Identification and Unusual Properties of the Master Regulator FNR in the Extreme Acidophile Acidithiobacillus ferrooxidans

Abstract

The ability to conserve energy in the presence or absence of oxygen provides a metabolic versatility that confers an advantage in natural ecosystems. The switch between alternative electron transport systems is controlled by the fumarate nitrate reduction transcription factor (FNR) that senses oxygen via an oxygen-sensitive [4Fe-4S]²⁺ iron-sulfur cluster. Under O₂ limiting conditions, FNR plays a key role in allowing bacteria to transition from aerobic to anaerobic lifestyles. This is thought to occur via transcriptional activation of genes involved in anaerobic respiratory pathways and by repression of genes involved in aerobic energy production. The Proteobacterium Acidithiobacillus ferrooxidans is a model species for extremely acidophilic microorganisms that are capable of aerobic and anaerobic growth on elemental sulfur coupled to oxygen and ferric iron reduction, respectively. In this study, an FNR-like protein (FNR_AF) was discovered in At. ferrooxidans that exhibits a primary amino acid sequence and major motifs and domains characteristic of the FNR family of proteins, including an effector binding domain with at least three of the four cysteines known to coordinate an [4Fe-4S]²⁺ center, a dimerization domain, and a DNA binding domain. Western blotting with antibodies against Escherichia coli FNR (FNR_EC) recognized FNR_AF. FNR_AF was able to drive expression from the FNR-responsive E. coli promoter PnarG, suggesting that it is functionally active as an FNR-like protein. Upon air exposure, FNR_AF demonstrated an unusual lack of sensitivity to oxygen compared to the archetypal FNR_EC. Comparison of the primary amino acid sequence of FNR_AF with that of other natural and mutated FNRs, including FNR_EC, coupled with an analysis of the predicted tertiary structure of FNR_AF using the crystal structure of the related FNR from Aliivibrio fisheri as a template revealed a number of amino acid changes that could potentially stabilize FNR_AF in the presence of oxygen. These include a truncated N terminus and amino acid changes both around the putative Fe-S cluster coordinating cysteines and also in the dimer interface. Increased O₂ stability could allow At. ferrooxidans to survive in environments with fluctuating O₂ concentrations, providing an evolutionary advantage in natural, and engineered environments where oxygen gradients shape the bacterial community.

Introduction

A central challenge in microbial ecology is to understand how microorganisms interact in complex communities, including how they respond to dynamically changing environments. Answers to this challenge are important for addressing issues such as the role of biogeochemical reactions in nutrient and energy cycling and in understanding ecosystem functioning in earth, ocean, and atmospheric environments (Widder et al., 2016). However, it is difficult to model such systems because of their complexity as well as that their experimental investigation in the field may require long time scales, measured in years to centuries, e.g., ecological succession.

Hyperacidic environments (pH < 3) provide an advantage over neutral milieu for addressing these issues as they generally exhibit low microbial diversity (Mendez-Garcia et al., 2015; Teng et al., 2017). This facilitates data collection, observation, and experimental exploration of ecological models over periods measured in weeks or months and simplifies model building of microbial interactions. One such environment is bioleaching heaps (termed “bioheaps”) that exploit acidophilic microorganisms’ metabolism (Bonnefoy and Holmes, 2012; Dopson and Johnson, 2012) to catalyze commercial metal recovery from sulfide minerals in many parts of the world (Brierley and Brierley, 2013; Vera et al., 2013). Bioheaps offer additional advantages for studying microbial community function and dynamics as they are subjected to dynamically changing conditions including levels of heavy metals, acidity, CO₂, temperature, nutrients, and available redox couples for growth (Dopson et al., 2009; Valdés et al., 2010; Riekkola-Vanhanen, 2013; Tupikina et al., 2013; Dopson and Holmes, 2014). In addition, bioheap microbes are challenged by a gradient of O₂ availability when thick biofilms are formed (Baker-Austin et al., 2010), due to limitations of O₂ gas–liquid mass transfer that are exacerbated at higher temperatures (Petersen, 2010), and decreasing O₂ concentrations in the center of the bioheap (Yin et al., 2011).

Acidithiobacillus ferrooxidans is a keystone bioheap species that is especially prevalent during early stage bioleaching (Demergasso et al., 2005; Remonsellez et al., 2009; Halinen et al., 2012). This is likely as it is able to grow at higher pH values than e.g., Leptospirillum ferriphilum (Dopson, 2016) and as it fixes carbon that aids in the subsequent growth of heterotrophic acidophilic species, as has been demonstrated during co-culture of autotrophic, and heterotrophic biomining species (Nancucheo and Johnson, 2010). At. ferrooxidans is an acidophilic, obligatory chemolithoautotrophic mesophile that gains its energy from the oxidation of ferrous iron, elemental sulfur, inorganic sulfur compounds, and hydrogen (Bonnefoy and Holmes, 2012; Dopson and Johnson, 2012; Hedrich and Johnson, 2013). At. ferrooxidans is a facultative anaerobe that grows under aerobic and anaerobic conditions and the main electron transport components couple the aerobic oxidation of iron and sulfur to the reduction of O₂ (Quatrini et al., 2009) and the anaerobic oxidation of elemental sulfur to reduction of ferric iron (Pronk et al., 1991; Ohmura et al., 2002; Osorio et al., 2013). This switch from aerobic to anaerobic growth is expected to require a regulator of gene expression, which has not been studied in detail in At. ferrooxidans.

The transition from oxic, to hypoxic (low concentrations of O₂), and finally anoxic environments may require gene regulation systems to respond to the varying O₂ concentrations (Osorio et al., 2009). In addition, At. ferrooxidans requires iron homeostasis systems (such as for the ferric iron utilized as electron acceptor) as its concentration can reach 10¹⁸-fold higher than in pH neutral environments (Osorio et al., 2008a, b). Bacterial O₂ sensing systems include the direct interaction of O₂ with membrane sensors such as FixL and the cytoplasmic transcription factor FNR (Fumarate and Nitrate Reduction), along with redox responsive regulatory systems that include, but are not limited to, ArcBA and Rex (reviewed in (Green et al., 2009; Bueno et al., 2012; Mettert and Kiley, 2018). The FNR transcription factor is a member of the cyclic AMP (cAMP) receptor protein (Crp) superfamily and plays a major role in altering gene expression between oxic and anoxic conditions (Constantinidou et al., 2006). The Escherichia coli FNR protein (termed FNR_EC) senses O₂ via four cysteine residues that ligate an O₂-sensitive [4Fe-4S]²⁺ iron-sulfur cluster in the N-terminal region and affects its regulatory function via the C-terminal helix-turn-helix (HTH) DNA binding domain (Fleischhacker and Kiley, 2011; Mettert and Kiley, 2018). In anoxic conditions, FNR is activated by Isc protein-dependent acquisition of the [4Fe-4S]²⁺ cluster that promotes dimerization. The dimer binds to target DNA sequences, and induces or represses transcription. As O₂ levels increase, the FNR [4Fe-4S]²⁺ cluster is degraded and the protein is converted to a monomeric form, which is no longer active in gene regulation (Crack and Le Brun, 2018; Mettert and Kiley, 2018). At. ferrooxidans gene clusters predicted to be under the control of FNR are suggested to be involved in carbon and energy metabolism along with nitrogen fixation (Osorio et al., 2009). However, the predicted role of FNR and the mechanisms of adaption to changing O₂ concentrations in At. ferrooxidans have not been experimentally tested.

Due to the importance of At. ferrooxidans as a model organism in natural and man-made acidic environments, it is important to understand the regulation of growth, adaptation, and extracellular electron transfer under anoxic and acidic conditions. Here, we characterized the At. ferrooxidans FNR master gene regulator and examined the effect of changing O₂ concentrations on its Fe-S cluster ligand.

Materials and Methods

Bacterial Strains and Growth Conditions

Acidithiobacillus ferrooxidans^T ATCC 23270 was obtained from the American Type Culture Collection (Table 1). The strain was maintained in sterile 9K basal salts medium (sterilized by Tyndallization) adjusted to pH 3.5 with H₂SO₄ (Silverman and Lundgren, 1959) containing 0.5% (wt/vol) S⁰ and incubated under aerobic conditions at 30°C with shaking. Anaerobic (S⁰/Fe³⁺) cultures of At. ferrooxidans were grown in identical medium with the exception of the addition of 25 mM ferric iron (sterile filtered through a 0.22 μm filter) as electron acceptor and the pH was adjusted to 1.8. At. ferrooxidans was pre-grown in aerobic conditions before transferring the cells to an anaerobic jar using the Anaerocult A system (Merck).

TABLE 1.

Bacterial strains and plasmids used in this study.

Strain or plasmid	Genotype	References or sources
At. ferrooxidans
ATCC 23270	Wild type
Escherichia coli
JM109	endA1, recA1, gyrA96, thi, hsdR17 (rk–, mk+), relA1, supE44, Δ(lac-proAB), [F′ traD36, proAB, laqIqZΔM15]	Promega
BL21	F-, ompT, hsdSB (rB-mB-), gal, dcm, rne131, (DE3)	Invitrogen
PK22	hsdS, gaL λDE53, Δcrp-bs990, rpsL, Δfnr, zcj-3061::Tn10	Lazazzera et al., 1993
RZ7350	lacZ Δ145, narG234::MudI1734	Kiley and Reznikoff, 1991
RZ8480	Δfnr, lacZ Δ145, narG234::MudI1734	Lazazzera et al., 1993
Plasmids
pET100/D-TOPO	Expression vector	Invitrogen
pET100/D-TOPO FNRAF	Expression vector, FNRAF protein	This study
pKK223-3	Plasmid vector, Ampr	PL-Pharmacia
pKK223-3 fnrAF	fnrAF coding region cloned into pKK223-3 vector with a tac promoter	This study
pET11A	Expresion vector, Ampr with a T7 promoter	Novagen
pET11A fnrAF	fnrAF coding region cloned into pET11A vector with a T7 promoter	This study

Escherichia coli strains (Table 1) were grown on a rotary shaker in sterile LB medium at 37°C. The following antibiotics were added as required: spectinomycin (Sp; 25 μg/mL), streptomycin (Sm; 25 μg/mL), ampicillin (Ap; 50 μg/mL), and tetracycline (Tc; 10 μg/mL). For β-galactosidase assays, E. coli strains were grown under aerobic or anaerobic conditions at 37°C in minimal medium M9 containing 0.1% glucose with the respective antibiotics. Anaerobic cultures were carried out in anaerobic jars (as described for At. ferrooxidans) on M9 minimal medium containing 0.1% (wt/vol) glucose.

Ferrous Iron Production During Anaerobic Cultures

The formation of ferrous iron in anaerobic cultures was determined by titration with 2,2′-dypyridyl. Samples (1 mL) of culture medium were passed through a 0.2 μm membrane filter and 160 μL aliquots of the filtrate were added to 40 μL of 5 mM 2,2′-dypyridyl. The ferrous iron concentration was determined via a calibration curve of FeSO₄ × 7H₂O at an absorbance of 510 nm in a spectrophotometer. At. ferrooxidans growth was quantified by counting in a Petroff-Hausser chamber. The cells in aerobic and anaerobic cultures were quantified in triplicate cultures to construct the respective growth curves [data presented are means (n = 3) ± standard deviations].

Bioinformatics

The amino acid sequence of FNR from E. coli K12 (FNR_EC; accession number, WP_000916335) was used in a BlastP search against the genome of At. ferrooxidans ATCC 23270. A potential FNR candidate (FNR_AF; locus tag, AFE_0270) was identified with 28% identity. Using FNR_AF in a reciprocal best Blast hit against the NCBI nr database recovered hits against the Crp-Fnr family of transcriptional regulators (domain architecture ID 11429533) from multiple organisms. A conserved domain analysis of FNR_AF was carried out (Marchler-Bauer et al., 2013). Multiple sequence alignments of FNR_AF, FNR_EC and FNR from Aliivibrio fisheri (FNR_AFI, Q5E593) were carried out using Clustal Omega (Sievers and Higgins, 2018) and Swiss-Model (Waterhouse et al., 2018). Where there was a difference between the two alignment methods, the alignment by Swiss-Model was chosen.

Secondary structure analysis of FNR_AF was carried out using homology modeling by comparing the predicted protein with the FNR crystal structure from A. fisheri (PDB 5e44) with a sequence identity of 27.35% and full coverage of the complete protein (Volbeda et al., 2015). The homology model was constructed using Modeler V.9 (Eswar et al., 2008) and validated using the ADIT! Validation Server from PDB (Richardson et al., 2013).

RNA Extraction and Real-Time PCR

Cells were harvested from At. ferrooxidans cultures (maximum 1 × 10⁹ total cells) by centrifugation at 12000 × g for 10 min at 4°C. The pellet was washed with 10 mM H₂SO₄ and then with TE buffer pH 8.0 and finally resuspended in 100 μL of TE pH 8.0. To this mixture, 10 μL RNAse-free lysis buffer (0.5 M TrisHCl, 20 mM EDTA, 10% SDS, pH 6.8) was added and mixed gently. The tubes were incubated at 100°C for 3 min and allowed to cool to room temperature. The previous steps were sufficient to guarantee the rupture of the cells without damaging the RNA. RNA was isolated using RNeasy Mini Kit (Qiagen®) and contaminant DNA removed using RNase free DNase I (Fermentas) according to the manufacturer’s recommendations. The RNA was resuspended in five volumes of RNAlater solution (Qiagen) and subsequently frozen at −80°C until use. RNA samples were reverse-transcribed using Revertaid M-MuLV (Fermentas) and specific oligonucleotides (Table 2) according to the manufacturer’s recommendations and 0.5 μg of total RNA for each reaction. The real-time PCR reactions were performed using an iCycler thermal cycler (Bio-Rad) and the KAPA SYBR FAST qPCR kit (KAPABIOSYSTEMS). The 20 μL PCR reactions contained 2 μL of a 1:100 diluted cDNA sample, 200 nM of each primer (Table 2), and 1 × KAPA SYBR FAST qPCR Master Mix. The reference dye ROX was included at a final concentration of 5 nM. The cycling protocol was as follows: initial denaturation for 10 min at 95°C followed by 40 cycles of 30 s each at 95°C, 56°C, and 72°C. Fluorescence was measured after the extension phase at 72°C and specific amplification was confirmed by a single peak in the melting curve. For each experimental condition, total RNA was extracted from replicate At. ferrooxidans cultures and the real-time PCR reactions were performed in triplicate and thus, the data sets consist of six values per gene. Relative expression levels of At. ferrooxidans fnr (amplified with qPCR fnr FF and qPCR fnr REV primers; Table 2) were normalized with the expression of the stable reference gene rpoC (amplified with qPCR rpoC FF and qPCR rpoC REV primers; Table 2). The rpoC gene has previously been demonstrated to be expressed at a constant level and is a valid choice as a reference (Nieto et al., 2009). Stationary phase genomic DNA (10-fold dilutions ranging from 10 ng to 1 pg) was used to generate a five-point standard curve for every gene by using the Cycle Threshold (Ct) value vs. the logarithm of each dilution factor. Reaction efficiency {E = [10(−1/slope)]^–1} for every gene was derived from the slope of the corresponding standard curves. A one-way Anova (multiple comparison analysis) or a two way ANOVA test swere carried out to test the statistical significance of gene expression results (McDonald, 2009) using the Graphpad Prism software¹.

TABLE 2.

Oligonucleotides used in this study.

Name	Sequence (5′–3′)	Function
pKK FF fnr-EcoRI	ATCGATGAATTCATGACTGCCAGGCACTCCG	Cloning
pKK REV fnr-EcoRI	ATCGATGAATTCTCAGGCGCGGGTGCC	Cloning
fnr FF-NdeI	CATATGACTGCCAGGCACTCC	Cloning
fnr REV-NdeI	CATATGGTCTGCATTGACAATTATCAA	Cloning
qPCR fnr FF	AAGCTGGTCAAGAGTCTGCCCAAT	RT-qPCR
qPCR fnr REV	TGCCGGTCAAGGTAATGGCACTAT	RT-qPCR
qPCR rpoC FF	AATGCGGTGTTGAGGTAACC	RT-qPCR
qPCR rpoC REV	AGGTACTGGTCTTCGGTAAG	RT-qPCR

Cloning Procedures

Acidithiobacillus ferrooxidans genomic DNA was prepared using the Wizard^® Genomic DNA Purification Kit (Promega Corp.). Plasmid DNA was prepared from E. coli JM109 cultures with the QIAprep^® Spin MiniPrep Kit (Qiagen). PCR products for cloning were amplified using oligonucleotides in Table 2 and purified from agarose gels with the SpinPrepTM Gel DNA Kit (Novagen).

To carry out β-galactosidase assays, the coding region of the At. ferrooxidans fnr gene (termed fnr_AF) was amplified with primers containing embedded EcoRI restriction sites: pKK FF fnr-EcoRI and pKK REV fnr-EcoRI (Table 2). Cloning and transformation was carried out using standard techniques as described by Miller (1972). The amplification product was cloned into the multiple cloning site of pKK223-3 carrying the Ptac promoter (Pharmacia Biotech), generating pKK223-3 fnr_AF. pKK223-3 fnr_AF was transformed into E. coli strain RZ8480 which is Δfnr and contains lacZ under control of the PnarG promoter (Lazazzera et al., 1993). Finally, the fnr_AF coding region was cloned from PKK223-3 FNR_AF into the pET100/D-TOPO expression vector to generate pET100/D-TOPO FNR_AF that was subsequently used as a control in the Western blot analysis.

For the construction of the plasmid pET11A fnr_AF,the At. ferrooxidans fnr gene coding region was amplified with primers containing embedded NdeI restriction sites fnr FF-NdeI and fnr REV-NdeI (Table 2). The product was cloned into pET11A (Novagen), generating plasmid pET11A fnr_AF (Table 2). The construct was then transformed into E. coli strain PK22 (Lazazzera et al., 1993) for FNR_AF purification experiments. E. coli strain PK22 was used because it lacks both FNR_EC and the structurally related CRP (cAMP-activated global transcriptional regulator) that could potentially contaminate the preparation of FNR_AF (Lazazzera et al., 1993).

β-Galactosidase Assays

Escherichia coli was pre-grown aerobically overnight in M9-glucose medium (Sambrook et al., 1989). The medium (10 mL) was inoculated with 1% (vol/vol) seed culture and incubated in anaerobic jars until the cell density reached an optical density at 600 nm (OD₆₀₀) of 0.8. The cultures had not yet achieved stationary phase since the cell mass increased at least twofold with further incubation. β-galactosidase assays were performed as described by (Miller, 1972) using chloroform and 0.1% sodium dodecyl sulfate to permeabilize the cells. All β-galactosidase assay results are the average of triplicate samples for each strain ± standard deviations.

Purification of FNR_AF

FNR-like protein was purified from strain PK22 carrying pET11A-fnrAF using the anaerobic protocol developed for FNR_EC. The cells were grown aerobically in 4 L of M9 minimal medium plus 0.2% (wt/vol) glucose and ampicillin at 37°C to an OD₆₀₀ ∼0.3, and IPTG was added to a final concentration of 400 μM for 1 h to induce FNR biosynthesis. After induction, cells were sparged overnight at 4°C with argon to remove the presence of O₂. All subsequent steps in FNR purification were carried out under anaerobic conditions in a Coy anaerobic chamber with an atmosphere of 90% N₂ and 10% H₂ or in sealed tubes. The cells were harvested by centrifugation at 7,900 g for 15 min at 4°C and concentrated 200-fold in buffer A [50 mM potassium phosphate (pH 6.8), 0.1 mM EDTA, 0.1 M KC1, 10% glycerol, 1 mM dithiothreitol (DTT), and 0.1 mM phenylmethanesulfonylfloride (PMSF)], and passed once through a French press at 20,000 psi. The extracts were centrifuged at 139,000 g for 1 h to remove the membrane fraction. Cell extracts were passed over a 5 mL Bio-Rex 70 cation-exchange column (BioRad Laboratories) at a flow rate of 0.17 mL/min and eluted with a 70 mL linear gradient of 0.1 to 1 M KC1 in buffer A. Fractions containing a green color were pooled and diluted 1:4 with buffer C [50 mM phosphate (pH 6.8) plus 10% (vol/vol) glycerol] and loaded onto a 1 mL BioRex-70 gravity column, washed with 2 column volumes of buffer A, and eluted with 1 column volume of buffer B [50 mM phosphate (pH 6.8), 10% (vol/vol) glycerol, and 1 M KCl]. The purity of the FNR protein preparations was estimated from Coomassie-stained SDS-polyacrylamide gels. The protein concentration was estimated by a Bradford assay using the Coomassie Plus Protein Assay Reagent (Pierce).

Purification of His-tagged FNR_AF was carried out by first transforming pET100/D-TOPO FNR_AF into E. coli BL21 cells. Induction of FNR_AF was carried out in cell cultures grown to an OD₆₀₀ of 0.8 in LB supplemented with amp (100 μg/ml) by adding 1 mM IPTG to the culture medium for 1 h. The overexpressed FNR_AF protein contained in the soluble extracts was purified by nickel-charged agarose resins (BIO-RAD) using 1M imidazole.

Western Blotting

Aliquots of total protein extract and purified FNR protein (approximately 10 μM of protein) were separated by SDS-PAGE with either 15 or 18% acrylamide (total acrylamide/bisacrylamide) and transferred onto nitrocellulose filters by standard methods with a Bio-Rad blotting apparatus.

The blotted proteins were subsequently screened using a polyclonal rabbit anti-FNR serum generated against FNR_EC. Filters were blocked overnight in blocking solution [5% skimmed milk, 0.05% Triton X-100, and Tris-buffered saline (TBS)] at 4°C with agitation, incubated for 1 h with a 1:500 dilution of the primary antibody in TBS/Tween 20 (0.05%) and further incubated in a 1:15,000 dilution of peroxidase-conjugated anti-rabbit immunoglobulin in TBS/Tween 20 (0.05%) for another hour. Immunoreactive proteins were detected using the Supersignal West Pico chemiluminescent substrate (Pierce). Pre-stained broad-range molecular mass protein standards from Bio-Rad were used. Protein concentrations were determined with Bio-Rad Protein Assay using BSA as standard.

UV-Visible Spectroscopy

To measure the absorbance of the FNR_AF, 1 mL of the protein stored under anaerobic conditions was used at a concentration of 10 μM in 50 mM phosphate buffer pH 6.8 containing 0.4 M KCl and its absorbance was recorded between 200 to 700 nm in a Lambda 25 UV/Vis spectrophotometer (PerkinElmer). The impact of O₂ on the spectral characteristics of Fnr_AF was evaluated by exposure of the sample to air for 0, 30, 90, 120, 150, 180, and 210 min and the absorbance spectra between 200 and 700 nm was recorded. As a control, the absorbance of the protein under anaerobic conditions was measured over the same time period in order to rule out other environmental factors causing a change in the protein’s spectral properties.

Iron determinations in FNR_AF were performed by the TPTZ method which forms a deep blue-purple color with ferrous iron that is spectrophotometrically measured at 562 nm as previously described (Yan and Kiley, 2009).

Results and Discussion

Anaerobic Growth of At. ferrooxidans ATCC 23270

A comparison of At. ferrooxidans growth in oxic and anoxic conditions was performed in which elemental sulfur oxidation was coupled, respectively to reduction of O₂ or Fe³⁺ as final electron acceptors. Despite the fact that both cultures reached similar levels of cell density, a reduced growth rate was observed when At. ferrooxidans used Fe³⁺ anaerobically instead of O₂ as terminal electron acceptor (Figure 1). During anaerobic reduction of Fe³⁺, the amount of Fe²⁺ rose to a maximum of 228 ± 4 μM at stationary phase in the presence of At. ferrooxidans compared to 4 ± 4 μM Fe²⁺ in the un-inoculated control. These growth curves confirm and extend earlier observations (Osorio et al., 2013).

FIGURE 1.

Chemolithoautotrophic growth of Acidithiobacillus ferrooxidans via aerobic and anaerobic respiration with S⁰ as the electron donor. (A) Time dependent changes in cell density of aerobically (▲) and anaerobically (■) respiring cultures and (B) Fe²⁺ formation in aerobic (■) and anaerobic () cultures. Data points are biological triplicates ± SD.

Primary and Secondary Structure Analysis of FNR_AF

The amino acid sequence of FNR_EC from E. coli K12 (accession number: WP_000916335) was used in a BlastP search against the genome of At. ferrooxidans ATCC 23270. A potential FNR_AF candidate (AFE_0270) was identified with 28% identity. Using FNR_AF in a reciprocal best Blast hit against the NCBI nr database recovered hits against the Crp-Fnr family of transcriptional regulators (domain architecture ID 11429533) from multiple organisms.

A conserved domain analysis of FNR_AF (Marchler-Bauer et al., 2013) and a comparison of its primary amino acid sequence with FNR_EC [as reviewed in (Crack and Le Brun, 2018; Mettert and Kiley, 2018)] showed that it contained the following motifs characteristic of an FNR-like protein² : (i) three of the four cysteines (positions 20, 23, and 122, using a numbering system based on the FNR_EC sequence) potentially forming part of an Fe-S cluster binding domain involved in coordinating an [4Fe-4S]²⁺ center; (ii) a dimerization helix; and (iii) a DNA binding domain (Figure 2).

FIGURE 2.

Cartoon of predicted domain structure of FNR_AF compared to FNR_EC. The four cysteines that coordinate the [4Fe-4S]²⁺ cluster at positions 20, 23, 29, and 122 in FNR_EC (Mettert and Kiley, 2007) are highlighted in yellow. Three of these cysteines are conserved in FNR_AF.

FNR_AF Can Drive Expression From the FNR-Responsive E. coli Promoter PnarG

Although bioinformatic analyses strongly support the contention that FNR_AF is an FNR-like protein, we investigated whether FNR_AF could complement a mutant strain that lacked fnr, providing evidence for its function. It is difficult to generate a Δfnr mutant of At. ferrooxidans as the organism is challenging to manipulate genetically (Inaba et al., 2018) as reviewed in (Gumulya et al., 2018). Therefore, we chose to complement an E. coli strain RZ8480 lacking fnr (Δfnr). To accomplish this, a plasmid pKK223-3 fnr_AF was constructed containing the predicted fnr_AF coding sequence fused to the IPTG inducible promoter Ptac, and was transformed into RZ8480 (Δfnr, PnarG–lacZ). This strain contains lacZ, under the control of the FNR inducible PnarG promoter (Figure 3A). Therefore, when a functional FNR is cloned and expressed in E. coli strain RZ8480, it can induce the expression of lacZ, giving rise to a measurable β-galactosidase activity.

FIGURE 3.

Experimental design and results of FNR_AF activity from the Escherichia coli promoter PnarG. (A) Experimental design to test the effect of FNR_AF (encoded on plasmid pKK223-3 fnr_AF) on in vivo expression of PnarG in E. coli Δfnr. (B) Data are reported as β-galactosidase activities (n = 3 ± SD, one way Anova p < 0.05) in strains RZ8480 A. f. [E. coli fnr (−) fnr A,f. (+)] in plasmid pKK223-3, PK7350 [E. coli fnr (+)], RZ8480 [E. coli fnr (−)], and RZ8480 PKK [E. coli fnr (–)] with pKK223-3 plasmid. The dotted arrow indicates the expression of FNR_AF from fnr_AF, its dimerization and binding to PnarG.

Escherichia coli strain RZ8480 transformed with pKK223-3 fnr_AF was grown anaerobically until mid-log and β-galactosidase activity was measured after induction with 0.5 mM IPTG for 1 hr (Figure 3B). This activity was compared to that of E. coli strain RZ7350 that contains a native fnr and the PnarG-lacZ allele. We observed that β-galactosidase was expressed in the recombinant strain harboring FNR_AF, indicating FNR_AF is able to drive expression from the PnarG promoter. However, expression from PnarG is about 70% of that produced by FNR_EC. One-way ANOVA (multiple comparisons analysis) was used to test the statistical significance yielding p < 0.05. Possible explanations for the observed decrease in expression are that there are important amino acid and/or structural differences between the respective FNRs or the architecture of the respective FNR binding sites are different. Alternatively, since Ptac is a strong promoter, a certain amount of expressed FNR_AF could be present in the cell in a non-soluble form potentially accounting, at least in part, for the lower activity.

As expected, little β-galactosidase activity was detected in the E. coli strain RZ8480 transformed with the vector only control (pKK223-3 lacking fnr_AF). Thus, fnr_AF is driving the expression of β-galactosidase and hence is capable of complementing Δfnr_EC.

The observation that fnr_AF can regulate expression from the E. coli PnarG promoter provides evidence that it could potentially be involved in the regulation of anaerobic metabolism in At. ferrooxidans as has been observed in a number of organisms. However, as yet, there is no experimental evidence to test this hypothesis because of the difficulties involved in genetic manipulation of this organism.

Transcription Levels of At. ferrooxidans fnr in Different Growth Conditions

Having demonstrated that FNR_AF is functional in a surrogate host, we wished to evaluate whether it was expressed in cell cultures of At. ferrooxidans and if so, under what conditions. Whole cell RNA was prepared from cells in four culture conditions: (i) anaerobic exponential growth; (ii) aerobic exponential growth; (iii) anaerobic stationary phase; and (iv) aerobic stationary phase and was quantified by RT-qPCR using the housekeeping gene rpoC mRNA as an internal standard (Figure 4). In anaerobic stationary phase, the number of RNA transcripts of FNR_AF exceeded that observed in aerobic conditions with statistical support (two-way ANOVA, multiple t unpaired test, p < 0.05). Also, the number of RNA transcripts in the stationary phase in both anaerobic and aerobic conditions exceeded (p < 0.05) those detected in the equivalent exponential phase. These results suggest the existence of a mechanism for regulating the level of fnr_AF transcripts depending on the growth phase and the presence or absence of O₂. Using known transcription factor binding sites of fnr_AF as models (Osorio et al., 2009), no FNR-type binding sites could be detected bioinformatically upstream of fnr_AF, suggesting that it is not auto-regulated.

FIGURE 4.

Level of fnr_AF transcripts in aerobic and anaerobic conditions. RT-qPCR data are expressed as relative values normalized to the housekeeping gene rpoC and presented as the average of triplicate samples ± the standard deviation, two-way Anova p < 0.05. An Exp, anaerobic exponential; Aer Exp, aerobic exponential; An Stat, anaerobic stationary; and Aer Stat, aerobic stationary.

Purification and Biochemical Characterization of FNR_AF

Antibodies prepared against FNR_EC were able to react with FNR_AF prepared from plasmid pET100/D-TOPO fnr_AF cloned into E. coli strain BL21 consistent with the observation that the two FNRs have similar structural regions that the antibody recognizes (Figure 5A). To determine if FNR_AF contains an O₂-sensitive metal cofactor, it was purified under anaerobic conditions (Figure 5B). The FNR_AF enriched fractions had a brownish color suggesting the presence of a light absorbing cofactor associated with the protein (data not shown). The ultraviolet/visible spectrum of the protein, recorded under anoxic conditions (Figure 5C), showed the expected protein absorption maximum at 280 nm and a broad absorbance centered around 420 nm, consistent with a Fe-S cluster containing protein (Khoroshilova et al., 1995). In order to identify the type of Fe-S cluster coordinated by FNR_AF, we measured the iron content of the purified FNR_AF. We found approximately 4.5 mol iron per monomer of mol FNR_AF, which is highly suggestive of a [4Fe-4S]²⁺ cluster per monomer of protein (Figure 5D).

FIGURE 5.

Biochemical validation and properties of FNR_AF. (A) Western blot, antibodies prepared against FNR_EC were used to detect FNR_AF, which was overproduced from plasmid pET100/D-TOPO fnr_AF cloned into E. coli strain BL21. The gel shows the molecular mass marker (MM), crude cell free extract (approximately 10 μg of total protein) prepared prior to induction of fnr_AF expression with IPTG (lane 1), 10 μg crude cell free extract 1 h after induction of fnr_AF expression with IPTG (lane 2), and elution’s 1 to 4 of 10 μg purified FNR_AF protein after elution from the nickel column (lanes 3–6). (B) Overproduction and purification of FNR_AF from the pET11A fnr_AF plasmid as shown by SDS-PAGE analysis. Gel lane 1 shows crude cell free extract (approximately 10 μg of total protein) prepared prior to induction of fnr_AF expression with IPTG; lane 2, 10 μg of crude cell free extract 1 h after induction of fnr_AF expression with IPTG; and lane 3, 10 μg FNR_AF after the second cationic interchange chromatographic column. M, molecular mass marker (Mr are indicated). (C) Ultraviolet/visible absorption spectrum of a representative result of biological duplicates for purified FNR_AF from anaerobically grown At. ferrooxidans with an inset of the ultraviolet/visible spectrum of anaerobically purified FNR_EC taken from Lazazzera et al. (1993). (D) Calculation of the FNR_AF iron content by spectrophotometric assay.

FNR_AF Reacts More Slowly With O₂ in vitro Than FNR_EC

The ability to sense and adapt to changes in O₂ concentration is critical for the regulatory function of FNR proteins. The ability of FNR to function as a transcription factor depends on the integrity of the [4Fe-4S]²⁺ cluster, which promotes a conformation amenable for dimerization, site-specific DNA binding, and transcriptional regulation [reviewed in (Crack and Le Brun, 2018; Mettert and Kiley, 2018)]. The O₂ sensitivity of FNR is mediated by the [4Fe-4S]²⁺ cluster whereby in the presence of O₂, the [4Fe-4S]²⁺ cluster is converted to [2Fe-2S]²⁺ both in vitro and in vivo. The [2Fe-2S]²⁺ form of FNR is monomeric in solution and is inactive for DNA binding and transcriptional regulation (Jordan et al., 1997; Khoroshilova et al., 1997; Popescu et al., 1998). To test whether FNR_AF is O₂ sensitive, the UV-visible spectrum of anaerobically purified FNR_AF was recorded after it was exposed to air. A progressive decrease in absorbance, was observed consistent with the degradation of the [4Fe-4S]²⁺ by O₂ and with complete degradation occurring by 210 min (Figure 6). The cluster decay was much slower than that observed for wild type FNR_EC (Crack et al., 2014) and other naturally O₂-stable FNRs from Neisseria meningitidis (Edwards et al., 2010), Pseudomonas putida [FNR PP_3233; (Ibrahim et al., 2015)], and Paracoccus denitrificans (Crack et al., 2016). Furthermore, the appearance of a [2Fe-2S]²⁺ cluster product was not readily observed as found previously with E. coli FNR.

FIGURE 6.

Effect of O₂ exposure on the ultraviolet/visible spectrum of anoxically purified FNR_AF (10 μM). Changes are shown occurring in the 300–550 nm spectral region after 0, 30, 60, 90, 120, 150, 180, and 210 minutes exposure to O₂.

Primary Amino Acid Sequence Differences Between FNR_AF and FNR_EC Discussed in Light of the Three-Dimensional Crystal Structure of FNR From Aliivibrio fisheri

Note that in the following results, all amino acid locations in FNR_AF are given based on the numbering system of FNR_EC in order to expedite comparisons in the text between the two sequences which have different lengths.

Despite the overall similarity of the primary amino acid sequences of FNR_AF and FNR_EC, a number of important differences were observed. It is important to consider how these differences might affect the function of FNR_AF and impact how FNR_AF coordinates the [4Fe-4S] center and its increased resistance to O₂. In order to address these issues, an alignment was carried out of the amino acid sequences of FNR_AF, FNR_EC, and FNR from Aliivibrio fisheri (Figure 7). The primary amino acid sequences were then compared to three dimensional models of FNR_AF and FNR_EC built using the crystal structure of FNR from A. fisheri (FNR_AFi) as a template [PDB 5CVR (Volbeda et al., 2015)]. In agreement with the amino acid sequence evidence, the model shows that FNR_AF shares similar global protein structure with important functional domains of FNR_EC, displaying a similar spatial distribution with an acceptable QMEAN score of −1.71 (Figure 8). These domains include the sensor domain that comprises a series of structural β-sheets with a [4Fe-4S]²⁺ coordination site, an α-helix promoting protein dimerization, and a DNA-binding domain composed of an HTH motif that allows recognition and binding to transcription factor binding sites (Myers et al., 2013).

FIGURE 7.

Comparison of the amino acid sequence of FNR_AF (AFE_0270) with that of FNR_EC (WP_000916335). The sequence of FNR from Aliivibrio fisheri (FNR_AFi; Q5E593) is included for comparison. The numbers correspond to the amino acid sequence of FNR_EC. In the sequence of FNR_EC, the four cysteines coordinating the [4Fe-4S]²⁺ center are highlighted in yellow. FNR_EC sequences corresponding to the dimerization helix and the DNA binding HTH motif are highlighted in gray and turquoise, respectively. Clear boxes indicate additional amino acids discussed in the text.

FIGURE 8.

Structural comparison and partial sequence comparison of (A) FNR_EC and (B) FNR_AF. Models of the three-dimensional structures of the respective monomers, showing the sensory domains, dimerization helices, and DNA binding domains, were created using the crystal structure of FNR_AFi (PDB 5e44) as a template. Cartoons of the sensory domains and dimerization helices are enlarged to illustrate specific amino acid locations discussed in the text. [4Fe-4S]²⁺ centers are illustrated with yellow and red Fe-S cage structures.

[4Fe-4S]²⁺ Center Coordination in FNR_AF

A notable difference in amino acid sequence between FNR_AF and FNR_EC is in the coordinating ligands of the [4Fe-4S]²⁺ center. In FNR_EC, coordination is carried out by four cysteines located at positions 20, 23, 29, and 122 (Figure 7). In FNR_AF, cysteines are conserved at positions 20, 23, and 122 and, based on the 3D model, these are predicted to be located in positions that could potentially allow them to participate in coordinating the [4Fe-4S]²⁺ center (Figure 8). There is no corresponding cysteine at position 29 in FNR_AF; there is, however, a Ser at this position that could potentially be the fourth coordinating ligand of the [4Fe-4S]²⁺ center. While mutational studies have shown that Ser can serve as a cluster ligand (Fujinaga et al., 1993; Vassiliev et al., 1995; Bentrop et al., 1996; Mansy et al., 2002) naturally occurring serine ligands are rare. Nevertheless, it is worth noting that the LipA enzyme contains an auxiliary [4Fe-4S] cluster that contains a 3Cys/Ser cluster ligation (Harmer et al., 2014).

An alternative hypothesis is that a Cys in FNR_AF at position 40 could assume the function of the missing Cys₂₉. Although this hypothesis cannot be rejected, we do not favor it. Inspection of the three-dimensional model of FNR_AF suggests that the protein is unlikely to be able to fold to bring Cys40 into sufficient proximity to the [4Fe-4S]²⁺ center to facilitate the required coordination.

Amino Acid/Structural Changes That Could Help Explain the Observed Stability of FNR_AF in Air

One of the major differences of FNR_AF compared to FNR_EC is the increased stability of the Fe-S cluster in air. Here, we inspect the primary amino acid sequence and postulated 3D structure of FNR_AF in order to propose hypotheses for explaining this unusual property.

Amino acid changes around the cluster ligand Cys₂₃ have been shown to alter the O₂ response of FNR in a number of organisms. In FNR_EC, replacement of Ser₂₄, located immediately adjacent to the cluster ligand Cys₂₃, by Pro results in increased aerobic FNR activity (Jervis et al., 2009). A natural variant of FNR from P. denitrificans has Pro in the position equivalent to Ser₂₄ in FNR_EC and is at least six times less sensitive to O₂ than FNR_EC (Crack et al., 2016). In P. putida a natural variant of FNR has an Arg in position 24 and is more stable to O₂ than FNR_EC (Ibrahim et al., 2015). In At. ferrooxidans there is Leu in position 24 (Figure 7) and by analogy, this amino acid substitution could at least partially account for the lower O₂ reactivity of FNR_AF.

Amino acid changes at other positions next to the cluster-coordinating Cys residues are also known to influence the aerobic reactivity of FNR_EC. For example, substitution of Asp₂₂ by Ala (Ibrahim et al., 2015) or by Gly (Kiley and Reznikoff, 1991) increased O₂ activity of FNR. FNR_AF has an Asp to His substitution at position 22. Interestingly, it has been found that juxtaposition of His to the cysteine-coordinated [4Fe-3S]²⁺ center of a subgroup of Ni hydrogenases provides stability in the presence of O₂ (Frielingsdorf et al., 2014; Flanagan et al., 2018). Also, substitution of Leu₂₈ by the positively charged His has been shown to stabilize the [4Fe-4S]²⁺ center in FNR_EC in the presence of O₂ (Bates et al., 2000) perhaps by hindering conformational flexibility of the region (Volbeda et al., 2015). FNR_AF has the bulky, polar, neutral amino acid Gln in this position and perhaps, like the L₂₈F variant of FNR_EC (Jervis et al., 2009), this could hinder conformational flexibility by steric hindrance that results in greater activity in O₂.

Changes in the dimerization helix may also alter the stability of the FNR dimer in O₂. Two charged residues Arg₁₄₀ and Asp₁₃₀ have been reported to a play key role in the monomer-dimer equilibrium in FNR_EC (Moore and Kiley, 2001). An examination of the crystal structure of FNR_AFi indicates that these residues could form a salt bridge between the a-C helix (Arg140) of one monomer with the opposite a-B helix (Asp₁₃₀) of the other monomer, perhaps modulating monomer-dimer equilibrium in FNR (Volbeda et al., 2015). Both Arg₁₄₀ and Asp₁₃₀ are conserved in FNR_AF implying conservation of the salt bridge and its role in monomer-dimer equilibrium in changing O₂ environments (Figures 7, 8).

Of particular importance is the observation that when Asp₁₅₄ in the dimer interface of FNR_EC is replaced with Ala₁₅₄, FNR_EC exhibits increased activity under aerobic conditions (Moore et al., 2006). In FNR_AF position 154 is occupied naturally by Ala, strongly suggesting that this change could, at least partially, explain its increased activity in O₂ (Figures 7, 8).

Hydrophobic interactions have also been shown to be involved in dimer interaction and stabilization. These include Met₁₄₄, Met₁₄₇, Ile₁₅₁, and Ile₁₅₈ that lie on the dimer interface of FNR_EC as shown in the three-dimensional model (Figure 8; Moore and Kiley, 2001; Volbeda et al., 2015). Ile₁₅₈ is conserved in FNR_AF, but the other equivalently positioned residues in FNR_AF are Phe₁₄₄, Trp₁₄₇, and Leu₁₅₁, respectively. All are hydrophobic and potentially play a role in dimer stabilization. Of interest is the possibility that in FNR_AF Trp₁₄₇ of one monomer helix and Phe₁₄₄ of the complementary monomer helix could interact through stacking of their respective aromatic rings, potentially providing additional stability to the interacting helices as has been observed in other proteins (McGaughey et al., 1998; Budyak et al., 2013; Madhusudan Makwana and Mahalakshmi, 2015).

Another difference is the presence of a truncated and divergent N terminal region of FNR_AF compared to FNR_EC, in which FNR_AF has only 7 amino acids just prior to the first Cys involved in [4Fe-4S]²⁺ center coordination instead of the 19 observed in FNR_EC (Figure 7). These amino acids form part of a flexible region with no predicted secondary structure. The truncation in FNR_AF does not appear to be a result of sequence mis-annotation e.g., incorrect translation start site. Interestingly, deletion of N-terminal amino acid residues 2 to 16 and 2 to 17 FNR_EC, increased FNR activity under aerobic conditions (Yan and Kiley, 2008). These results suggest that the N-terminal region also contributes to the lability of the [4Fe-4S] cluster of FNR to O₂ and that the removal of amino acids in this region may act to increase the stability of the cluster to O₂. How these changes operate is not known.

Additional Discussion

Anaerobic culturing of At. ferrooxidans confirmed previous reports that it is capable of growth using Fe³⁺ as the final electron acceptor (Ohmura et al., 2002; Osorio et al., 2013) and that anaerobic growth is slower than with O₂ as the electron acceptor (Osorio et al., 2013; Figure 1). The slower rate of growth for anaerobic cultures may be due to the greater amount of energy available from sulfur oxidation using O₂ as terminal electron acceptor (−124 kcal/atom S⁰) compared with Fe³⁺ reduction (−75 Kcal/atom S⁰).

The ability to transition from aerobic reduction of O₂ to utilizing ferric iron as a terminal electron acceptor suggests that At. ferrooxidans must regulate the expression of alternative electron transfer chains used in energy conservation. In this study, we provide evidence that At. ferrooxidans, a model organism for studying life at extremely low pH, contains a FNR-like protein (FNR_AF) that is a member of the CRP FNR superfamily of regulators. FNR_AF exhibits sequence (Figure 2) and structural similarity (Figure 8) with the archetypal FNR from E. coli (FNR_EC) that was recently deduced from the crystal structure of FNR from Al. fisheri (Mettert and Kiley, 2018). FNR_AF reacts with antibodies prepared against FNR_EC (Figure 5A) and is able to drive expression from the FNR-responsive E. coli PnarG promoter, suggesting that it is functionally active as an FNR-like protein at least in the surrogate host E. coli.

Despite high levels of structural and protein sequence similarity, FNR_AF exhibits several properties that differ from FNR_EC. First, RNA encoded by fnr_AF, although detected in aerobic cultures, increases in amount in the stationary phase of anaerobically grown cultures (Figure 4), suggesting that depletion of O₂, and/or culture age upregulate fnr expression or modifies post-transcriptional processing of fnr RNA. Upregulation of fnr in anaerobic conditions has also been observed in B. subtilis (Cruz Ramos et al., 1995). In contrast, although there is negative auto-regulation of FNR_EC expression (Mettert and Kiley, 2007), in E. coli it has been demonstrated that FNR activity is predominantly regulated at the protein level where FNR appears to cycle between active [4Fe-4S]²⁺, inactive [2Fe-2S], and apo forms, with the level of O₂ determining which form predominates and therefore, the extent to which FNR is transcriptionally active. Such a mechanism requires that the levels of FNR in the cell are tightly controlled (Spiro and Guest, 1987; Sutton et al., 2004; Mettert and Kiley, 2007; Jervis et al., 2009). The suggestion that expression of fnr_AF is regulated opens up opportunities to investigate the underlying mechanism(s) involved.

Another important consideration is the significantly increased stability of FNR_AF compared to FNR_EC. What could be the evolutionary advantage of this strategy? We hypothesize that it allows the control of genes in its network over a wide range of O₂ concentrations without the need to resort to recycling between active and inactive forms of FNR, as in E. coli, or to differential transcriptional regulation of FNR as exhibited by B. subtilis, P. putida, H. seropedicae, B. cenocepacia, and R. eutropha. These mechanisms are energetically costly and time consuming. Speed of response to increased environmental concentrations of O₂ might be particularly critical for At. ferrooxidans as it needs to transition rapidly from anaerobic to highly oxidizing Fe-rich environments at very low pH such as found in bioheaps for industrial copper recovery (Jerez, 2008) and in biofilms in naturally occurring acidic environments (Wilmes et al., 2009; Liljeqvist et al., 2015) and these responses need to be made in an organism with a relatively slow growth rate and whose energy budget allocation is restricted by living at the thermodynamic edge of life.

Data Availability

Publicly available datasets were analyzed in this study. This data can be found here: https://www.ncbi.nlm.nih.gov/genome/1014?genome_assembly_id=300479.

Author Contributions

DH, EJ, and PK designed the study. HO and EM carried out the experiments. All authors analyzed the data. DH and MD drafted the manuscript and all authors agreed on the final version.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.