SUMMARY
Epitranscriptomic regulation controls information flow through the central dogma and provides unique opportunities for manipulating cells at the RNA level. However, both fundamental studies and potential translational applications are impeded by a lack of methods to target specific RNAs with effector proteins. Here, we present CRISPR-Cas-inspired RNA targeting system (CIRTS), a protein engineering strategy for constructing programmable RNA control elements. We show that CIRTS is a simple and generalizable approach to deliver a range of effector proteins, including nucleases, degradation machinery, translational activators, and base editors to target transcripts. We further demonstrate that CIRTS are not only smaller than naturally-occurring CRISPR-Cas programmable RNA binding systems, but can also be built entirely from human protein parts. CIRTS provides a platform to probe fundamental RNA regulatory processes, while the human-derived nature of CIRTS provides a potential strategy to avoid immune issues when applied to epitranscriptome-modulating therapies.
In brief
Engineered modular RNA-guided RNA-targeting effectors synthesized entirely from human protein parts provide a set of new tools that may overcome the size and immunogenicity limitations of CRISPR-Cas systems
Graphical Abstract

INTRODUCTION
Programmable nucleic acid-binding proteins, including zinc finger proteins, transcription activator-like effector nucleases (TALEN), PUF (Pumillo) proteins, and Cas proteins, have revolutionized genome studies and editing technologies (Chandrasegaran and Carroll, 2016; Kim and Kim, 2014; O’Connell, 2019; Terns, 2018) and are opening up new therapeutic opportunities to treat human diseases (Liao et al., 2017; Monteys et al., 2017). In particular, the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system, which evolved as a prokaryotic immune defense mechanism, has transformed our ability to study and manipulate cellular DNA site-specifically (Cong et al., 2013; Jiang et al., 2013; Wiedenheft et al., 2012). A key advantage of CRISPR-Cas systems compared to previous methods, such as zinc finger proteins and TALE nucleases (Choudhury et al., 2012; Desjarlais and Berg, 1993; Hockemeyer et al., 2011; Joung and Sander, 2012; Schierling et al., 2012), is that they are easily programmable to target virtually any locus of interest. The CRISPR-Cas system is a ribonucleoprotein complex that uses base pair interactions of a displayed guide RNA (gRNA) to interact with a target nucleic acid sequence. The simple nature of base pair-guided targeting opens up the possibility to program systems to interact with a defined nucleic acid sequence by simply changing the nucleic acid sequence on the guiding strand.
While targeting DNA directly will have profound clinical ramifications, diseases that involve subtle alterations to many genes will be challenging to target using DNA editing technologies (Fuxman Bass et al., 2015; Granados-Riveron and Aquino-Jarquin, 2018). Additionally, potential side effects or risks of permanent genetic alteration might not be tolerated for some diseases. For example, the genes one may want to target to activate an enhanced wound healing response are likely targets that could pose a risk for cancer development, rendering permanent DNA-based alteration strategies risky (Sundaram et al., 2017). Targeting information flow at the RNA level presents several opportunities for therapeutic intervention, including but not limited to the ability to halt treatment if side effects emerge, the ability to target genes that would be too risky to alter at the DNA level, and the ability to manipulate gene expression without permanent alterations to the host genome. While inhibiting or enhancing transcription at the genome level provides one possibility for controlling gene expression (Du et al., 2017; Qi et al., 2013), recently discovered RNA epitranscriptomic regulatory mechanisms offer a broad range of RNA regulatory processes to target, including editing, degradation, transport, and translation of RNA transcripts (Nishikura, 2010; Roundtree et al., 2017; Zhao et al., 2017). Although the mechanisms and consequences of this epitranscriptomic regulatory layer are just beginning to be uncovered, it is apparent that the information flow through RNA is tightly regulated, offering many new opportunities for both basic research discoveries as well as therapeutic development.
Programmable RNA-targeting tools analogous to the Cas9 DNA-targeting systems hold great promise for studying the mechanisms of epitranscriptomic regulation and for therapeutic applications. Prior to the discovery of the CRISPR-Cas system, programmable PUF (Pumillo) protein-based RNA-targeting tools analogous to TALEN had been developed (Abil et al., 2014; Adamala et al., 2016; Choudhury et al., 2012). However, the Cas9-based DNA targeting revolution has demonstrated that genetically encodable ribonucleoprotein-based approaches with programmable guiding RNA offer advantages for broad adaptation due to their easily programmable nature (Chandrasegaran and Carroll, 2016). The Cas9 protein family, which natively targets DNA, has been repurposed to act as a programmable nuclease-inactive RNA targeting moiety (Batra et al., 2017; Nelles et al., 2016; O’Connell et al., 2014). A protein family related to Cas9, the Cas13 protein family, was then shown to natively target RNA (Abudayyeh et al., 2016). More recently, an additional class of smaller single-stranded RNA targeting Cas proteins (Cas12g proteins) that exhibit ssRNA and ssDNA collateral cleavage were discovered (Yan et al., 2019). Aside from providing a powerful method to degrade target RNAs using the nuclease activity inherent to Cas13 systems, catalytically-inactive dead Cas13 proteins (dCas13) have been used to image RNA by fusions to GFP (Abudayyeh et al., 2017), to edit RNA by delivering an ADAR A-to-I editing enzyme (Cox et al., 2017), and to modulate splicing by delivering hnRNPa1 to target transcripts of interest (Konermann et al., 2018). Additionally, our group recently adopted the dCas13 system to deliver truncated N6-methyladenosine (m6A) binding proteins (“readers”) to specific sites in the transcriptome, yielding new tools to study and control RNA regulation (Rauch et al., 2018).
Although the Cas9 and Cas13 systems have revolutionized studies of DNA and RNA, respectively, the large size and bacterial origin of these proteins pose problems for both basic research applications and therapeutic development. Most Cas13 proteins studied to-date are around 130 kDa in size, and even the smallest member of the family (Cas13d) is ~100 kDa (Yan et al., 2018). From a translational perspective, the large size presents challenges for viral packaging and direct protein delivery. Moreover, it was recently discovered that a substantial fraction of people already have circulating antibodies to CRISPR-Cas proteins (Charlesworth et al., 2019; Simhadri et al., 2018; Wagner et al., 2018), suggesting immunogenicity issues may prove problematic in long-term clinical applications. While a one-time DNA editing treatment may not present immunogenicity problems, targeting RNA therapeutically with continuously-delivered microbially-derived effector proteins may eventually lead to substantial immunogenicity challenges.
To overcome the large size and microbial-derived nature of current RNA-targeting systems, we present a CRISPR-Cas-inspired RNA targeting system (CIRTS), a general method for engineering programmable RNA effector proteins. We show that the CIRTS strategy permits mining the human proteome for functional parts to build programmable RNA regulatory proteins. Similar to CRISPR-Cas-based systems, CIRTS is a ribonucleoprotein complex that uses Watson-Crick-Franklin base pair interactions with a gRNA to deliver protein cargo site-selectively to the transcriptome. We show that CIRTS can deliver a range of regulatory proteins, including ribonucleases for direct RNA degradation, deadenylation regulatory machinery for transcript degradation, RNA editing proteins for A-to-I editing, and translational activation machinery for enhanced protein production to transcripts in a gRNA-dependent manner. Taken together, this work validates the CIRTS strategy as a viable approach to engineer RNA effector proteins that are small and assembled from human parts.
RESULTS
Design of CIRTS
While DNA-targeting Cas9-based systems employ complex biophysical mechanisms to unwind DNA and anneal to a target sequence (Rutkauskas et al., 2015; Sternberg et al., 2014; Szczelkun et al., 2014), mechanistic studies of Cas13 showed that RNA targeting is initiated by a central seed region in the gRNA (Abudayyeh et al., 2016; Liu et al., 2017; Slaymaker et al., 2019; Tambe et al., 2018). Additionally, Cas13 systems display substantial variability in sequence context targetability on individual transcripts (Abudayyeh et al., 2017; Cox et al., 2017; Konermann et al., 2018; Smargon et al., 2017). Together these findings suggest that sequence complementarity between the gRNA and targeted transcript, as well as the accessibility of a given site, are key requirements for RNA targeting. We sought to engineer a Cas13-inspired system that uses a defined protein-RNA interaction to display a gRNA sequence to deliver protein cargoes to a target RNA, similar to previous RNA tethering assays with overexpressed reporter constructs (Coller and Wickens, 2007). Indeed, hairpin-binding proteins and covalent RNA fusions have been used to deliver RNA editing machinery to transcripts (Montiel-Gonzalez et al., 2016; Sinnamon et al., 2017; Vogel et al., 2018).
Based on the current characterization of Cas13 (Abudayyeh et al., 2017; Cox et al., 2017; Gootenberg et al., 2018; Konermann et al., 2018; Liu et al., 2017; Tambe et al., 2018; Yan et al., 2018), we reasoned that a minimal programmable RNA-targeting system will need four components: (1) an RNA hairpin-binding protein that serves as the core of the system and is a selective, high affinity binder to a specific RNA structure displayed on an engineered gRNA, (2) a gRNA that features both the structure that interacts with the engineered hairpin-binding protein and a sequence with complementarity to the target RNA of interest, (3) a charged protein that could bind to the displayed gRNA sequence non-specifically to stabilize and protect the guiding RNA prior to target engagement, and (4) an effector protein, such as a ribonuclease or epitranscriptomic regulator, that acts on the targeted RNA in a proximity-dependent manner (Figure 1A). While Cas13 houses all of these functional components in a single protein domain (Liu et al., 2017; Tambe et al., 2018), we envisioned engineering a system that combines multiple protein domains that each perform one of these functions, which we termed CRISPR- Cas-inspired RNA targeting system (CIRTS). CIRTS vary in their module composition and are uniquely numbered as listed in Figure 1A and Figure S1.
Figure 1. Design of CRISPR-Cas-inspired RNA targeting system (CIRTS).
(A) Schematic overview of the design strategy. CIRTS is composed of a ssRNA binding protein, an RNA hairpin binding protein, an effector protein, and a guiding RNA.
(B) List of key CIRTS used in this work.
(C) Design of the guiding RNA for TBP6.7. The HIV TAR hairpin was fused to a nucleotide linker (L) and a guide sequence. The nucleotide linker was altered during optimization (as described in the supporting figures), but L = UUAUU was used for all work thereafter.
(D) Design of the guiding RNA for the RNA recognition motif (RRM) of SLBP. The human histone mRNA hairpin was fused to a flexible five nucleotide linker and a guide sequence.
Development and in vitro validation of CIRTS-1
For our first-generation system, CIRTS-1, we used an evolved version of the human hairpin-binding protein U1A protein (TBP6.7), which was previously engineered to bind the HIV transactivation response (TAR) hairpin and has no endogenous human RNA hairpin targets (Blakeley and McNaughton, 2014; Crawford et al., 2016) (Figure 1B). We designed a gRNA that includes the TAR hairpin, a nucleotide linker sequence (L), and then a guiding sequence (Figure 1C). To develop and validate the system, we first engineered a programmable ribonuclease by fusing TBP6.7 to the Pin nuclease domain of human nonsense-mediated mRNA decay factor SMG6, which has been previously used as a non-specific proximity-dependent RNA endonuclease (Batra et al., 2017; Choudhury et al., 2012). Although this simplest design already displayed promising gRNA-mediated transcript degradation in cell-based luciferase assays (Figure S2A), the performance was quite poor, which we attributed to the potential degradation of the displayed guiding sequence. The protein surface and hairpin channel of Cas13 systems tend to be highly charged, likely to non-specifically bind and stabilize the guiding RNA sequence (Liu et al., 2017). To engineer this RNA protection function into our system, we added a non-specific, low affinity single-stranded RNA binding protein (ss RNA binding protein) to our construct. However, the human proteome did not readily contain an annotated small, non-specific single-stranded RNA binding protein to the best of our knowledge. Therefore, we developed CIRTS-1 using a small viral ssRNA binding protein, ORF5 (Zhou et al., 2006). Altogether, CIRTS-1 is a protein fusion complex composed of ORF5-TBP6.7-Pin nuclease domain along with a corresponding gRNA (Figure 1B).
We first characterized gRNA-dependent RNA binding and ribonuclease activity of CIRTS-1 in vitro on model RNA target substrates. The Pin nuclease domain was previously shown to be active in the presence of Mn2+ and activity could be quenched by the addition of EDTA (Choudhury et al., 2012). Directly overexpressing CIRTS-1 led to insoluble protein, which we resolved by fusing an N-terminal MBP tag to CIRTS-1 (MBP-CIRTS-1). Using purified MBP-CIRTS-1 protein and gRNAs in filter binding assays, we found MBP-CIRTS-1 binds a target RNA (STAR Methods) in a gRNA-dependent manner with an apparent binding dissociation constant (KD) of 22 nM (Figure 2A). Critically, if we provide the system with a non-targeting gRNA, we see ~ 50-fold weaker binding (Figure 2A). Moreover, in a cleavage assay, we found that MBP-CIRTS-1 cleaves an RNA substrate in a gRNA- and Mn2+-dependent manner, confirming the activity of the Pin ribonuclease domain in the fusion context (Figure 2B). Collectively, these in vitro results validate the design principles behind CIRTS-1 and motivated us to optimize the system for use in live cells.
Figure 2. CIRTS-1 in vitro binding and RNA cleavage assays.
(A) Filter binding assay evaluating the binding affinity of MBP-CIRTS-1 with on-target gRNA and non-targeting RNA complex to a labeled RNA substrate. Fitting the data to a quadratic binding equation revealed an apparent KD of 22 ± 7 nM for the on-target gRNA:protein complex and an apparent KD around 500 nM for the non-targeting gRNA:protein interaction to the same substrate RNA.
(B) Cleavage assay run on a 10% denaturing Urea PAGE gel in presence of 0.5 mM MnCl2. An IR800-labeled RNA substrate is cleaved in a gRNA-dependent manner.
Optimization of CIRTS-1 in live cells
To test the target nuclease activity of CIRTS-1 in live mammalian cells, we established a dual luciferase reporter assay that reports on gRNA-dependent transcriptional changes on a target firefly luciferase (Fluc) RNA (Figure 3A). Using this system, we optimized the deployment of the Pin nuclease CIRTS by assaying different protein linker types (Figure S3A), gRNA structures and lengths (Figure S3C), and CIRTS nuclease cellular localization (Figure S2B) using a gRNA targeting site we previously found to be effective for Cas13-based knockdown (Rauch et al., 2018). For this first-generation design, we assayed three linker types with different rigidities between the hairpin-binding protein and the effector domain to assess which one positioned the effector protein best on the target strand while keeping the linker between the ssRNA binding protein and the hairpin binding protein constant. Additionally, we tested different numbers of linking nucleotides (L) on our gRNA (denoted ‘XXXXX’ in Figure 1C), ultimately settling on a linker composed of -UUAUU- between the hairpin structure and guiding sequence. We found that a long flexible linker between the hairpin-binding protein and 40 nucleotide long gRNA resulted in the best knockdown efficiency. We designed gRNAs that target the firefly luciferase mRNA in the dual-luciferase reporter assay for both CIRTS-1 and Cas13b, as well as control, non-targeting gRNAs (targeting a lambda phage sequence) for each programmable nuclease. To test whether binding to the transcript alters protein levels, we engineered CIRTS-0, which contains a previously reported deactivating mutation in the Pin nuclease domain of CIRTS-1 (Eberle et al., 2009), serving as a negative control. We found that CIRTS-0 has no significant effect on the expression level of the target transcript (Figure 3B and Figure S2C), indicating binding by the CIRTS ribonucleoprotein to a target RNA is minimally perturbative to the targeted transcript. Additionally, we verified that gRNA binding alone does not introduce detectable target RNA degradation (Figure S2A). Next, we tested whether CIRTS-1, containing an active nuclease, could mediate degradation of the target. Indeed, we found gRNA-dependent degradation of the target Fluc mRNA, measured at both the protein level as monitored by luciferase activity (Figure 3C) and the mRNA levels as monitored by RT-qPCR (Figure S2D). Both results suggest the CIRTS strategy is a viable method in live cells After optimization, we compared the ability of optimized CIRTS-1 (Pin nuclease) to degrade the target reporter RNA to the Cas13b system (Cox et al., 2017) (Figure 3C). Although CIRTS-1 is less efficient at targeting the reporter gene as compared to Cas13b, the performance was not dramatically different, especially considering that Cas13b systems have evolved to perform this knockdown function. Encouraged by the performance of CIRTS-1 (Pin nuclease), we next sought to assess the versatility of the design by testing whether each component of the system, including the gRNA, hairpin binding domain, non-specific RNA binding domain, and effector protein, could be swapped for other parts to achieve CIRTS with diverse functions.
Figure 3. CIRTS mammalian cell reporter assays.
(A) General overview of the dual luciferase assay. A reporter construct that contains both firefly luciferase and Renilla luciferase is used in all assays. We targeted CIRTS to the firefly luciferase transcript, while using Renilla luciferase as an internal control. For all subsequent assays, HEK293T cells were transfected with the reporter vector, a CIRTS vector, and a gRNA vector.
(B) Catalytically-inactive CIRTS-0 was used as a control. After 48 h of incubation, we observed no decrease in protein readout. Values shown as mean ± SEM with n = 3 biological replicates.
(C) Comparison of CIRTS-1 with Cas13b nuclease. Cells transfected with either CIRTS-1 or Cas13 and the corresponding gRNA targeting Fluc show reduced protein levels. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05, **P < 0.01.
(D) HEK293T cells transfected with CIRTS-2 show an increase in protein level after transfection. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: **P < 0.01.
(E) HEK293T cells transfected with CIRTS-3 show the anticipated decrease in protein level. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05.
(F) Switching the hairpin-binding protein to SLBP still results in decrease protein levels after 48 h of transfection. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05.
(G) Cells transfected with a fully humanized CIRTS (CIRTS-5 and CIRTS-6) system and an on-target gRNA for firefly luciferase result again in decreased protein levels. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05.
Modularity of CIRTS on Reporter Transcripts
To explore the versatility of the CIRTS design, we first assayed whether CIRTS could deliver RNA epitranscriptomic regulatory “reader” proteins, which we previously delivered using the dCas13b system (Rauch et al., 2018). For our study, we chose to focus on regulatory proteins of N6-methyladenosine, the most prevalent mRNA modification. On average each transcript contains three modifications sites with high m6A abundance detected in the 3’UTR, and m6A has been shown to have regulatory roles in splicing (Xiao et al., 2016), translation (Meyer et al., 2015; Wang et al., 2015), and stability (Du et al., 2016; Wang et al., 2013). We exchanged the Pin nuclease effector protein of CIRTS-1 for the N-terminal domain of the YT521-B homology domain family protein 1 (YTHDF1), a cytoplasmic m6A reader protein that recruits the translation machinery (Wang et al., 2015), to generate CIRTS-2. Note that CIRTS-2 does not include the C-terminal YTH domain of YTHDF1 that recognizes m6A. When CIRTS-2 (YTHDF1) is delivered to the same target sequence as the CIRTS-1 experiments, the RNA levels are relatively unchanged (Figure S2E), but a significant increase in protein levels from the RNA is generated (Figure 3D), consistent with the previously reported YTHDF1 activity (Wang et al., 2015). We then exchanged the YTHDF1 fragment for a fragment of YTHDF2, an m6A reader protein that recruits the RNA deadenylation machinery and induces RNA degradation (Du et al., 2016; Wang et al., 2013), to generate CIRTS-3. Delivery of CIRTS-3 (YTHDF2) to the reporter mRNA induces degradation of the target transcript as measured by both RNA (Figure S2F) and protein levels (Figure 3E). CIRTS-1 through −3 demonstrate the versatility of the design strategy to deliver a range of effector protein cargoes to target RNA in live cells.
After demonstrating the modularity of the effector domain, we set out to assess if other human parts could also be used for the RNA hairpin binding domain and non-specific ssRNA binding protein. We replaced TBP6.7 in CIRTS-3 (YTHDF2) with the RNA hairpin binding domain of the human histone stem loop binding protein (SLBP) to generate CIRTS-4 (YTHDF2). Concurrently, we designed a gRNA based on the histone mRNA stem loop structure (Figure 1D). Assaying CIRTS-4 (YTHDF2) in the reporter assay (Figure 3F) and by RT-qPCR to assess RNA levels (Figure S2G) revealed similar performance as CIRTS-3, confirming other hairpin binding domains can be used as the core of the CIRTS.
Next, we sought to engineer entirely humanized versions of the CIRTS system. As stated earlier, we designed the initial proof-of-concept systems based on the viral non-specific, single-stranded RNA binding protein, ORF5. Although there are no annotated human single-stranded, non-specific RNA binding proteins, we reasoned highly charged, cationic human proteins could fulfill the role of ORF5 in the CIRTS system (Cronican et al., 2011). We therefore engineered HBEGF and β-defensin 3, two cationic human proteins, in the place of ORF5 in CIRTS-3 to generate CIRTS-5 and CIRTS-6, respectively. Again, deploying these programmable effectors in the luciferase reporter assay revealed gRNA-dependent degradation of the target gene (Figure 3G and S2H) mediated by the YTHDF2 epitranscriptomic regulation.
Finally, we used CIRTS to deliver the catalytic domain of human ADAR2 (hADAR2) to RNA transcripts to confirm CIRTS’ versatility in scope of functions with an additional effector protein. We designed a dual luciferase reporter that contains a G-to-A mutation in the coding region of firefly luciferase resulting in a premature stop of translation and no measurable firefly luciferase activity (Figure 4A and S2J). We then deployed CIRTS to deliver wt hADAR2 (CIRTS-7) or hADAR2 E488Q (CIRTS-8), a known hyperactive mutant of hADAR2 (Kuttan and Bass, 2012), to the mutated position, which resulted in gRNA-dependent rescue of luciferase activity in both cases (Figure 4B). The hyperactive hADAR2 mutant showed higher editing efficiency and a higher background in the absence of an on-target gRNA based on luciferase assay. However, using the hyperactive mutant could be beneficial to allow targeting of a wider substrate scope as it has relaxed sequence constraints (Kuttan and Bass, 2012). To verify that the observed editing signal was indeed gRNA and hairpin-binding protein-dependent, we transfected cells with the gRNA alone or with gRNA and TBP6.7-lacking hADAR2 construct. In our assay, we only observed substantial editing in the presence of both gRNA and our CIRTS editor (Figure S2J). Collectively, the performance of these various CIRTS in the reporter assays demonstrates the modularity of the CIRTS design, including the hairpin-binding domain and corresponding gRNA, the single-stranded RNA binding protein, and the effector protein.
Figure 4. CIRTS for RNA editing.
(A) Schematic overview of the RNA editing reporter assay used. A single G-to-A mutation was introduced in the coding sequence of firefly luciferase resulting in a W417X (X = STOP) codon switch and no measurable firefly luciferase signal (Figure S2J).
(B) Delivery of CIRTS-7 (hADAR2 wt) and CIRTS-8 (hADAR E488Q) with an on-target gRNA shows significant RNA editing that results in measurable firefly luciferase signal. Both the background and the editing efficiency of CIRTS-8, the hyperactive hADAR2 mutant, are found to be higher compared to wildtype hADAR2. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: ***P < 0.001.
Targeting endogenous mRNAs with CIRTS
We next sought to assess whether the CIRTS could deliver an effector protein to a target endogenous transcript, using the CIRTS-1 programmable nuclease and CIRTS-3 programmable YTHDF2-mediated decay systems as exemplars. We selected five RNA transcripts that have been previously validated as Cas13 targets, reasoning that these are accessible for RNA targeting by programmable RNA-binding systems. We then designed gRNAs for each target, using the same binding sites on the targets that were previously used in Cas13 experiments (Abudayyeh et al., 2017; Konermann et al., 2018). We assayed the effects of the CIRTS on RNA levels of each target by RT-qPCR. When cells were transfected with either CIRTS-1 or CIRTS-3, along with a specific gRNA expressing vector, we observed a significant decrease in RNA level by RT-qPCR for each of the five endogenous mRNA transcripts (Figure 5A and 5B). In addition to targeting mRNA, we also verified that we can target other RNA species such as lncRNA by targeting CIRTS-1 (Pin nuclease) to MALAT1 (Figure S4A). The relative knockdown efficiency varied for each gene, which is also observed in other RNA-targeting systems and is potentially mediated by accessibility, differences in gRNA expression and composition, or other regulatory pathways specific to each gene. Nonetheless, these results confirm that CIRTS can target endogenous transcripts and mediate decay through either active nuclease activity on the target or by triggering endogenous epitranscriptomic regulatory pathways.
Figure 5. Targeting endogenous transcripts with CIRTS.
(A) Nuclease-mediated knockdown of five endogenous transcripts upon transfection of cells with CIRTS-1 as assayed using qPCR. CIRTS-1 can be used to target endogenous transcripts of interest by co-transfecting a gRNA with the corresponding on-target guiding sequence. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05, **P <0.01, ***P <0.001.
(B) RT-qPCR analysis of YTHDF2-mediated knockdown of endogenous transcripts with CIRTS-3. Cells transfected with CIRTS-3 show gRNA-dependent decreases in RNA level for all five transcripts tested. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05.
(C) Analysis of protein levels after transfection with CIRTS-2 or CIRTS-3 by Western blot. CIRTS-2 induces an increase in protein levels, whereas CIRTS-3 shows the expected decrease in protein levels, both in a gRNA-dependent manner.
(D) gRNA screen along SMARCA4 using CIRTS-3 to induce gRNA-dependent RNA decay. We see significant changes in the amount of induced decay dependent on where the transcript is targeted (n = 2 or 3).
Next, we set out to assess whether CIRTS-2 could trigger protein production of an endogenous transcript through a YTHDF1-mediated epitranscriptomic pathways. We selected an abundant transcript PPIB with a reported, reliable antibody for analysis of CypB (the protein product of PPIB) protein production by western blotting. Indeed, cells transfected with CIRTS-2 and an on-target gRNA showed an increase in protein level (Figure 5C and Figure S4C) without a change in RNA levels (Figure S4B), consistent with prior reported YTHDF1 effects on the transcript (Wang et al., 2015). As a control, the same experiment performed with CIRTS-3, which delivers YTHDF2, results in slight decrease in protein levels, which correlates with the decrease in mRNA levels (Figure 5B and S4C).
Finally, as a first test of transcript position-specific effects, we tiled gRNAs along the SMARCA4 mRNA and tested YTHDF2-mediated decay by CIRTS-3. We found dramatically different performance of the system depending on where the gRNA lands on the targeted mRNA (Figure 5D), which is likely the result of both CIRTS binding accessibility and the regulatory protein sequence requirements. Taken together, these experiments show that the CIRTS platform is functional on endogenous transcripts in a gRNA-dependent manner, and can actively degrade a target transcript, trigger degradation machinery to act on the target transcript, or activate translation and increase protein production from the target transcript.
Targeting Specificity of CIRTS
To gain insights into how specific CIRTS is at targeting RNA substrates, we designed a series of experiments that address the sensitivity of the gRNA to mismatches, transcriptome-wide off-targets, and endogenous substrate targeting. To assess mismatch tolerance, we designed a luciferase-based mismatch experiment that allows us to assay targeting effects when introducing one, two, or three mismatches into the duplex formed between gRNA and target RNA. We chose to fuse the disease-relevant KRAS4b transcript to our luciferase reporter and asked whether our engineered system can differentiate between the cancer-associated G12D (target 1), the wild type (target 2), the G12C (target 3), and a G12W (target 4) KRAS4b variants (Figure S5A). We found that CIRTS yields comparable knockdown of the G12D and wild type variants indicating that one mismatch does not cause large changes in targeting specificity (Figure S5B). However, when we targeted the system to the G12C and G12W reporters, which contain two and three mismatches respectively, CIRTS knockdown efficiency decreased.
We next assessed whether increasing the gRNA length could affect the mismatch tolerance of CIRTS, focusing on mismatches in the center region of the duplex formed between gRNA and target RNA as they showed the largest effect on knockdown efficiency in our assay. As observed with the shorter 20 nt gRNA, we see no difference in knockdown efficiency when we target a reporter with no or one mismatches. However, a longer 40 nt gRNA can rescue some of the effects when the two-mismatch variant was targeted, indicating that the gRNA length contributes to the efficiency of the system (Figure S5D). As a comparison to existing technology, we subjected Cas13b to the same mismatch assay, which showed that Cas13b is less sensitive to mismatches in general. Targeting Cas13b to reporters with one and two mismatches yielded little change in knockdown efficiency, while three mismatches led to a substantial decrease in knockdown efficiency (Figure S5C). Both Cas13b and CIRTS are most sensitive to mismatched base-pairing in the center of the duplex formed between gRNA and target RNA, a finding that agrees well with previous studies of Cas13b (Abudayyeh et al., 2017; Cox et al., 2017).
To assess transcriptome-wide off-targets, we subjected our system to RNA sequencing. We assayed effects of the CIRTS Pin nuclease and CIRTS YTHDF2 targeting the endogenous transcript SMARCA4 (Figure S5E and S5F). In both cases, we find no statistically significant off-targets. However, while we see knockdown of the targeted transcript and even statistically significant knockdown by CIRTS-3 (YTHDF2) when we look at the target transcript only (pval <0.1), the knockdown levels do not fall into a statistically significant region when evaluated in a transcriptome-wide manner (qval < 0.1) (Figure S5G, Table S6). However, together the results of our mismatch assay and the fact that we observed no statistically significant gRNA-dependent off-targets indicate that the selective knockdown efficiency can be further optimized in future studies.
To verify CIRTS bind the transcript of interest, we furthermore performed RNA immunoprecipitation followed by RT-qPCR. We designed gRNAs to target two endogenous transcripts that were previously targeted by Cas13 systems, PPIB, and B4GALNT1 (Cox et al., 2017; Konermann et al., 2018). We separately delivered each gRNA along with CIRTS-0 (dead nuclease CIRTS) fused to a 3x FLAG-tag. We then subjected lysates to immunoprecipitation with an anti-Flag antibody and quantified the relative amounts of each target RNA bound to the protein. Indeed, both endogenous transcripts were enriched between 2.5- and 5-fold in a gRNA-dependent manner (Figure S5H), confirming CIRTS function as a programmable RNA-guided RNA binding protein on endogenous transcripts.
Multiplexed targeting of multiple endogenous RNAs with CIRTS
The targeting specificity and the modularity of CIRTS inspired us to extend the application of CIRTS in a multiplexed targeting manner. Rather than delivering a single effector protein and targeting a single transcript at a time, we set out to test whether CIRTS can target more than one transcript or deliver more than one effector protein in the same sample. In principle, CIRTS built from the TBP hairpin binding domain and CIRTS built from the SLBP hairpin binding domain, which each use separately engineered gRNAs (Figure 1C and 1D), should be orthogonal to one another, permitting selective targeting of multiple transcripts with either the same or even different CIRTS.
First, we tested whether a single CIRTS can be used to simultaneously target multiple transcripts. We co-transfected cells with CIRTS-6 (YTHDF2) along with three gRNAs targeting PPIB, SMARCA4, and NRAS and assessed changes in RNA level by RT-qPCR. As expected, we observed a decrease in RNA levels for all three targeted transcripts (Figure 6A and 6B). However, we observed a slight decrease in efficiency when we deploy several gRNAs or CIRTS in the same cells, which we attribute to the simultaneous transfection of cells with four plasmids.
Figure 6. Multidimensional targeting and viral delivery of CIRTS.
(A) Schematic of delivery of CIRTS-6 and three gRNAs.
(B) CIRTS-6 can be delivered with three distinct gRNAs for PPIB, SMARCA4, and NRAS and simultaneously cause knockdown of all three transcripts. n = 5 biological replicates. Student t-test: **P <0.05, ***P <0.001.
(C) Schematic of simultaneous CIRTS delivery with different effector proteins.
(D) Changes in luciferase protein levels and PPIB transcript levels when cells were transfected with both CIRTS-9 (YTHDF1) and CIRTS-10 (YTHDF2) and gRNAs for Fluc and PPIB respectively. Both orthogonal CIRTS retain their individual functions and act simultaneously in cells. n = 5 biological replicates. Student t-test: *P < 0.1, **P <0.05.
(E) Transfer plasmid for AAV delivery containing both the CIRTS-6 (YTHDF2) as well as the gRNA component of the system. The total insert size between the two inverted terminal repeats (ITR) was 2.7 kb.
(F) AAV-packaged CIRTS-6 and a gRNA targeting luciferase was delivered to HEK293T cells to knockdown firefly luciferase in the dual luciferase reporter assay.
(G) AAV-packaged CIRTS-6 and a gRNA targeting SMARCA4 was delivered to HEK293T cells to knockdown the endogenous gene, which revealed efficiency comparable to that achieved by transient transfection. Values shown as mean ± SEM with n = 3 biological replicates. Student t-test: *P < 0.05.
To test whether two different types of effectors can be used simultaneously, we next deployed both CIRTS-9, a fully humanized version of the YTHDF1 construct, to target firefly luciferase and CIRTS-10 (YTHDF2) to target SMARCA4 (Figure 6C and 6D). We find that both proteins are active and induce the anticipated increase in luciferase protein and decrease in RNA levels respectively. Moreover, to further corroborate the orthogonality of multiple-targeting CIRTS, we deployed two CIRTS, CIRTS-6 (TBP6.7) and CIRTS-10 (SLBP) (Figure S6A and S6B), but use different hairpin-binding modules, to deliver YTHDF2 to two different endogenous target mRNAs (Figure S7A). Each CIRTS degraded the target transcript in an on-target gRNA-dependent manner, with minimal crosstalk between the two systems (Figure S7B).
At this point, we conclude that the TBP6.7 and SLBP-based CIRTS can each simultaneously target endogenous transcripts in a gRNA-dependent manner. Although not human-derived, we found that other hairpin-binding systems, such as PP7, can also be used to generate CIRTS, suggesting it is possible to generate a range of selective and orthogonal systems (Figure S2I). CIRTS allow for multiple regulatory proteins to be simultaneously delivered, for example to target one transcript for degradation and another for translational activation, opening up possibilities for cell reprogramming by targeting multiple genes at once in multiple dimensions (Bao et al., 2017; Gao et al., 2016).
Viral Delivery of CIRTS by AAV
Aside from the human-derived nature of CIRTS, another core advantage is the small size of CIRTS, which should permit more efficient viral packaging and delivery. Adenovirus-associated virus (AAV) is a versatile delivery vehicle to deliver transgenes and gene therapies to different cell types due to wide range of serotypes available (Gao et al., 2005), low immune response stimulation (Vasileva and Jessberger, 2005), and low risk of genome insertion (Gao et al., 2005; Naso et al., 2017). However, it has been challenging to package and deliver many Cas13 proteins due to a limited packaging capacity of about 4.7 kb (Wu et al., 2010). To showcase the possibility of CIRTS to be delivered by AAV, we designed a dual CIRTS-6/gRNA transfer plasmid and packaged it in the AAV delivery vehicle. The total insert, including the CIRTS protein and gRNA, is only 2.7 kb (Figure 6E). We found that transduction of HEK293T cells with the generated virus recapitulates the knockdown efficiency of CIRTS-6 on both the luciferase reporter as well as an endogenous target (Figure 6F and 6G), confirming viral-delivered CIRTS are still functional and providing a pathway toward clinical deployment. In future applications, one could imagine packing more than one CIRTS into the AAV delivery vehicle to simultaneously target one transcript for upregulation and one transcript for degradation as previously shown by transient transfection.
DISCUSSION
In summary, here we presented CIRTS, a versatile strategy for engineering programmable RNA effector proteins. CIRTS are small, can be fully humanized, can target endogenous RNAs in live cells, and can work for multidimensional transcriptome control. As research tools, CIRTS should provide advantages to previous methods because of their smaller size. For example, CIRTS-2 and CIRTS-3 are 65 and 36 kDa respectively, while the comparable Cas13b-based programmable YTHDF1 and YTHDF2 systems are 155 and 126 kDa, respectively (Figure 7). CIRTS-1 is even smaller than the smallest DNA-targeting Cas protein found to date, Cas14a and the smallest Cas12g RNA-targeting protein (Harrington et al., 2018; Yan et al., 2019).
Figure 7. Comparing CIRTS to other DNA and RNA-targeting CRISPR-Cas systems.
Schematic size comparison of commonly used Cas9, Cas12, Cas13, and CIRTS.
From a translational perspective, CIRTS should offer several key advantages and opportunities. The humanized nature of the CIRTS will provide a pathway toward avoiding immune responses, opening up the potential for continuously-delivered therapies. While the fusions between the human proteins in the CIRTS present potential limitations in the design where the immune system could respond to (Glaesner et al., 2010), this is a problem that can in principle be engineered around. When we computationally predicted the immunogenicity of the highest likelihood MHC I binding peptides in our engineered constructs, we find that the fully humanized CIRTS shows lower propensity to cause immune reactions (Figure S7C), but further experimental testing is needed to discover where the limitations in the design emerge.
Several challenges remain with the current CIRTS. First, the alternative hairpin binding protein SLBP in its current form has an endogenous RNA hairpin binding partner, which could influence stem loop RNA trafficking. To minimize endogenous effects of our fusion constructs, we only included the minimal RNA recognition motif (RRM) necessary for hairpin recognition in our system and omitted regions of potential interactions with other proteins or nucleic acids. Likewise, we tried to keep the required RNA hairpin as small as possible to avoid potential endogenous interactions. The stem loop hairpin was already very short and could not be further truncated but we chose to only use the minimally required region necessary for TBP6.7 binding to the TAR hairpin, resulting in a gRNA with less than half the original hairpin length. Second, the cationic peptide, β-defensin 3, in its current form can theoretically still interact with its intracellular binding partners and elicit unwanted biological responses. However, human β-defensin 3 has been extensively studied (Dhople et al., 2006; Kluver et al., 2005), potentially allowing us to engineer b-defensin 3 mutants that retain the highly charged nature required for CIRTS, but abolish endogenous functions in order to engineer a human part-based, orthogonal RNA targeting system.
From a broader perspective, the CIRTS platform demonstrates the potential of combining parts contained within the human protein toolbox to engineer proteins with new properties. The presented CIRTS were created through minimal protein engineering and optimization efforts, but function nearly as well as the naturally-evolved CRISPR-Cas systems. In particular, when we compared the Cas13b-based knockdown by its endogenous nuclease and by delivering YTHDF2 (Figure S6C) to CIRTS-mediated knockdown, we find that while the Cas13b nuclease performs substantially better than CIRTS nuclease, we see no difference in knockdown mediated by YTHDF2, suggesting CIRTS-3 (YTHDF2) in its current state can already be used to manipulate the epitranscriptome effectively. Further work optimizing the CIRTS using directed evolution will likely yield variants that have improved performance in mammalian systems (Hu et al., 2018). Understanding target site design and effector protein contextual requirements will also improve CIRTS performance, and a better understanding of the epitranscriptomic pathways being exploited will allow us to design better systems. Additionally, there are a range of other regulatory proteins contained within the human proteome that likely house unique RNA control properties (Dominguez et al., 2018), which can be coupled with CIRTS to create programmables versions of each protein for both functional characterization and potential translational applications. CIRTS provides an alternative approach for studying and exploiting RNA regulation and will open up future opportunities to intervene in cell regulation for disease treatment.
STAR METHODS
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Bryan C. Dickinson (dickinson@uchicago.edu).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Escherichia coli strains (10-beta and BL21 (DE3))
E. coli 10-beta cells were used for all cloning and cultured in Luria-Bertani (LB) broth. E. coli BL21 (DE3) cells were used for protein expression for in vitro studies. Cells were grown in 2 XYT media to an OD of ~0.6 at 37°C before being induced with 0.5 mM IPTG (bioWORLD) and incubated at 16 °C for 16 h.
Cell culture of Human Embryonic Kidney (HEK) 293T cells
Human embryonic kidney (HEK) cell line 293T (female, ATCC) was maintained in DMEM (L-glutamine, high glucose, sodium pyruvate, phenol red; Corning) media supplemented with 10% fetal bovine serum (FBS; Gemini Benchmark), and 1x penicillin/streptomycin (P/S; Gibco/Life Technologies) at 37°C with 5% CO2. When reaching 90%−100% confluency, cells were lifted with Trypsin-EDTA 0.25% (Gibco) and passaged at a ratio of 1:2. This cell line was purchased directly from the manufacturer and no further authenticated was performed.
METHOD DETAILS
Cloning
All plasmids were generated using Gibson Assembly and sequenced by the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility. PCR fragments for Gibson Assembly were amplified using Q5 DNA Polymerase (NEB). All plasmids used in this study are listed in Table S1, S2, and S3 with links to fully annotated vector maps and are available upon request. The original pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA was a gift from Feng Zhang (Addgene plasmid # 61591; http://n2t.net/addgene:61591; RRID:Addgene_61591), the original dPspCas13b plasmid pC0050-CMV-dPspCas13b-longlinker-ADAR2DD(wt) was a gift from Feng Zhang (Addgene plasmid # 103866; http://n2t.net/addgene:103866; RRID:Addgene_103866), pAAV2/1 and pAdDeltaF6 were gifts from James M. Wilson (Addgene plasmid # 112862; http://n2t.net/addgene:112862; RRID:Addgene_112862 and Addgene plasmid # 112867; http://n2t.net/addgene:112867; RRID:Addgene_112867). Key plasmids will be made available through Addgene.
Protein Expression and Purification
E. co//-optimized synthetic genes for ORF5, TBP6.7, and the Pin nuclease from SMG6 were purchased as gBlocks (Integrated DNA Technologies) and cloned into a pET vector-derived pMCSG19 protein expression vector (MBP-TVMV-6xHis-TEV) using Gibson Assembly. The ORF5-TBP6.7-Pin construct was transformed into BL21(DE3) cells (NEB). A 10 mL seed culture was used to inoculate 2 L of 2XYT (16 g/L digest peptone, 10 g/L yeast extract, 5 g/L sodium chloride, US Biological) supplemented with 100 μg/mL carbenicillin. Cells were grown to an optical density of 0.6 OD600 at 37 °C before being chilled to 16 °C on ice. Once cooled to 16 °C, CIRTS-1 expression was induced with 0.5 mM IPTG (bioWORLD). Induced cultures were grown at 16 °C for 12–16 h before the cells were lysed to harvest the protein.
The cells were pelleted by centrifuging at 1,500 g for 15 min at 4 °C. The resulting pellet was either directly purified or stored at −80 °C for later purification. For purification, cells were lysed with 100 mL lysis buffer (50 mM Tris, 1 M NaCl, 20% glycerol, 10 mM TCEP, pH 7.5) supplemented with protease inhibitors. The resuspended cells were lysed using sonication (Thermo Fisher). Lysates were cleared by centrifuging at 12,000 g for 40 min at 4 °C. Cleared lysates were incubated with His60 Ni Superflow Resin (Takara) for 1 h at 4 °C with constant gentle agitation. After 1 h, the resin was washed with lysis buffer and eluted with a gradient imidazole elution (10 mM-500 mM). Fractions containing the protein, as assessed by SDS-PAGE, were pooled and concentrated using Ultra-50 Centrifugal Filter Units with 30 kDa cutoff (Amicon, EMD Millipore). After sufficient concentration, the combined fractions were desalted and buffer exchanged into protein storage buffer (50 mM Tris-HCl pH 7.5, 300 mM NaCl, 10 % glycerol, 1 mM DTT) using Sephadex G-25 in PD-10 Desalting Columns (GE Healthcare Life Sciences). The protein was stored at −80°C or directly used for biochemical assays. The concentration was measured using standard BCA Assay (Thermo Scientific).
In vitro RNA preparation
DNA oligomer templates containing a T7 RNAP promoter were synthesized by IDT. Templates for all transcribed RNAs were amplified using PCR prior to transcription. For a 250 μL reaction, 12 μg PCR product was incubated with 1x transcription buffer (40 mM Tris-HCl, 2 mM spermidine, 10 mM NaCl), 25 mM MgCl2, 10 mM DTT, 40U SUPERaseIn, 4 mM of each NTP, and 40 μg/mL T7 RNAP at 37 °C overnight. The next day, the resulting mixture was DNasel digested in 1x DNasel buffer for 30 min at 37 °C. RNA was then gel-purified after separation on a 10% 8 M TBE-urea/PAGE gel and purified using the ZR small-RNA PAGE Recovery Kit (Zymo). The target RNA for both the nuclease and the filter binding assays was then 5’-end labeled using the 5’ oligonucleotide labeling kit (Vector Labs) with a maleimide-IR800 probe (LI-COR Biosciences) according to the manufacturer’s instructions. The labeled RNA was purified using the RNA Clean and Concentrator Kit (Zymo).
Nuclease Cleavage Assay
The nuclease cleavage assay was performed in Pin domain nuclease buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1 mM DTT, 0.5 mM MnCl2, 10% glycerol) with 450 nM labeled substrate (R2), 360 nM gRNA (R4) and 250 nM purified MBP-CIRTS-1. Reactions were incubated for 2 h at 37 °C before being quenched with proteinaseK buffer (60 mM EDTA, 4 M urea, proteinaseK). The proteinaseK reaction was incubated for 30 min at 37 °C and then denatured further by the addition of 5 M urea and loading dye. Samples were boiled for 7 min at 75 °C and analyzed by denaturing gel electrophoresis on a 10% denaturing PAGE gel with 8M urea. Gels were imaged using an Odyssey scanner (LI-COR Biosciences).
Filter Binding Assay
Filter binding assays were performed as previously reporter (Boyle et al., 2017) using two-fold complex dilution of the 1x protein:1x gRNA (0.5 μM - 2 nM). For all reactions, 10 nM labeled substrate were used. The reactions were run in nuclease buffer in the absence of MnCl2 to prevent any cleavage and supplemented with 100 μg/mL heparin and 100 μg/mL tRNA to prevent non-specific interactions. The gRNA and CIRTS were pre-incubated for 5 min at 37°C. Then, the substrate was added and the reaction was incubated for 30 min at 37°C. The reactions were then loaded onto a dot-blot apparatus through Nitrocellulose, Hybond-N+ membranes, filter paper in that order. Membranes were washed with equilibration buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1 mM DTT, 10% glycerol) and visualized using an Odyssey scanner (LICOR Biosciences). Data were fit to a quadratic binding equation using Prism (GraphPad Software).
Luciferase Reporter Assay
To assess changes in protein levels, HEK293T cells were transfected with 12.5 ng dual luciferase reporter plasmid (Promega), 150 ng of the indicated CIRTS expression vector, and 100 ng of the gRNA expression vector. About 16 h before transfection, cells were plated on 96-well plates (Corning) and allowed to grow to 70–80% confluency overnight. The next day, a total of 20 μL Opti-MEM I Reduced Serum Medium (ThermoFisher Scientific) per well was used after combining 10 μL Opti-MEM with 0.5 μL lipofectamine 2000 and 10 μL containing all the transfection DNA. The solutions were combined and incubated for 15 min before slow addition to cells. After 48 h, luciferase readouts of firefly luciferase and Renilla luciferase were sequentially measured using the DualGlo Luciferase Assay System (Promega) on a Biotek Synergy plate reader according to the manufacturer’s instructions. All experiments were conducted in at least biological triplicates. Firefly luciferase luminescence levels were normalized to the corresponding Renilla luminescence levels to generate the normalized change in protein levels from the target firefly luciferase gene.
RT-qPCR
To assess changes in RNA levels after transfection of a CIRTS, total RNA was isolated from HEK293T cells and changes in RNA levels were quantified using RT-qPCR. Cells were plated on 96-well plates (Corning) and transfected at 80% confluency as described above for luciferase assays. Total RNA was harvested 48 h after transfection and isolated using the RNeasy Mini Kit (Qiagen). After RNA isolation, RNA was reverse transcribed to cDNA using the PrimeScript RT Reagent Kit (TaKaRa). All qPCR reactions were run at 20 μL volumes with three biological replicates using FastStart Essential DNA Green Master (Roche) and amplified on a LightCycler 96 Instrument (Roche). Only experiments that showed no amplification of the o cDNA control reactions and sharp, single-product melting peaks were used for analysis. All reactions were run with at least three biological replicates. qPCR primers were either identified based on previous publications (Konermann et al., 2018) or verified for specificity using NCBI Primer BLAST. Expression levels were calculated using the housekeeping control gene (GAPDH) cycle threshold (Ct) value and the gene of interest Ct value. The relative expression level of one gene was determined by 2−ΔCt, where ΔCt = Ct (gene of interest) - Ct (GAPDH). Relative expression level for targeted gene was obtained upon normalizing the targeted gene expression level of cells experiments treated with the on-target gRNA to those treated by the nontargeting (NT) gRNA. All qPCR primers can be found in Table S5.
Western Blotting
For Western blots, HEK293T cells were plated on 12-well plates (Corning) and transfected with 1.5 μg of a CIRTS expression vector and 1.3 μg of a gRNA expression vector. After 48 h, the cells were washed twice with ice-cold PBS and lysed in 50 μL RIPA buffer (50 mM Tris, 150 mM NaCl, 0.5% deoxycholate, 2% SDS, pH 7.4) supplemented with protease inhibitors. After 30 min room temperature incubation, the concentration was measured by BCA assay (Thermo Scientific). 35 μg protein was boiled in protein loading buffer (50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 0.05% bromphenol blue, 100 mM DTT) for 10 min at 95 °C and loaded onto a 12% SDS PAGE gel. After stacking at 70 V, the gel was run at 120 V until the dye front reached the bottom, and the proteins were transferred onto a PVDF membrane (Millipore) and blocked in 5% nonfat milk in TBST. Proteins were then detected using 1:500 mouse anti-CypB antibody (Santa Cruz), followed by 1:1000 anti-mouse HRP-conjugated antibody (Santa Cruz). The loading control GAPDH was visualized using 1:5000 HRP-conjugated anti-GAPDH antibody (Proteintech). Membranes were imaged on a Fluor Chem R (Protein Simple) imager after incubation with Super Signal West Pico Plus (Thermo Scientific).
RNA Immunoprecipitation
For RNA immunoprecipitation experiments, HEK293T were plated on 6-well plates (Corning) and transfected with 1.3 μg of the CIRTS-0 expression vector and 1.7 μg of a gRNA expression vector. After 48 h of incubation, cells were washed twice with ice-cold PBS and then fixed with 1% paraformaldehyde in PBS for 15 min at room temperature. The reaction was then quenched with 250 mM glycine in PBS for 15 min at room temperature. Cells were washed twice with ice-cold PBS before being pelleted at 800 g for 4 min at 4 °C. The supernatant was removed, and the pellet was washed once with PBS before lysis. Cells were lysed with 200 μL RIPA buffer (50 mM Tris, 150 mM NaCl, 0.5% deoxycholate, 0.1% SDS, pH 7.4) supplemented with protease inhibitors, and SUPERaseIn RNase Inhibitor (Invitrogen). Cells were allowed to lyse on ice for 10 min before being sheared through a 25G needle three times. Insoluble material was pelleted by centrifuging at 13,000 g for 10 min at 4 °C and the resulting cleared lysate was used for the FLAG pulldown.
To prepare the antibody-conjugated magnetic beads, 100 μL Dynabeads Protein G (Thermo Fisher Scientific) were pelleted by magnet and washed twice with wash buffer (PBS + 0.02 % Tween 80). Beads were then resuspended in wash buffer and 5 μg of rabbit anti-mouse antibody (Sigma M7023) was added. Samples were incubated on a rotator for 10 min at room temperature. After incubation, beads were washed twice with wash buffer, resuspended in 100 μL wash buffer and incubated with 5 μg anti-FLAG antibody (Thermo Scientific). Beads were then allowed to conjugate for 10 min at room temperature on the rotator. Then, beads were washed twice with wash buffer and split into two 50 μL fractions. One fraction was allowed to continue to incubate while the other fraction was incubated with 7.5 μg 3xFLAG peptide, which will serve as the control IP. After another 10 min incubation at room temperature, the beads were washed twice and resuspended in 200 μL 1x RIPA buffer with SUPERaseIN RNase inhibitor. The lysates were then incubated with beads overnight at 4 °C.
After antibody incubation, the beads were pelleted, washed three times with 1x RIPA, 0.02% Tween 80 and then washed once with DNase buffer (350 mM Tris pH 6.7, 50 mM MgCl2, 5 mM DTT). The beads were then resuspended in DNase buffer and 0.08 U/μL DNaseI (Thermo Fisher) was added. The DNase reaction was incubated for 30 min at 37 °C on a rotator. Then, proteins were digested using a final volume 0.1 U/μL proteinaseK (Sigma). The reaction was again incubated for 30 min at 37 °C on a rotator before the denaturation step. To denature the sample further, 2.5 M urea was added, and the samples were incubated for 30 min at room temperature. The resulting RNA was purified using the RNA Clean and Concentrator kit (Zymo) and reverse transcribed to cDNA using the PrimeScript RT kit (TaKaRa). RT-qPCRs were run using FastStart Essential DNA Green Master (Roche) and detected on a LightCycler 96 Instrument (Roche). The pulldown data was analyzed using the difference between control-IP and FLAG-IP and then normalized to the non-targeting (NT) gRNA sample. All qPCR reactions were run as 20 μL reactions with at least three biological replicates.
RNA sequencing and analysis
To determine the targeting specificity of CIRTS, we performed RNA sequencing analysis. HEK293T cells were plated in 96-well plates (Corning) and transfected with 150 ng CIRTS and 100 ng gRNA plasmid. After 48 h, total RNA was extracted using the RNeasy Mini Kit (Qiagen) followed by a 30 min DNaseI (Fisher) treatment. Samples were then cleaned up using the RNA clean up and concentrator kit (Zymo) and the resulting total RNA was used as the input for library. RNA-seq libraries were prepared using the mRNA HyperPrep Kit (KAPA biosystems). Libraries were sequenced on an Illumina HiSeq instrument at the University of Chicago Genomic Facility with at least 10 million reads per library. Reads were mapped to the RefSeqGRCh38 transcriptome, quantified, and pseudoaligned using kallisto (Bray et al., 2016). To find differentially expressed transcripts, we used sleuth (Pimentel et al., 2017). Only genes that had a log2FoldChange > 0.75 and a qval < 0.1 were considered to be differentially expressed.
AAV Preparation
HEK293T cells were transfected with AAV2/1 serotype, pAdDelta6 helper packing plasmid (Addgene) and the CIRTS-gRNA containing transfer plasmid using polyethylenenimine (Sigma). The serotype and helper plasmids were a gift from James M. Wilson (Addgene #112862 and Addgene #112867). The transfer plasmid was designed based on Addgene plasmid #61591, a gift from Feng Zhang. After 48h of incubation, the AAV-containing supernatant was harvested, clarified through a 0.22 pm PVDF filter (Millipore), and concentrated using PEG-it Virus Precipitation Solution (SBI) according to the manufacturer’s protocol.
Immunogenicity Prediction
To predict how likely our constructs are to induce an immune response, we used previously described prediction strategies to predict T cell epitopes and score the potential immunogenicity of these potential epitopes (Moutaftsi et al., 2006). We used the Immune Epitope Database (IEDB) prediction tools to assess peptide binding to MHC class I molecules with the default prediction method, which combines artificial neuronal network (ANN) (Andreatta and Nielsen, 2016), Stabilized matrix method (SMM) (Peters and Sette, 2005), and Scoring Matrices derived from Combinatorial Peptide Libraries (Comlib) (Sidney et al., 2008) if any corresponding predictor was available. Otherwise, NetMHCpan (Jurtz et al., 2017) was used for the prediction. The top one percentile of the predicted MHC class I restricted 9-mer candidates were used to predict an immunogenicity score using the T cell class I pMHC immunogenicity predictor (IEDB) (Calis et al., 2013).
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistics
All values are reported as the mean ± SD or mean ± SEM as indicated in the figure legend. When comparing two groups, we used a one-tailed Student’s t-test and a statistical significance cutoff of at least <0.1 as indicated in the figure legend. For comparison of the two conditions in our RNA-seq data that do not follow a normal distribution, we used sleuth, which assumes a negative binomial distribution. Samples sizes were not determined a priori. At least three biological replicates were used for each experiment unless otherwise noted in the figure legend.
DATA AND SOFTWARE AVAILABILITY
The accession number for the sequencing data in this paper is GSE128288.
Supplementary Material
Figure S1. CIRTS List continued from Figure 1B. Related to Figure 1.
Reference list of all remaining CIRTS used in this work.
Excel File 2: Supplemental Table 7: Sleuth differential expression analysis with CIRTS-3. Related to STAR methods.
Figure S2: Control luciferase assays and RT-qPCRs. Related to Figure 3.
(A) Luciferase assay comparing transfection of gRNA only to nuclease-mediated decay of TBP6.7-Pin nuclease domain without (CIRTS-11) and with (CIRTS-12) the additional ssRNA binding protein ORF5.
(B) CIRTS nuclease can mediate decreases in RNA and therefore protein level in both the nucleus and the cytoplasm (n=6).
(C) RT-qPCR analysis of RNA levels with the ‘dead’ Pin nuclease domain CIRTS (CIRTS-0).
(D) Comparison of RNA levels when cells were transfected with CIRTS-1 and active Cas13b nuclease. CIRTS-1-Pin mediated RNA cleavage showed substantially less RNA degradation compared to the Cas13b system.
(E-H) All engineered CIRTS system we tested in the dual luciferase assay were also subjected to RT-qPCR analysis to assess changes in RNA levels. CIRTS-2, which contain the YTHDF1 effector domain inducing translation activation showed no significant changes in RNA level while all YTHDF2-containing CIRTS show the expected decrease in RNA levels.
(I) Engineered CIRTS-18 containing the PP7 dimer as the hairpin binding protein. Knockdown of PPIB after transfection with CIRTS-18 as measured by qPCR.
(J) Comparison of reporter only, gRNA only, non-TBP6.7 fused hADAR2(E488Q) in the presence of NT or Fluc gRNA, and reporter with CIRTS-8 (hADAR E488Q) with non-targeting or targeting gRNA (S3F and S3H: n = 2 or 3). n = 3 biological replicates unless otherwise noted. Student t-test: *P < 0.05, **P <0.01, ***P <0.001.
Figure S3. CIRTS linker and gRNA optimization. Related to Figure 3.
(A) Luciferase assay with the CIRTS nuclease system using different linkers between the hairpin-binding protein and the effector protein. Previously published L8 = SGSETPGTSESATPES (Guilinger et al., 2014), 10 nm helical linker = EEEEKKKQQEEEAERLRRIQEEMEKERKRREEDEKRRRKEEEERRMKLEMEAKRKQEEEERK KREDDEKRKKK.
(B) Luciferase assay with CIRTS-YTHDF2-mediated decay using different linkers between the hairpin-binding protein and the effector protein.
(C) Different engineered gRNA for TBP6.7 based on the design shown in Figure 1C. Two different targeting lengths of 20 and 40 nucleotides were used in combination with different numbers of linking nucleotides (L) between the hairpin and the guiding sequence. The dual luciferase assay was used to assess nuclease-mediated decay. NT = non-targeting, Fluc gRNA containing different linker nuclease (Figure 1), L2 = UU, L3 = UUU, L5 = UUAUU.
(D) The same engineered gRNAs as in Figure S3C were used with CIRTS-3 to induce epitranscriptome-induced RNA decay. NT = non-targeting, Fluc gRNA containing different linker nuclease (Figure 1), L2 = UU, L3 = UUU, L5 = UUAUU. n = 3 biological replicates.
Figure S4. Control qPCR, Western Blot, YTHDF2 truncations. Related to Figure 5.
(A) CIRTS-1 can be delivered to RNA species other than mRNA. As a proof-of-principle, we transfected cells with CIRTS-1 (Pin nuclease) and two different gRNAs for the lncRNA MALAT1 and assessed RNA levels by RT-qPCR.
(B) RT-qPCR analysis of RNA level when cells were transfected with CIRTS-2. As anticipated, no significant changes in RNA level were observed when a YTHDF1-containing protein was used.
(C) Quantification of protein levels as measured by Western blot when cells were transfected with CIRTS-2 or CIRTS-3 and targeted to PPIB (n=3).
(D) Different truncations of YTHDF2 were assayed to determine which would be more efficient. We compared luciferase data (left) with qPCR data (right) and concluded to use the Y2(100-200) construct for luciferase analysis and the Y2(1-200) construct for endogenous targeting to enable the best possible quantifications of our tools. n = 3 biological replicates unless otherwise noted. Student t-test: *P < 0.05, **P <0.01.
Figure S5: Targeting Specificity of CIRTS. Related to Figure 5.
(A) Schematic of the KRAS4b-luciferase mismatch reporter assay. We chose four KRAS4b variants that have an increasing number of mismatches to the designed 20 nt length gRNA and fused it N-terminal to the dual luciferase reporter.
(B) CIRTS-mediated knockdown of KRAS4b-Fluc with different numbers of mismatches between the gRNA and target RNA as described in Figure S5A. CIRTS was found to be most sensitive to mismatches in the middle of its guiding sequence.
(C) Cas13b-mediated knockdown in the same KRAS4b-Fluc reporter assay as described above. Cas13b shows a higher knockdown efficiency but is also less sensitive to mismatches introduced. Similar to CIRTS, Cas13b is knockdown is most affected by mismatches at the center of the guiding target duplex region.
(D) Knockdown efficiency of CIRTS on the KRAS4b-luciferase mismatch reporter when using a 40 nt gRNA length. A longer guiding sequence in the gRNA can rescue some of the loss in knockdown efficiency.
(E-F) Mean expression levels of the transcriptome in log2(transcript per million (TPM) +1) when CIRTS Pin nuclease (E) or CIRTS YTHDF2 (F) are deployed to SMARCA4 (in red) in cells (n=3). Pearson’s correlation: 0.990 (E) and 0.991 (F).
(G) Knockdown levels of SMARCA4 as determined by RNA sequencing.
(H) Cells were transfected with CIRTS-0-3xFLAG and a gRNA for either PPIB, B4GALNT1, or NT. After crosslinking and FLAG IP, pulled down RNA was quantified using RT-qPCR. Reactions containing on-target gRNA for either transcript showed 3.5 to 5-fold enrichment for these transcripts, indicating guided RNA targeting (n = 2 or 3).
Figure S6. Endogenous targeting with CIRTS. Related to Figure 6.
(A) Changes in RNA levels as assessed by RT-qPCR after transfection of CIRTS5-7 alone for PPIB.
(B) Similar to Figure S6A, SMARCA4 levels were assayed when cells were transfected with CIRTS5-7.
(C) Comparison of knockdown levels of PPIB after delivery of active Cas13b nuclease or an engineered dCas13b-YTHDF2(1-200) construct to PPIB (n = 2 or 3). n = 3 biological replicates unless otherwise noted. Student t-test: *P < 0.01, **P <0.05, ***P <0.01, ****P < 0.001.
Figure S7. Multiplexed targeting with CIRTS. Related to Figure 6.
(A) Schematic of vectors used for multiplexed targeting. Cells were transfected with an expression vector for CIRTS-6, and an expression vector for CIRTS-10, an expression vector for a CIRTS-6 gRNA construct targeting PPIB or a non-targeting control, and an expression vector for a CIRTS-9 gRNA targeting SMARCA4 or a non-targeting control.
(B) Heat map showing knockdown of multiplexed targeting described in (A). When both CIRTS have an on-target gRNA for PPIB or SMARCA4 present, both transcripts can be knocked down in the same samples. Values shown as mean expression level of each target transcript relative to GAPDH, with n = 8 biological replicates.
(C) Computational prediction of immunogenicity. We first predicted 9-mer peptides that are MHC I binders using the IEDB database and subjected the top one percentile of binders to immunogenicity predictions using the IEDB immunogenicity predictor.
Excel File 1: Supplemental Table 6: Sleuth differential expression analysis with CIRTS-12. Related to STAR methods.
KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal HRP-conjugated GAPDH antibody | Proteintech | Cat# HRP-60004 |
| Mouse monoclonal CypB antibody | Santa Cruz | Cat# sc-130626 |
| Goat anti-mouse HRP-antibody | Santa Cruz | Cat# sc-516102 |
| Rabbit anti-mouse antibody | Sigma | Cat# M7023 |
| Mouse anti-FLAG antibody | Invitrogen | Cat# MA1–9187A |
| Bacterial and Virus Strains | ||
| E. coli NEB 10-beta | NEB | Cat# C3019I |
| E. coli BL21 (DE3) | NEB | Cat# C2530H |
| pAAV-CMV-CIRTS-6-bGHpA-hU6-BsaI-gRNA | This study | Adapted from Addgene #61591 provided by Feng Zhang |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Q5 DNA Polymerase | NEB | Cat# M0491 |
| T5 exonuclease | NEB | Cat# M0363 |
| T4 DNA ligase | NEB | Cat# M0208 |
| Isopropyl-b-D-thiogalatoside (ITPG) | bioWORLD | Cat# 21530057 |
| His60 Ni Superflow Resin | Takara | Cat# 635660 |
| SUPERaseIn | Invitrogen | Cat# AM2696 |
| T7 RNA Polymerase | NEB | Cat# M0251S |
| DNaseI | Thermo Fisher | Cat# EN0525 |
| ProteinaseK | Sigma | Cat# P2308 |
| Yeast tRNA | Invitrogen | Cat# AM7119 |
| Heparin | Sigma | Cat# H3393 |
| Dynabeads Protein G | Invitrogen | Cat# 10004D |
| Lipofectamine 2000 | Thermo Fisher | Cat # 11668028 |
| Polyethyleneimine (PEI) | Sigma | Cat# 408727 |
| Opti-MEM I Reduced Serum Medium | Thermo Fisher | Cat# 31985–070 |
| 3x FLAG peptide | Sigma | Cat# F4799 |
| Super Signal West Pico Plus | Thermo Fisher | Cat# 34577 |
| Critical Commercial Assays | ||
| DualGlo Luciferase Assay System | Promega | Cat# E2920 |
| RNeasy Plus Mini Kit | QIAGEN | Cat# 74136 |
| PrimeScript RT Reagent Kit | TaKaRa | Cat# RR037A |
| FastStart Essential DNA Green Master | Roche | Cat# 6402712001 |
| 5’ oligonucleotide labeling kit | Vector Labs | Cat# MB-9001 |
| RNA Clean up & Concentrator | Zymo | Cat# R1016 |
| MidiPrep kit | Zymo | Cat# D4201 |
| mRNA HyperPrep Kit | KAPA biosystems | Cat# KK8580 |
| PEG-it Virus Precipitation Solution | SBI | Cat# LV825A |
| Deposited Data | ||
| GEO (RNA sequencing of targeted CIRTS in HEK293T cells) | This paper | GSE128288 |
| Experimental Models: Cell Lines | ||
| Human: HEK293T cells (Female) | ATCC | Cat# CRL-3216 |
| Oligonucleotides | ||
| Target RNA for filter binding assay: GGTGGTTCTGGTGGCGGCTCTGTGGGTGGTGGCTCTGTGGGCTGGACTGG | This study | IDT |
| gRNA for filter binding assay: GGCCAGATCTGAGCCTGGGAGCTCTCTGGCCCAGCCACCACCCACAGAGCCGCCACCAGA | This study | N/A |
| Target RNA for cleavage assay: GGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAAATATGGATTACTTGGTAGAACAGCAATCTACTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAG | This study | N/A |
| gRNA for cleavage assay/NT gRNA for filter binding assay: GGCCAGATCTGAGCCTGGGAGCTCTCTGGCCCTAGATTGCTGTTCTACCAAGTAATCCAT | This study | N/A |
| qPCR primers used | This study | Table S5 |
| Recombinant DNA | ||
| E. coli plasmids | This study | Table S1 |
| Mammalian expression plasmids | This study | Table S2 |
| gRNA vectors and targeting sequences | This study | Tables S3 and S4 |
| pAAV2/1 | James M. Wilson AAV packaging plasmids (unpublished) | Addgene #112862 |
| pAdDeltaF6 | James M. Wilson AAV packaging plasmids (unpublished) | Addgene #112867 |
| CMV-d0-dPspCas13b-GGS6-NYTHDF2 | (Rauch et al., 2018) | Adapted from Addgene #103866 provided by Feng Zhang |
| Software and Algorithms | ||
| Graphpad Prism | GraphPad Software | https://graphpad.com/scientific-software/prism |
| R | R Project | http://www.r-project.org |
| Kallisto | (Bray et al., 2016) | https://pachterlab.github.io/kallisto/ |
| Sleuth | (Pimentel et al., 2017) | https://pachterlab.github.io/sleuth/ |
| Other | ||
| LightCycler 96 | Roche | N/A |
| Odyssey scanner | LI-COR Biosciences | N/A |
| Synergy plate reader | Biotek | N/A |
| Fluor Chem R Imager | Protein Simple | N/A |
CIRTS is a general strategy for engineering programmable RNA effectors
Nucleases, epitranscriptomic regulators, and editors can be delivered by CIRTS
CIRTS can be constructed entirely from human protein “parts” and delivered by AAV
Orthogonal CIRTS can deliver target multiple effectors to different transcripts
ACKNOWLEDGEMENTS
This work was supported by the University of Chicago, the National Institute of General Medical Sciences (R35 GM119840, B.C.D.) and the National Human Genome Research Institute (RM1 HG008935, B.C.D.) of the National Institutes of Health. Additionally, this work was supported by a Cancer Center Support Grant (#P30 CA14599) of the University of Chicago Medicine Comprehensive Cancer Center. M.S. was supported by the University of Chicago Pritzker School of Medicine. H. Z. was supported by the Chicago Fellow Program.
Footnotes
DECLARATION OF INTERESTS
S.R. and B.C.D. have filed a provisional patent application for CIRTS.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Abil Z, Denard CA, and Zhao H (2014). Modular assembly of designer PUF proteins for specific post-transcriptional regulation of endogenous RNA. J Biol Eng 8, 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abudayyeh OO, Gootenberg JS, Essletzbichler P, Han S, Joung J, Belanto JJ, Verdine V, Cox DBT, Kellner MJ, Regev A, et al. (2017). RNA targeting with CRISPR-Cas13. Nature 550, 280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DBT, Shmakov S, Makarova KS, Semenova E, Minakhin L, et al. (2016). C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 353, aaf5573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Adamala KP, Martin-Alarcon DA, and Boyden ES (2016). Programmable RNA-binding protein composed of repeats of a single modular unit. Proc Natl Acad Sci U S A 113, E2579–2588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Andreatta M, and Nielsen M (2016). Gapped sequence alignment using artificial neural networks: application to the MHC class I system. Bioinformatics 32, 511–517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bao Z, Jain S, Jaroenpuntaruk V, and Zhao H (2017). Orthogonal Genetic Regulation in Human Cells Using Chemically Induced CRISPR/Cas9 Activators. ACS Synth Biol 6, 686–693. [DOI] [PubMed] [Google Scholar]
- Batra R, Nelles DA, Pirie E, Blue SM, Marina RJ, Wang H, Chaim IA, Thomas JD, Zhang N, Nguyen V, et al. (2017). Elimination of Toxic Microsatellite Repeat Expansion RNA by RNA-Targeting Cas9. Cell 170, 899–912 e810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Blakeley BD, and McNaughton BR (2014). Synthetic RNA recognition motifs that selectively recognize HIV-1 trans-activation response element hairpin RNA. ACS Chem Biol 9, 1320–1329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boyle EA, Andreasson JOL, Chircus LM, Sternberg SH, Wu MJ, Guegler CK, Doudna JA, and Greenleaf WJ (2017). High-throughput biochemical profiling reveals sequence determinants of dCas9 off-target binding and unbinding. Proc Natl Acad Sci U S A 114, 5461–5466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bray NL, Pimentel H, Melsted P, and Pachter L (2016). Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol 34, 525. [DOI] [PubMed] [Google Scholar]
- Calis JJ, Maybeno M, Greenbaum JA, Weiskopf D, De Silva AD, Sette A, Kesmir C, and Peters B (2013). Properties of MHC class I presented peptides that enhance immunogenicity. PLoS Comput Biol 9, e1003266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chandrasegaran S, and Carroll D (2016). Origins of Programmable Nucleases for Genome Engineering. J Mol Biol 428, 963–989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Charlesworth CT, Deshpande PS, Dever DP, Camarena J, Lemgart VT, Cromer MK, Vakulskas CA, Collingwood MA, Zhang L, Bode NM, et al. (2019). Identification of preexisting adaptive immunity to Cas9 proteins in humans. Nat Med 25, 249–254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choudhury R, Tsai YS, Dominguez D, Wang Y, and Wang Z (2012). Engineering RNA endonucleases with customized sequence specificities. Nat Commun 3, 1147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coller J, and Wickens M (2007). Tethered function assays: an adaptable approach to study RNA regulatory proteins. Methods Enzymol 429, 299–321. [DOI] [PubMed] [Google Scholar]
- Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, and Zhang F (2017). RNA editing with CRISPR-Cas13. Science 358, 1019–1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crawford DW, Blakeley BD, Chen PH, Sherpa C, Le Grice SF, Laird-Offringa IA, and McNaughton BR (2016). An Evolved RNA Recognition Motif That Suppresses HIV-1 Tat/TAR-Dependent Transcription. ACS Chem Biol 11, 2206–2215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cronican JJ, Beier KT, Davis TN, Tseng JC, Li W, Thompson DB, Shih AF, May EM, Cepko CL, Kung AL, et al. (2011). A class of human proteins that deliver functional proteins into mammalian cells in vitro and in vivo. Chem Biol 18, 833–838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desjarlais JR, and Berg JM (1993). Use of a zinc-finger consensus sequence framework and specificity rules to design specific DNA binding proteins. Proceedings of the National Academy of Sciences 90, 2256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dhople V, Krukemeyer A, and Ramamoorthy A (2006). The human beta-defensin-3, an antibacterial peptide with multiple biological functions. Biochim Biophys Acta 1758, 1499–1512. [DOI] [PubMed] [Google Scholar]
- Dominguez D, Freese P, Alexis MS, Su A, Hochman M, Palden T, Bazile C, Lambert NJ, Van Nostrand EL, Pratt GA, et al. (2018). Sequence, Structure, and Context Preferences of Human RNA Binding Proteins. Mol Cell 70, 854–867.e859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du D, Roguev A, Gordon DE, Chen M, Chen S-H, Shales M, Shen JP, Ideker T, Mali P, Qi LS, et al. (2017). Genetic interaction mapping in mammalian cells using CRISPR interference. Nat Methods 14, 577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du H, Zhao Y, He J, Zhang Y, Xi H, Liu M, Ma J, and Wu L (2016). YTHDF2 destabilizes m6A-containing RNA through direct recruitment of the CCR4-NOT deadenylase complex. Nat Commun 7, 12626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eberle AB, Lykke-Andersen S, Muhlemann O, and Jensen TH (2009). SMG6 promotes endonucleolytic cleavage of nonsense mRNA in human cells. Nat Struct Mol Biol 16, 49–55. [DOI] [PubMed] [Google Scholar]
- Fuxman Bass JI, Sahni N, Shrestha S, Garcia-Gonzalez A, Mori A, Bhat N, Yi S, Hill DE, Vidal M, and Walhout AJM (2015). Human gene-centered transcription factor networks for enhancers and disease variants. Cell 161, 661–673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao G, Vandenberghe LH, and Wilson JM (2005). New recombinant serotypes of AAV vectors. Curr Gene Ther 5, 285–297. [DOI] [PubMed] [Google Scholar]
- Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, and Qi LS (2016). Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods 13, 1043–1049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Glaesner W, Vick AM, Millican R, Ellis B, Tschang SH, Tian Y, Bokvist K, Brenner M, Koester A, Porksen N, et al. (2010). Engineering and characterization of the long-acting glucagon-like peptide-1 analogue LY2189265, an Fc fusion protein. Diabetes Metab Res Rev 26, 287–296. [DOI] [PubMed] [Google Scholar]
- Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, and Zhang F (2018). Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360, 439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Granados-Riveron JT, and Aquino-Jarquin G (2018). CRISPR-Cas13 Precision Transcriptome Engineering in Cancer. Cancer Res 78, 4107–4113. [DOI] [PubMed] [Google Scholar]
- Guilinger JP, Thompson DB, and Liu DR (2014). Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat Biotechnol 32, 577–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, and Doudna JA (2018). Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Science 362, 839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, Cassady JP, Cost GJ, Zhang L, Santiago Y, Miller JC, et al. (2011). Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29, 731–734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu JH, Miller SM, Geurts MH, Tang W, Chen L, Sun N, Zeina CM, Gao X, Rees HA, Lin Z, et al. (2018). Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature 556, 57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang W, Bikard D, Cox D, Zhang F, and Marraffini LA (2013). RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 31, 233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Joung JK, and Sander JD (2012). TALENs: a widely applicable technology for targeted genome editing. Nature Reviews Molecular Cell Biology 14, 49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jurtz V, Paul S, Andreatta M, Marcatili P, Peters B, and Nielsen M (2017). NetMHCpan-4.0: Improved Peptide-MHC Class I Interaction Predictions Integrating Eluted Ligand and Peptide Binding Affinity Data. J Immunol 199, 3360–3368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim H, and Kim J-S (2014). A guide to genome engineering with programmable nucleases. Nature Reviews Genetics 15, 321. [DOI] [PubMed] [Google Scholar]
- Kluver E, Schulz-Maronde S, Scheid S, Meyer B, Forssmann WG, and Adermann K (2005). Structure-activity relation of human beta-defensin 3: influence of disulfide bonds and cysteine substitution on antimicrobial activity and cytotoxicity. Biochemistry 44, 9804–9816. [DOI] [PubMed] [Google Scholar]
- Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, and Hsu PD (2018). Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell 173, 665–676.e614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kuttan A, and Bass BL (2012). Mechanistic insights into editing-site specificity of ADARs. Proc Natl Acad Sci U S A 109, E3295–3304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liao H-K, Hatanaka F, Araoka T, Reddy P, Wu M-Z, Sui Y, Yamauchi T, Sakurai M, O’Keefe DD, Nunez-Delicado E, et al. (2017). In Vivo Target Gene Activation via CRISPR/Cas9-Mediated Trans-epigenetic Modulation. Cell 171, 1495–1507.e1415. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu L, Li X, Ma J, Li Z, You L, Wang J, Wang M, Zhang X, and Wang Y (2017). The Molecular Architecture for RNA-Guided RNA Cleavage by Cas13a. Cell 170, 714–726 e710. [DOI] [PubMed] [Google Scholar]
- Meyer Kate D., Patil Deepak P., Zhou J, Zinoviev A, Skabkin Maxim A., Elemento O, Pestova Tatyana V., Qian S-B, and Jaffrey Samie R. (2015). 5’ UTR m6A Promotes Cap-Independent Translation. Cell 163, 999–1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Monteys AM, Ebanks SA, Keiser MS, and Davidson BL (2017). CRISPR/Cas9 Editing of the Mutant Huntingtin Allele In Vitro and In Vivo. Mol Ther 25, 12–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Montiel-Gonzalez MF, Vallecillo-Viejo IC, and Rosenthal JJ (2016). An efficient system for selectively altering genetic information within mRNAs. Nucleic Acids Res 44, e157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moutaftsi M, Peters B, Pasquetto V, Tscharke DC, Sidney J, Bui HH, Grey H, and Sette A (2006). A consensus epitope prediction approach identifies the breadth of murine T(CD8+)-cell responses to vaccinia virus. Nat Biotechnol 24, 817–819. [DOI] [PubMed] [Google Scholar]
- Naso MF, Tomkowicz B, Perry WL 3rd, and Strohl WR (2017). Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs 31, 317–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nelles DA, Fang MY, O’Connell MR, Xu JL, Markmiller SJ, Doudna JA, and Yeo GW (2016). Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell 165, 488–496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nishikura K (2010). Functions and regulation of RNA editing by ADAR deaminases. Annu Rev Biochem 79, 321–349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- O’Connell MR (2019). Molecular Mechanisms of RNA Targeting by Cas13-containing Type VI CRISPR-Cas Systems. J Mol Biol 431, 66–87. [DOI] [PubMed] [Google Scholar]
- O’Connell MR, Oakes BL, Sternberg SH, East-Seletsky A, Kaplan M, and Doudna JA (2014). Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature 516, 263–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peters B, and Sette A (2005). Generating quantitative models describing the sequence specificity of biological processes with the stabilized matrix method. BMC Bioinformatics 6, 132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pimentel H, Bray NL, Puente S, Melsted P, and Pachter L (2017). Differential analysis of RNA-seq incorporating quantification uncertainty. Nat Methods 14, 687. [DOI] [PubMed] [Google Scholar]
- Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, and Lim WA (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rauch S, He C, and Dickinson BC (2018). Targeted m(6)A Reader Proteins To Study Epitranscriptomic Regulation of Single RNAs. J Am Chem Soc 140, 11974–11981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roundtree IA, Evans ME, Pan T, and He C (2017). Dynamic RNA Modifications in Gene Expression Regulation. Cell 169, 1187–1200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rutkauskas M, Sinkunas T, Songailiene I, Tikhomirova Maria S., Siksnys V, and Seidel R (2015). Directional R-Loop Formation by the CRISPR-Cas Surveillance Complex Cascade Provides Efficient Off-Target Site Rejection. Cell Reports 10, 1534–1543. [DOI] [PubMed] [Google Scholar]
- Schierling B, Dannemann N, Gabsalilow L, Wende W, Cathomen T, and Pingoud A (2012). A novel zinc-finger nuclease platform with a sequence-specific cleavage module. Nucleic Acids Res 40, 2623–2638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sidney J, Assarsson E, Moore C, Ngo S, Pinilla C, Sette A, and Peters B (2008). Quantitative peptide binding motifs for 19 human and mouse MHC class I molecules derived using positional scanning combinatorial peptide libraries. Immunome Res 4, 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simhadri VL, McGill J, McMahon S, Wang J, Jiang H, and Sauna ZE (2018). Prevalence of Pre-existing Antibodies to CRISPR-Associated Nuclease Cas9 in the USA Population. Mol Ther Methods Clin Dev 10, 105–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sinnamon JR, Kim SY, Corson GM, Song Z, Nakai H, Adelman JP, and Mandel G (2017). Site-directed RNA repair of endogenous Mecp2 RNA in neurons. Proc Natl Acad Sci U S A 114, E9395–E9402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Slaymaker IM, Mesa P, Kellner MJ, Kannan S, Brignole E, Koob J, Feliciano PR, Stella S, Abudayyeh OO, Gootenberg JS, et al. (2019). High-Resolution Structure of Cas13b and Biochemical Characterization of RNA Targeting and Cleavage. Cell Rep 26, 3741–3751 e3745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smargon AA, Cox DBT, Pyzocha NK, Zheng K, Slaymaker IM, Gootenberg JS, Abudayyeh OA, Essletzbichler P, Shmakov S, Makarova KS, et al. (2017). Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNase Differentially Regulated by Accessory Proteins Csx27 and Csx28. Mol Cell 65, 618–630 e617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sternberg SH, Redding S, Jinek M, Greene EC, and Doudna JA (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sundaram GM, Ismail HM, Bashir M, Muhuri M, Vaz C, Nama S, Ow GS, Vladimirovna IA, Ramalingam R, Burke B, et al. (2017). EGF hijacks miR-198/FSTL1 wound-healing switch and steers a two-pronged pathway toward metastasis. J Exp Med 214, 2889–2900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Szczelkun MD, Tikhomirova MS, Sinkunas T, Gasiunas G, Karvelis T, Pschera P, Siksnys V, and Seidel R (2014). Direct observation of R-loop formation by single RNA-guided Cas9 and Cascade effector complexes. Proceedings of the National Academy of Sciences 111, 9798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tambe A, East-Seletsky A, Knott GJ, Doudna JA, and O’Connell MR (2018). RNA Binding and HEPN-Nuclease Activation Are Decoupled in CRISPR-Cas13a. Cell Rep 24, 1025–1036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Terns MP (2018). CRISPR-Based Technologies: Impact of RNA-Targeting Systems. Mol Cell 72, 404–412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vasileva A, and Jessberger R (2005). Precise hit: adeno-associated virus in gene targeting. Nat Rev Microbiol 3, 837–847. [DOI] [PubMed] [Google Scholar]
- Vogel P, Moschref M, Li Q, Merkle T, Selvasaravanan KD, Li JB, and Stafforst T (2018). Efficient and precise editing of endogenous transcripts with SNAP-tagged ADARs. Nat Methods 15, 535–538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wagner DL, Amini L, Wendering DJ, Burkhardt L-M, Akyuz L, Reinke P, Volk H-D, and Schmueck-Henneresse M (2018). High prevalence of Streptococcus pyogenes Cas9-reactive T cells within the adult human population. Nat Med. [DOI] [PubMed] [Google Scholar]
- Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, et al. (2013). N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 505, 117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang X, Zhao Boxuan S., Roundtree Ian A., Lu Z, Han D, Ma H, Weng X, Chen K, Shi H, and He C (2015). N6-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell 161, 1388–1399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wiedenheft B, Sternberg SH, and Doudna JA (2012). RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331. [DOI] [PubMed] [Google Scholar]
- Wu Z, Yang H, and Colosi P (2010). Effect of genome size on AAV vector packaging. Mol Ther 18, 80–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao W, Adhikari S, Dahal U, Chen Y-S, Hao Y-J, Sun B-F, Sun H-Y, Li A, Ping X-L, Lai W-Y, et al. (2016). Nuclear m6A Reader YTHDC1 Regulates mRNA Splicing. Mol Cell 61, 507–519. [DOI] [PubMed] [Google Scholar]
- Yan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, and Scott DA (2018). Cas13d Is a Compact RNA-Targeting Type VI CRISPR Effector Positively Modulated by a WYL-Domain-Containing Accessory Protein. Mol Cell 70, 327–339 e325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yan WX, Hunnewell P, Alfonse LE, Carte JM, Keston-Smith E, Sothiselvam S, Garrity AJ, Chong S, Makarova KS, Koonin EV, et al. (2019). Functionally diverse type V CRISPR-Cas systems. Science 363, 88–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao BS, Roundtree IA, and He C (2017). Post-transcriptional gene regulation by mRNA modifications. Nat Rev Mol Cell Biol 18, 31–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou Z, Dell’Orco M, Saldarelli P, Turturo C, Minafra A, and Martelli GP (2006). Identification of an RNA-silencing suppressor in the genome of Grapevine virus A. J Gen Virol 87, 2387–2395. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1. CIRTS List continued from Figure 1B. Related to Figure 1.
Reference list of all remaining CIRTS used in this work.
Excel File 2: Supplemental Table 7: Sleuth differential expression analysis with CIRTS-3. Related to STAR methods.
Figure S2: Control luciferase assays and RT-qPCRs. Related to Figure 3.
(A) Luciferase assay comparing transfection of gRNA only to nuclease-mediated decay of TBP6.7-Pin nuclease domain without (CIRTS-11) and with (CIRTS-12) the additional ssRNA binding protein ORF5.
(B) CIRTS nuclease can mediate decreases in RNA and therefore protein level in both the nucleus and the cytoplasm (n=6).
(C) RT-qPCR analysis of RNA levels with the ‘dead’ Pin nuclease domain CIRTS (CIRTS-0).
(D) Comparison of RNA levels when cells were transfected with CIRTS-1 and active Cas13b nuclease. CIRTS-1-Pin mediated RNA cleavage showed substantially less RNA degradation compared to the Cas13b system.
(E-H) All engineered CIRTS system we tested in the dual luciferase assay were also subjected to RT-qPCR analysis to assess changes in RNA levels. CIRTS-2, which contain the YTHDF1 effector domain inducing translation activation showed no significant changes in RNA level while all YTHDF2-containing CIRTS show the expected decrease in RNA levels.
(I) Engineered CIRTS-18 containing the PP7 dimer as the hairpin binding protein. Knockdown of PPIB after transfection with CIRTS-18 as measured by qPCR.
(J) Comparison of reporter only, gRNA only, non-TBP6.7 fused hADAR2(E488Q) in the presence of NT or Fluc gRNA, and reporter with CIRTS-8 (hADAR E488Q) with non-targeting or targeting gRNA (S3F and S3H: n = 2 or 3). n = 3 biological replicates unless otherwise noted. Student t-test: *P < 0.05, **P <0.01, ***P <0.001.
Figure S3. CIRTS linker and gRNA optimization. Related to Figure 3.
(A) Luciferase assay with the CIRTS nuclease system using different linkers between the hairpin-binding protein and the effector protein. Previously published L8 = SGSETPGTSESATPES (Guilinger et al., 2014), 10 nm helical linker = EEEEKKKQQEEEAERLRRIQEEMEKERKRREEDEKRRRKEEEERRMKLEMEAKRKQEEEERK KREDDEKRKKK.
(B) Luciferase assay with CIRTS-YTHDF2-mediated decay using different linkers between the hairpin-binding protein and the effector protein.
(C) Different engineered gRNA for TBP6.7 based on the design shown in Figure 1C. Two different targeting lengths of 20 and 40 nucleotides were used in combination with different numbers of linking nucleotides (L) between the hairpin and the guiding sequence. The dual luciferase assay was used to assess nuclease-mediated decay. NT = non-targeting, Fluc gRNA containing different linker nuclease (Figure 1), L2 = UU, L3 = UUU, L5 = UUAUU.
(D) The same engineered gRNAs as in Figure S3C were used with CIRTS-3 to induce epitranscriptome-induced RNA decay. NT = non-targeting, Fluc gRNA containing different linker nuclease (Figure 1), L2 = UU, L3 = UUU, L5 = UUAUU. n = 3 biological replicates.
Figure S4. Control qPCR, Western Blot, YTHDF2 truncations. Related to Figure 5.
(A) CIRTS-1 can be delivered to RNA species other than mRNA. As a proof-of-principle, we transfected cells with CIRTS-1 (Pin nuclease) and two different gRNAs for the lncRNA MALAT1 and assessed RNA levels by RT-qPCR.
(B) RT-qPCR analysis of RNA level when cells were transfected with CIRTS-2. As anticipated, no significant changes in RNA level were observed when a YTHDF1-containing protein was used.
(C) Quantification of protein levels as measured by Western blot when cells were transfected with CIRTS-2 or CIRTS-3 and targeted to PPIB (n=3).
(D) Different truncations of YTHDF2 were assayed to determine which would be more efficient. We compared luciferase data (left) with qPCR data (right) and concluded to use the Y2(100-200) construct for luciferase analysis and the Y2(1-200) construct for endogenous targeting to enable the best possible quantifications of our tools. n = 3 biological replicates unless otherwise noted. Student t-test: *P < 0.05, **P <0.01.
Figure S5: Targeting Specificity of CIRTS. Related to Figure 5.
(A) Schematic of the KRAS4b-luciferase mismatch reporter assay. We chose four KRAS4b variants that have an increasing number of mismatches to the designed 20 nt length gRNA and fused it N-terminal to the dual luciferase reporter.
(B) CIRTS-mediated knockdown of KRAS4b-Fluc with different numbers of mismatches between the gRNA and target RNA as described in Figure S5A. CIRTS was found to be most sensitive to mismatches in the middle of its guiding sequence.
(C) Cas13b-mediated knockdown in the same KRAS4b-Fluc reporter assay as described above. Cas13b shows a higher knockdown efficiency but is also less sensitive to mismatches introduced. Similar to CIRTS, Cas13b is knockdown is most affected by mismatches at the center of the guiding target duplex region.
(D) Knockdown efficiency of CIRTS on the KRAS4b-luciferase mismatch reporter when using a 40 nt gRNA length. A longer guiding sequence in the gRNA can rescue some of the loss in knockdown efficiency.
(E-F) Mean expression levels of the transcriptome in log2(transcript per million (TPM) +1) when CIRTS Pin nuclease (E) or CIRTS YTHDF2 (F) are deployed to SMARCA4 (in red) in cells (n=3). Pearson’s correlation: 0.990 (E) and 0.991 (F).
(G) Knockdown levels of SMARCA4 as determined by RNA sequencing.
(H) Cells were transfected with CIRTS-0-3xFLAG and a gRNA for either PPIB, B4GALNT1, or NT. After crosslinking and FLAG IP, pulled down RNA was quantified using RT-qPCR. Reactions containing on-target gRNA for either transcript showed 3.5 to 5-fold enrichment for these transcripts, indicating guided RNA targeting (n = 2 or 3).
Figure S6. Endogenous targeting with CIRTS. Related to Figure 6.
(A) Changes in RNA levels as assessed by RT-qPCR after transfection of CIRTS5-7 alone for PPIB.
(B) Similar to Figure S6A, SMARCA4 levels were assayed when cells were transfected with CIRTS5-7.
(C) Comparison of knockdown levels of PPIB after delivery of active Cas13b nuclease or an engineered dCas13b-YTHDF2(1-200) construct to PPIB (n = 2 or 3). n = 3 biological replicates unless otherwise noted. Student t-test: *P < 0.01, **P <0.05, ***P <0.01, ****P < 0.001.
Figure S7. Multiplexed targeting with CIRTS. Related to Figure 6.
(A) Schematic of vectors used for multiplexed targeting. Cells were transfected with an expression vector for CIRTS-6, and an expression vector for CIRTS-10, an expression vector for a CIRTS-6 gRNA construct targeting PPIB or a non-targeting control, and an expression vector for a CIRTS-9 gRNA targeting SMARCA4 or a non-targeting control.
(B) Heat map showing knockdown of multiplexed targeting described in (A). When both CIRTS have an on-target gRNA for PPIB or SMARCA4 present, both transcripts can be knocked down in the same samples. Values shown as mean expression level of each target transcript relative to GAPDH, with n = 8 biological replicates.
(C) Computational prediction of immunogenicity. We first predicted 9-mer peptides that are MHC I binders using the IEDB database and subjected the top one percentile of binders to immunogenicity predictions using the IEDB immunogenicity predictor.
Excel File 1: Supplemental Table 6: Sleuth differential expression analysis with CIRTS-12. Related to STAR methods.
Data Availability Statement
The accession number for the sequencing data in this paper is GSE128288.







