin of the mycelium were spaced equally on the Petri dish and incubated at 30 °C for 72 h.

PDSLzg-1 promotes wheat growth assay

Triticum aestivum L. seeds were cultured for 3 days in test tubes with 30 mL of water. Following germination, they were subjected to grow under 30 °C with a light: dark ratio of 16:8. Plants of the same size were selected for the experiment. B. pumilus PDSLzg-1 was incubated with 100 mL of LB medium at 30 °C on a rotatory shaker (180 rpm) for 72 h, after which the media were centrifuged for 10 min (5000g at 4 °C) and the bacteria were removed. Samples were subsequently extracted from the fermentation broth twice with equal volumes of ethyl acetate. The ethyl acetate layer was then evaporated to desiccate at below 40 °C in a rotary evaporator. Next, the residue was dissolved in 1 mL of ethanol as PDSLzg-1 fermentation additive A. Three treatments were set up: 50 μL of ethanol as a control (negative control), 50 μL of PDSLzg-1 fermentation additive A, and 50 μL of GA (0.24 mg/mL) + IAA (0.006 mg/mL) ethanol solution (positive control). There were five replications for each treatment and five individuals in each replication. The stem and root length were measured after 9 days followed by drying at 90 °C for 12 h, then weighted. All the results were expressed as the mean ± standard errors (SE) of the replicates. Differences among stem and root length and biomass were calculated using one-way ANOVA (SPSS version 16.0, SPSS) and Duncan’s multiple-range test. A p-value < 0.05 was considered to indicate the level of significance.

Results

Genes related to survival and plant growth promotion

The annotated genes of PDSLzg-1 that participated in the metabolism of biosynthesis of secondary metabolites, terpenoids and polyketides are found closely related to bio-control function and plant growth promotion (Idris et al. 2007; Ali et al. 2009; Belbahri et al. 2017; Boottanun et al. 2017).

Bacillus usually exhibits chemotaxis toward a variety of root exudates, especially sugars and various glycoside compounds. Carbohydrates secreted by plant roots comprise an important carbon source for bacteria. There were 114 carbohydrate-active enzymes related to the degradation of plant chitin, pectin, peptidoglycan and oligosaccharides, including 12 secretory proteins and 31 phosphotransferase system (PTS) transporters that are involved in sugar uptake (Tables S1-S3). In this study, we found two nitrogen fixation proteins and two nitrogenases related to PDSLzg-1 nitrogen fixation (Table S4). Moreover, a total of 71 secretory proteins were found including lipase, lipoprotein, carboxypeptidase, polysaccharide and protein degradation enzymes that could directly degrade plant root exudates (Table S2). Under natural conditions, PDSLzg-1 could produce a biofilm that adheres to the roots of the plant, which could effectively prevent the invasion of plant pathogens. Moreover, we identified 15 biofilm formation related genes (Table S5). Antibiotic-resistant bacteria have a competitive-advantage over other microorganisms in the rhizosphere soil, and three antibiotic-resistant genes were found in PDSLzg-1 (Table S6).

Many of Bacillus sp. could secrete plant hormones, such as IAA and GA, to promote plant growth. In the PDSLzg-1 genome, there were 11 candidate genes involved in IAA biosynthesis pathway and 13 candidate genes involved in GA biosynthesis pathway (Table 2).

Table 2.

IAA, GA biosynthesis pathway-related genes

Locus_tag Gene SwissProt annotation
IAA biosynthesis pathway-related genes
BEN31_RS05965 trpA A8FEJ7; TRPA_BACP2 Tryptophan synthase alpha chain
BEN31_RS05960 trpB A8FEJ8; TRPB_BACP2 Tryptophan synthase beta chain
BEN31_RS05955 trpF Q65I34; TRPF_BACLD N-(5′-phosphoribosyl) anthranilate isomerase
BEN31_RS05950 trpC A8FEK0; TRPC_BACP2 Indole-3-glycerol phosphate synthase
BEN31_RS05945 trpD P18261; TRPD_BACPU Anthranilate phosphoribosyltransferase
BEN31_RS05940 trpE P18267; TRPE_BACPU Anthranilate synthase component 1
BEN31_RS18030 ysnE P94562; YSNE_BACSU Uncharacterized N-acetyltransferase YsnE
BEN31_RS10560 TDO Q43908; DDC_ACIBA L-2,4-diaminobutyrate decarboxylase
BEN31_RS12085 TDO NA
BEN31_RS07480 IAD O08336; CYPE_BACSU Probable bifunctional P-450/NADPH-P450 reductase 2
BEN31_RS14025 IANH O31664; MTNU_BACSU Hydrolase MtnU
GA biosynthesis pathway-related genes
BEN31_RS16020 P450-1 O34374; YJIB_BACSU Putative cytochrome P450 YjiB
BEN31_RS06780 P450-1 P27632; CPXM_BACPZ Cytochrome P450 109
BEN31_RS07480 P450-4 O08336; CYPE_BACSU Probable bifunctional P-450/NADPH-P450 reductase 2
BEN31_RS05835 IPPI A8FEM3; IDI2_BACP2 Isopentenyl-diphosphate delta-isomerase
BEN31_RS05155 FPPS GGPPS GPPS P54383; ISPA_BACSU Farnesyl diphosphate synthase
BEN31_RS05160 DXS A8FF11; DXS_BACP2 1-deoxy-D-xylulose-5-phosphate synthase
BEN31_RS08025 DXR A8FDB9; DXR_BACP2 1-deoxy-d-xylulose 5-phosphate reductoisomerase
BEN31_RS15165 CMS A8F959; ISPF_BACP2 2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase
BEN31_RS15170 DMS A8F958; ISPD_BACP2 2-C-methyl-d-erythritol 4-phosphate cytidylyltransferase
BEN31_RS15475 DMK A8F913; ISPE_BACP2 4-diphosphocytidyl-2-C-methyl-d-erythritol kinase
BEN31_RS04780 DHS A8FF87; ISPG_BACP2 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
BEN31_RS17445 AACT P45855; THL_BACSU Acetyl-CoA acetyltransferase
BEN31_RS04115 AACT O07618; YHFS_BACSU Putative acetyl-CoA C-acetyltransferase YhfS
Open in a new tab

Genes related to antifungal secondary metabolites

The secondary metabolisms of bacteria constitute a rich source of bioactive compounds, such as antibiotics, which can kill or inhibit other microorganisms. Genes encoding the biosynthetic pathways responsible for the production of secondary metabolites were often spatially clustered together at a specific position on the chromosome. Nine secondary metabolite biosynthetic gene clusters were found, including three terpene gene clusters (cluster1, cluster4 and cluster5), one bacteriocin gene cluster (cluster2), one type III polyketides (cluster3) gene cluster, three (NRPS) non-ribosomal peptide synthetase (cluster6, cluster7 and cluster8) gene clusters, and one ‘other’ type of gene cluster i.e. cluster9 (Fig. 1). The three NRPS (Genecluster6-Genecluster8) clusters had a structure that roughly fit predictions. Comparative analysis of PDSLzg-1 and other Bacillus species showed that genes in these clusters were highly conserved. Comparative analysis of PDSLzg-1 and other confirmed bacteria antibiotics gene clusters showed that 33% of carotenoid biosynthetic clustered genes had a high similarity with gene cluster 5; 18% of zwittermycin A or paenilamicin biosynthetic clustered genes had a high similarity with gene cluster 6; 85% of lichenysin and 71% of surfactin biosynthetic clustered genes had a high similarity with gene cluster 7; 53% of bacillibactin biosynthetic or 71% of paenilamicin biosynthetic clustered genes had a high similarity with gene cluster 8; and 71% of bacilysin biosynthetic clustered genes had a high similarity with gene cluster 9 (Figure S2). Genome analysis shows that a variety of bacterial secretions, including protease, chitinase, and secondary metabolites may be produced by PDSLzg-1, which can inhibit fungal growth (Table S2). So we subsequently treated C. truncatum with PDSLzg-1. The results showed that mycelium growth of C. truncatum was inhibited on the PDA medium with PDSLzg-1 fermentation; however, the same effect was not observed on the control PDA medium (Figure S3).

Fig. 1.

Fig. 1

Open in a new tab

Predicted secondary metabolite biosynthetic gene clusters in the B. pumilus ‘PDSLzg-1’ genome (top right). Rough prediction of core scaffold based on assumed PKS/NRPS (genecluster6-genecluster8) collinearity; tailoring reactions not taken into account

The content of GA and IAA in PDSLzg-1 fermentation and its plant growth-promoting effect

GA and IAA were the most common plant growth hormones secreted by bacteria. HPLC was used to detect the concentration of GA and IAA in PDSLzg-1 fermentation. We set up two treatments: 0.07% (v:v) n-hexadecane added into the culture medium and a control. Concentrations of GA in the control and the n-hexadecane treatment were 2.312 mg/L and 2.930 mg/L, respectively. Concentrations of IAA in the control and the n-hexadecane treatment were 0.061 mg/L and 0.065 mg/L, respectively. Student’s t-tests showed that the concentration of GA in the n-hexadecane treatment was significantly higher (F = 2.342, p = 0.008) than in the control, while the concentrations of IAA did not differ significantly (F = 0.333, p = 0.784) between the n-hexadecane treatment and the control (Fig. 2A). Three treatments of T. aestivum were then designed in a manner that one subjected to PDSLzg-1 fermentation, one with added GA + IAA (positive control), and a negative control to investigate the plant growth-promoting effect of PDSLzg-1. Doses of GA and IAA (final concentration = GA: 0.4 μg/mL and IAA: 0.01 μg/mL) were added to each plant in the positive control according to the HPLC detection results for GA and IAA levels in the PDSL fermentation treatment. After 9 days of treatment, the stem and root length along with total biomass of T. aestivum samples were measured. One-way ANOVA using Duncan’s multiple-range test showed that the stem length of GA + IAA and PDSLzg-1 fermentation treatments were significantly lengthier (F = 19.282, p < 0.001) than those of the control. The root length of GA + IAA and PDSLzg-1 fermentation treatments though non-significant with each other, however; they were significantly lengthier (F = 35.576, p < 0.001) than those of the control (Fig. 2B). Similarly, the stem biomass of GA + IAA and PDSLzg-1 fermentation treatments were significantly greater than those of the control (F = 31.067, p < 0.001) besides the fact that they were non-significant (F = 8.184, p = 0.006) with each other (Fig. 2C). These results indicate that GA and IAA secreted by PDSLzg-1 could promote the growth of T. aestivum.

Fig. 2.

Fig. 2

Open in a new tab

A Concentration of GA and IAA in ‘PDSLzg-1’ fermentation; B length of T. aestivum stem and root in different treatment; C biomass of T. aestivum stem and root in different treatments. All results were expressed as means ± standard error (SE) of the number of experiments. *Indicates statistically significant difference of GA and IAA concentrations at p < 0.05 based on a Student’s t test (left). Lowercase ‘a’, ‘b’ and ‘c’ indicate a significant difference in stem and root length at p < 0.05 based on one-way ANOVA using Duncan’s multiple-range test (right)

Validation gene express profile between n-hexadecane treatment and control

To verify different gene expression profile of B. pumilus after the application of n-hexadecane treatment, relative mRNA level of 11 key genes involved in plant hormone biosynthesis between n-hexadecane treatment and control were detected by real-time PCR. GA and IAA biosynthesis pathway-related genes including N-acetyltransferase (BEN31_RS18030), l-2,4-diaminobutyrate decarboxylase (BEN31_RS10560), bifunctional P-450/NADPH-P450 reductase (BEN31_RS07480), Hydrolase (BEN31_RS14025), cytochrome P450 (BEN31_RS16020, BEN31_RS06780), l-deoxy-d-xylulose-5-phosphate synthase (BEN31_RS05160), l-deoxy-d-xylulose 5-phosphate reductoisomerase (BEN31_RS08025), 2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase (BEN31_RS15165), 2-C-methyl-d-erythritol 4-phosphate cytidylyltransferase (BEN31_RS15170), 4-diphosphocytidyl-2-C-methyl-d-erythritol kinase (BEN31_RS15475) were selected as target genes. Results showed that the relative mRNA level of all of the 11 genes in 0.2% n-hexadecane treatment were significantly higher than that of the control (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Real-time PCR validations of 11 genes in 0.2% n-hexadecane treatment (black) and control (grey). For each real-time PCR validation, three technical replications were performed, 16S rDNA gene was used as an internal control. *Indicates significant differences in n-hexadecane concentrations at p < 0.05 based on a Student’s t test

Discussion

Microbial nitrogen fixation is a major nitrogen source for plants and many species of plants are relying on this association for their food (Gaby and Buckley 2014). Secretory proteins also play an important role in the communication between plant roots and microbes (De-la-Pena et al. 2008). PDSLzg-1 genome analysis indicated the presence of a large number of transporters and a wealth of metabolic pathways, especially secondary metabolite synthesis pathways. All of these genotypes demonstrated that the PDSLzg-1 has the ability of symbiosis association in rhizosphere with plants in a specific ecosystem.

Chitinase produced by B. pumilus is a vital antifungal compound (Shali et al. 2010). Genome analysis showed that PDSLzg-1 could produce chitinase and various secondary metabolites (e.g. lipopeptide antibiotics) that inhibited the growth of fungi. The fosB gene encodes metalloglutathione transferase, which confers resistance to fosfomycin via catalysis of the addition of glutathione to fosfomycin (Thompson et al. 2013). Although PDSLzg-1 does not exhibit a broad-spectrum antifungal effect, however, it has been shown to inhibit the growth of specific pathogenic fungus i.e. C. truncatum that infects legumes. The bacA gene, which encodes undecaprenyl pyrophosphate phosphatase, confers resistance to bacitracin via the phosphorylation of undecaprenol (Ghachi et al. 2004). The multi-drug resistance protein (mdr) serves as a transporter and has been shown to be a major facilitator (Kumar et al. 2013).

Our study revealed that PGPR bacteria could synthesize and secrete plant hormone analogues including GA and IAA, to promote plant growth and development. Therefore, the GA and IAA synthesis pathways of PDSLzg-1 (Figure S4) that we made are based on KEGG, metacyc (https://metacyc.org/) according to the previous findings (Kobayashi et al. 1995; Tudzynski and Hölter 1998; Gutiérrez-Mañero et al. 2001; Idris et al. 2007; Bömke and Tudzynski 2009; Caspi et al. 2009).

Previous study reported that the IAA concentration in Bacillus sp. fermentation was approximately 0.6–3.0 mg/L of IAA, while the IAA concentration in PDSLzg-1 fermentation was only 0.06 mg/L (Ali et al. 2009). Normally, the IAA synthesis pathway included two steps. The first step was biosynthesis of indole or l-tryptophan via the l-tryptophan synthesis pathway (Figure S4). All the genes in the l-tryptophan synthesis pathway, including trpA to trpE, were in the same gene cluster (Table 2). However, the second step of the IAA synthesis pathway is divided into three different potential methods. An IAA acetyltransferase (ysnE) exists in Bacillus velezensis FZB42, which can catalyze indole directly into IAA. Genome analysis showed that a ysnE homologous gene existed in PDSLzg-1 (Table 2); therefore, this is the most likely pathway for the synthesis of IAA in PDSLzg-1 (Idris et al. 2007). Arabidopsis thaliana also produces IAA from l-tryptophan via stepwise indole-3-acetaldoxime catalyzation by indole-3-acetaldoxime dehydratase and indole-3-acetonitrile nitrilase (Normanly et al. 1993; Ouyang et al. 2000). Although this pathway has been identified in plants, however, our study is innovative in the sense for finding homologous genes for tryptophan decarboxylase (TDO), indole-3-acetaldoxime dehydratase (IAD), and indole-3-acetonitrile nitrilase (IANH) in the PDSLzg-1 genome (Table 2). These findings suggest the possible existence of this pathway in PDSLzg-1.

Gibberellins are tetracyclic diterpenoid acids that are involved in plant stem elongation. It has been reported that B. pumilus can produce more than 0.2 mg/L GA, while the GA concentration resulting from PDSLzg-1 fermentation was as high as 2 mg/L (Gutiérrez-Mañero et al. 2001). Similar to the IAA synthesis pathway, the GA synthesis pathway has also been divided into two steps: terpenoid backbone biosynthesis (including the mevalonate (MVA) pathway and the MEP/DOXP pathway) and GA biosynthesis (Figure S4). All six genes in the MEP/DOXP pathway were found in the PDSLzg-1 genome. However, no homologous genes of the MVA pathway were found in PDSLzg-1 (Table 2), except Acetyl-CoA acetyltransferase (ACCT). These findings indicate that only the MEP/DOXP pathway exists in PDSLzg-1. Diterpenoids, such as kaurene, were produced from isopentenyl diphosphate (IPP) and subsequently catalyzed into the GA homologues GA1, GA3, GA4, and GA20 via desaturase and P450 family enzymes (Figure S4). The concentration of GA in the n-hexadecane treatment was significantly higher than that in the control. Both MVA and MEP/DOXP pathway requires glyceraldehyde 3-phosphate and pyruvate as initial carbon sources, which can be provided by the n-hexadecane metabolism process. Real-time PCR results also demonstrated that the expression of genes involved in GA biosynthesis pathway was significantly induced by n-hexadecane. Therefore, we hypothesized that long-chain alkanes might provide more diverse carbon sources for PDSLzg-1 to synthesize greater levels of secondary metabolites.

HPLC results showed that PDSLzg-1 secreted GA and IAA. The results of the PDSLzg-1 wheat growth assay showed that the stem and root length and total biomass of the positive control and the PDSLzg-1 fermentation treatment were significantly higher than the negative control, while there was no significant difference between the positive control and the PDSLzg-1 fermentation treatment. It supported the conclusion that GA and IAA secreted by PDSLzg-1 significantly promoted plant growth.

In addition to identifying plant hormones that promote plant growth and development, genomic analysis showed that PDSLzg-1 exhibited a nitrogen fixation mechanism that could provide an available source of nitrogen for plants growth (Gaby and Buckley 2014). PDSLzg-1 can also produce various secondary metabolites (e.g. lipopeptide antibiotics) that inhibit the growth of certain fungi (Das et al. 2015). In contrast, various oligosaccharide enzymes, pectinases, cellulases, or chitinases secreted by PDSLzg-1 not only consume plant root exudates as a carbon source, but can also play an antibacterial role (Table S1) (De Boer et al. 1998; Cantarel et al. 2008; Jang et al. 2011; Gurav et al. 2017; Mefteh et al. 2017). A symbiotic relationship might exist between PDSLzg-1 and plants. Plants need to provide the proper conditions for PDSLzg-1 to get benefited from the plant hormones and sources of nitrogen.

Conclusion

Our previous study showed the alkane degradation function of PDSLzg-1. In this study, results demonstrate that PDSLzg-1 has the simultaneous potential ability of alkane degradation as well as PGPR functions. The growth of pathogenic fungus C. truncatum can be inhibited by PDSLzg-1. Moreover, GA and IAA were detected in response of PDSLzg-1 applications, which could have promoted T. aestivum growth. The express profile of genes related to plant hormone biosynthesis was verified by real-time PCR. Interestingly, the revealed function of PDSLzg-1 indicates a synergic relationship, such as n-hexadecane could promote plant growth by stimulating the synthesis of gibberellin. Our research suggests that hydrocarbon-degrading bacterium PDSLzg-1 should be able to protect plants on oil-contaminated land that will ultimately minimize the effect of climate change. This property makes PDSLzg-1 well-suited for combined phyto-microbial oil bioremediation.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary material 1 (JPEG 74 kb) (74.3KB, jpg)
Supplementary material 2 (JPEG 2153 kb) (2.1MB, jpg)
Supplementary material 3 (JPEG 1069 kb) (1MB, jpg)
Supplementary material 4 (JPEG 1433 kb) (1.4MB, jpg)
Supplementary material 5 (DOCX 40 kb) (40.6KB, docx)
Supplementary material 6 (DOCX 25 kb) (25.6KB, docx)
Supplementary material 7 (DOCX 36 kb) (37KB, docx)
Supplementary material 8 (DOCX 16 kb) (16.4KB, docx)
Supplementary material 9 (DOCX 16 kb) (16.3KB, docx)
Supplementary material 10 (DOCX 16 kb) (16.4KB, docx)

Acknowledgments

We thank Shan Xue for editing the figures.

Funding

This work was supported by the China Major Science and Technology Program for Water Pollution Control and Treatment, the Standardization and Scale of Application of Rural Drinking Water Security Technology (2015ZX07402003-4).

Compliance with ethical standards

Conflict of interest

The authors declare no competing financial interests.

Contributor Information

Kun Hao, Email: haokun8611@foxmail.com.

Hidayat Ullah, Email: shabkadar@yahoo.com.

Xinghu Qin, Email: xq5@st-andrews.ac.uk.

Hongna Li, Email: lihongna@caas.cn.

Feng Li, Email: lifeng@caas.cn.

Ping Guo, Phone: 86-10-82107857, Email: guoping@caas.cn.

References

  1. Ali B, Sabri AN, Ljung K, Hasnain S. Auxin production by plant associated bacteria: impact on endogenous IAA content and growth of Triticum aestivum L. Lett Appl Microbiol. 2009;48:542–547. doi: 10.1111/j.1472-765X.2009.02565.x. [DOI] [PubMed] [Google Scholar]
  2. Anith KN, Sreekumar A, Sreekumar J. The growth of tomato seedlings inoculated with co-cultivated Piriformospora indica and Bacillus pumilus. Symbiosis. 2015;65(1):9–16. doi: 10.1007/s13199-015-0313-7. [DOI] [Google Scholar]
  3. Belbahri L, Chenari BA, Rekik I, Alenezi FN, Vallat A, Luptakova L, Petrovova E, Oszako T, Cherrad S, Vacher S, Rateb ME. Comparative genomics of Bacillus amyloliquefaciens strains reveals a core genome with traits for habitat adaptation and a secondary metabolites rich accessory genome. Front Microbiol. 2017;8:1438. doi: 10.3389/fmicb.2017.01438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, Weber T. antiSMASH 2.0—a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 2013;41(W1):W204–W212. doi: 10.1093/nar/gkt449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bömke C, Tudzynski B. Diversity, regulation, and evolution of the gibberellin biosynthetic pathway in fungi compared to plants and bacteria. Phytochemistry. 2009;70:1876–1893. doi: 10.1016/j.phytochem.2009.05.020. [DOI] [PubMed] [Google Scholar]
  6. Boottanun P, Potisap C, Hurdle JG, Sermswan RW. Secondary metabolites from bacillus amyloliquefaciens isolated from soil can kill burkholderia pseudomallei. AMB Express. 2017;7:16. doi: 10.1186/s13568-016-0302-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res. 2008;37(suppl_1):D233–D238. doi: 10.1093/nar/gkn663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Caspi R, Altman T, Dale JM, Dreher K, Fulcher CA, Gilham F, Kaipa P, Karthikeyan AS, Kothari A, Krummenacker M, Latendresse M. The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases. Nucleic Acids Res. 2009;38(suppl_1):D473–D479. doi: 10.1093/nar/gkp875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chettri B, Mukherjee A, Langpoklakpam JS, Chattopadhyay D, Singh AK. Kinetics of nutrient enhanced crude oil degradation by Pseudomonas aeruginosa AKS1 and Bacillus sp. AKS2 isolated from Guwahati refinery, India. Environ Poll. 2016;216:548–558. doi: 10.1016/j.envpol.2016.06.008. [DOI] [PubMed] [Google Scholar]
  10. Cunningham SD, Berti WR, Huang JW. Phytoremediation of contaminated soils. Trends Biotechnol. 1995;13(9):393–397. doi: 10.1016/S0167-7799(00)88987-8. [DOI] [Google Scholar]
  11. Das S, Majumdar B, Saha AR. Biodegradation of plant pectin and hemicelluloses with three novel Bacillus pumilus strains and their combined application for quality jute fibre production. Agric Res. 2015;4(4):354–364. doi: 10.1007/s40003-015-0188-0. [DOI] [Google Scholar]
  12. De Boer W, Gunnewiek PJK, Lafeber P, Janse JD, Spit BE, Woldendorp JW. Anti-fungal properties of chitinolytic dune soil bacteria. Soil Biol Biochem. 1998;30:193–203. doi: 10.1016/S0038-0717(97)00100-4. [DOI] [Google Scholar]
  13. De-la-Pena C, Lei Z, Watson BS, Sumner LW, Vivanco JM. Root-microbe communication through protein secretion. J Biol Chem. 2008;283:25247–25255. doi: 10.1074/jbc.M801967200. [DOI] [PubMed] [Google Scholar]
  14. Feitkenhauer H, Müller R, Mauml H. Degradation of polycyclic aromatic hydrocarbons and long chain alkanes at 6070 C by Thermus and Bacillus spp. Biodegradation. 2003;14(6):367–372. doi: 10.1023/A:1027357615649. [DOI] [PubMed] [Google Scholar]
  15. Gaby JC, Buckley DH. A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database. 2014 doi: 10.1093/database/bau001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ghachi ME, Bouhss A, Blanot D, Mengin-Lecreulx D. The bacA gene of Escherichia coli encodes an undecaprenyl pyrophosphate phosphatase activity. J Biol Chem. 2004;279:30106–30113. doi: 10.1074/jbc.M401701200. [DOI] [PubMed] [Google Scholar]
  17. Gurav R, Tang J, Jadhav J. Novel chitinase producer bacillus pumilus rst25 isolated from the shellfish processing industry revealed antifungal potential against phyto-pathogens. Int Biodeterior Biodegr. 2017;125:228–234. doi: 10.1016/j.ibiod.2017.09.015. [DOI] [Google Scholar]
  18. Gurska J, Wang W, Gerhardt KE, Khalid AM, Isherwood DM, Huang XD, Glick BR, Greenberg BM. Three year field test of a plant growth promoting rhizobacteria enhanced phytoremediation system at a land farm for treatment of hydrocarbon waste. Environ Sci Technol. 2009;43(12):4472–4479. doi: 10.1021/es801540h. [DOI] [PubMed] [Google Scholar]
  19. Gutiérrez-Mañero FJ, Ramos-Solano B, Mehouachi J, Tadeo FR, Talon M. The plant-growth-promoting rhizobacteria Bacillus pumilus and Bacillus licheniformis produce high amounts of physiologically active gibberellins. Physiol Plant. 2001;111(2):206–211. doi: 10.1034/j.1399-3054.2001.1110211.x. [DOI] [Google Scholar]
  20. Hao K, Li H, Li F, Guo P. Complete genome sequence of Bacillus pumilus PDSLzg-1, a hydrocarbon-degrading bacterium isolated from oil-contaminated soil in China. Genome Announcements. 2016;4(5):e01079-16. doi: 10.1128/genomeA.01079-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. He P, Hao K, Blom J, Rückert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y, Borriss R. Genome sequence of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and expression of mersacidin and other secondary metabolites. J Biotechnol. 2013;164(2):281–291. doi: 10.1016/j.jbiotec.2012.12.014. [DOI] [PubMed] [Google Scholar]
  22. Heidarzadeh N, Baghaee-Ravari S. Application of Bacillus pumilus as a potential biocontrol agent of Fusarium wilt of tomato. Arch Phytopathol Plant Protect. 2016;48:841–849. doi: 10.1080/03235408.2016.1140611. [DOI] [Google Scholar]
  23. Hernandez JP, de-Bashan LE, Rodriguez DJ, Rodriguez Y, Bashan Y. Growth promotion of the freshwater microalga Chlorella vulgaris by the nitrogen-fixing, plant growth-promoting bacterium Bacillus pumilus from arid zone soils. Eur J Soil Biol. 2009;45(1):88–93. doi: 10.1016/j.ejsobi.2008.08.004. [DOI] [Google Scholar]
  24. Idris EE, Iglesias DJ, Talon M, Borriss R. Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol Plant Microbe Interact. 2007;20(6):619–626. doi: 10.1094/MPMI-20-6-0619. [DOI] [PubMed] [Google Scholar]
  25. Jang JO, Lee JB, Kim BS, Kang SC, Hwang CW, Shin KS, Kwon GS. Characterization and antifungal activity from soilborne streptomyces sp. am50 towards major plant pathogens. Korean J Environ Agric. 2011;30:346–356. doi: 10.5338/KJEA.2011.30.3.346. [DOI] [Google Scholar]
  26. Kafilzadeh F, Amiri P, Jahromi AR, Mojoodi N. Isolation and molecular identification of fluoranthene degrading bacteria from the mangrove sediments in South of Iran. Int J Biosci. 2013;3(5):60–67. doi: 10.12692/ijb/3.5.60-67. [DOI] [Google Scholar]
  27. Kang Y, Shen M, Wang H, Zhao Q. A possible mechanism of action of plant growth-promoting rhizobacteria (PGPR) strain Bacillus pumilus WP8 via regulation of soil bacterial community structure. J Gen Appl Microbiol. 2013;59(4):267–277. doi: 10.2323/jgam.59.267. [DOI] [PubMed] [Google Scholar]
  28. Kato T, Miyanaga A, Kanaya S, Morikawa M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 2010;14(1):33. doi: 10.1007/s00792-009-0285-8. [DOI] [PubMed] [Google Scholar]
  29. Khanna P, Goyal D, Khanna S. Pyrene degradation by Bacillus pumilus isolated from crude oil contaminated soil. Polycyclic Aromat Compd. 2011;31(1):1–15. doi: 10.1080/10406638.2010.542792. [DOI] [Google Scholar]
  30. Kobayashi M, Suzuki T, Fujita T, Masuda M, Shimizu S. Occurrence of enzymes involved in biosynthesis of indole-3-acetic acid from indole-3-acetonitrile in plant-associated bacteria, Agrobacterium and Rhizobium. Proc Natl Acad Sci. 1995;92(3):714–718. doi: 10.1073/pnas.92.3.714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kumar S, Mukherjee MM, Varela MF. Modulation of bacterial multidrug resistance efflux pumps of the major facilitator superfamily. Int J Bacteriol. 2013 doi: 10.1155/2013/204141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liu B, Pop M. ARDB—antibiotic resistance genes database. Nucleic Acids Res. 2008;37(suppl_1):D443–D447. doi: 10.1093/nar/gkn656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  34. Mefteh FB, Daoud A, Chenari BA, Alenezi FN, Luptakova L, Rateb ME, Kadri A, Gharsallah N, Belbahri L. Fungal root microbiome from healthy and brittle leaf diseased date palm trees (Phoenix dactylifera L.) reveals a hidden untapped arsenal of antibacterial and broad spectrum antifungal secondary metabolites. Front Microbiol. 2017;8:307. doi: 10.3389/fmicb.2017.00307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Normanly J, Cohen JD, Fink GR. Arabidopsis thaliana auxotrophs reveal a tryptophan-independent biosynthetic pathway for indole-3-acetic acid. Proc Natl Acad Sci. 1993;90(21):10355–10359. doi: 10.1073/pnas.90.21.10355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ouyang J, Shao X, Li J. Indole-3-glycerol phosphate, a branchpoint of indole-3-acetic acid biosynthesis from the tryptophan biosynthetic pathway in Arabidopsis thaliana. Plant J. 2000;24(3):327–334. doi: 10.1046/j.1365-313x.2000.00883.x. [DOI] [PubMed] [Google Scholar]
  37. Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods. 2011;8(10):785. doi: 10.1038/nmeth.1701. [DOI] [PubMed] [Google Scholar]
  38. Ren JH, Li H, Wang YF, Ye JR, Yan AQ, Wu XQ. Biocontrol potential of an endophytic Bacillus pumilus JK-SX001 against poplar canker. Biol Control. 2013;67(3):421–430. doi: 10.1016/j.biocontrol.2013.09.012. [DOI] [Google Scholar]
  39. Sampaio CJS, Souza JRBD, Damião AO, Bahiense TC, Roque MRA. Biodegradation of polycyclic aromatic hydrocarbons (pahs) in a diesel oil-contaminated mangrove by plant growth-promoting rhizobacteria. 3 Biotech. 2019;9:155. doi: 10.1007/s13205-019-1686-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Shali A, Ghasemi S, Ahmadian G, Ranjbar G, Dehestani A, Khalesi N, Motallebi E, Vahed M. Bacillus pumilus SG2 chitinases induced and regulated by chitin, show inhibitory activity against Fusarium graminearum and Bipolaris sorokiniana. Phytoparasitica. 2010;38(2):141–147. doi: 10.1007/s12600-009-0078-8. [DOI] [Google Scholar]
  41. Stein T. Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol. 2005;56(4):845–857. doi: 10.1111/j.1365-2958.2005.04587.x. [DOI] [PubMed] [Google Scholar]
  42. Thompson MK, Keithly ME, Harp J, Cook PD, Jagessar KL, Sulikowski GA, Armstrong RN. Structural and chemical aspects of resistance to the antibiotic Fosfomycin conferred by FosB from Bacillus cereus. Biochemistry-US. 2013;52:7350–7362. doi: 10.1021/bi4009648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tsavkelova EA, Klimova SY, Cherdyntseva TA, Netrusov AI. Microbial producers of plant growth stimulators and their practical use: a review. Appl Biochem Microbiol. 2006;42(2):117–126. doi: 10.1134/S0003683806020013. [DOI] [PubMed] [Google Scholar]
  44. Tudzynski B, Hölter K. Gibberellin biosynthetic pathway in Gibberella fujikuroi: evidence for a gene cluster. Fungal Genet Biol. 1998;25(3):157–170. doi: 10.1006/fgbi.1998.1095. [DOI] [PubMed] [Google Scholar]
  45. Vargas WA, Sanz-Martín JM, Rech GE, Rivera LP, Benito EP, Díaz-Mínguez JM, Thon MR, Sukno SA. Plant defense mechanisms are activated during biotrophic and necrotrophic development of Colletotricum graminicola in maize. Plant Physiol. 2012 doi: 10.1104/pp.111.190397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Vergani L, Mapelli F, Zanardini E, Terzaghi E, Di Guardo A, Morosini C, Raspa G, Borin S. Phyto-rhizoremediation of polychlorinated biphenyl contaminated soils: an outlook on plant-microbe beneficial interactions. Sci Total Environ. 2017;575:1395–1406. doi: 10.1016/j.scitotenv.2016.09.218. [DOI] [PubMed] [Google Scholar]
  47. Xu Y, Sun GD, Jin JH, Liu Y, Luo M, Zhong ZP, Liu ZP. Successful bioremediation of an aged and heavily contaminated soil using a microbial/plant combination strategy. J Hazard Mater. 2014;264:430–438. doi: 10.1016/j.jhazmat.2013.10.071. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1 (JPEG 74 kb) (74.3KB, jpg)
Supplementary material 2 (JPEG 2153 kb) (2.1MB, jpg)
Supplementary material 3 (JPEG 1069 kb) (1MB, jpg)
Supplementary material 4 (JPEG 1433 kb) (1.4MB, jpg)
Supplementary material 5 (DOCX 40 kb) (40.6KB, docx)
Supplementary material 6 (DOCX 25 kb) (25.6KB, docx)
Supplementary material 7 (DOCX 36 kb) (37KB, docx)
Supplementary material 8 (DOCX 16 kb) (16.4KB, docx)
Supplementary material 9 (DOCX 16 kb) (16.3KB, docx)
Supplementary material 10 (DOCX 16 kb) (16.4KB, docx)

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES