Skip to main content
NCBI home page
Lippincott Open Access logoLink to Lippincott Open Access
. 2018 Oct 17;100(15):1-11. doi: 10.2106/JBJS.16.01066

Expression of Signaling Molecules Involved in Embryonic Development of the Insertion Site Is Inadequate for Reformation of the Native Enthesis

Evaluation in a Novel Murine ACL Reconstruction Model

Xiang-Hua Deng 1, Amir Lebaschi 1, Christopher L Camp 1,2, Camila B Carballo 1, Nathan W Coleman 1, Jianchun Zong 1, Brian M Grawe 3, Scott A Rodeo 1,a
PMCID: PMC6661256  PMID: 30063598

Background:

Since healing of anterior cruciate ligament (ACL) grafts occurs by formation of a fibrovascular scar-tissue interface rather than by reformation of the native fibrocartilage transition zone, the purpose of our study was to examine expression of various signaling molecules and transcription factors that are known to be involved in embryologic insertion-site development following ACL reconstruction. We also aimed to characterize a murine model of ACL reconstruction to allow future study of the molecular mechanisms of healing.

Methods:

Seventy-nine mice underwent reconstruction of the ACL with autograft. Healing was assessed using histology in 12 mice and quantitative real-time polymerase chain reaction (qRT-PCR) gene-expression analysis in 3 mice at 1 week postoperatively (Group-1 mice) and by biomechanical analysis in 7, histological analysis in 7, immunohistochemical analysis in 5, microcomputed tomography analysis in 5, and qRT-PCR analyses in 8 at 2 weeks (Group-2 mice) and 4 weeks (Group-3 mice) postoperatively. Fifteen additional mice did not undergo surgery and were used for biomechanical (7 mice), qRT-PCR (3 mice), and immunohistochemical (5 mice) analyses to obtain baseline data for the native ACL.

Results:

Histological analysis demonstrated healing by formation of fibrovascular tissue at the tendon-bone interface. Immunohistochemical analysis showed a positive expression of proteins in the Indian hedgehog, Wnt, and parathyroid hormone-related protein (PTHrP) pathways. There was minimal Sox-9 expression. Gene-expression analysis showed an initial increase in markers of tissue repair and turnover, followed by a subsequent decline. Mean failure force and stiffness of the native ACL were 5.60 N and 3.44 N/mm, respectively. Mean failure force and stiffness were 1.29 N and 2.28 N/mm, respectively, in Group 2 and were 1.79 N and 2.59 N/mm, respectively, in Group 3, with 12 of 14 failures in these study groups occurring by tunnel pull-out.

Conclusions:

The spatial and temporal pattern of expression of signaling molecules that direct embryologic insertion-site formation was not adequate to restore the structure and composition of the native insertion site.

Clinical Relevance:

Development of a murine model to study ACL reconstruction will allow the use of transgenic animals to investigate the cellular, molecular, and biomechanical aspects of tendon-to-bone healing following ACL reconstruction, ultimately suggesting methods to improve healing in patients.

Function of an anterior cruciate ligament (ACL) graft is dependent on secure healing in a bone tunnel1,2. Prior work has demonstrated that healing at the tendon-bone interface in ACL reconstruction occurs by formation of a fibrovascular scar-tissue interface that does not recapitulate the microscopic architecture of the native enthesis2-6. Bone resorption along the tunnel (tunnel widening) may also compromise attachment strength, contributing to recurrent knee laxity7,8. Accordingly, research has focused on understanding the biologic healing mechanism in an attempt to optimize healing2-6.

Animal models of ACL reconstruction have provided insight into the basic biologic and biomechanical factors that affect graft healing9-15. However, a complete understanding of the cellular signaling pathways that regulate ACL graft incorporation is still lacking. Murine models provide the ability to study the role of specific molecular pathways in healing using genetically modified strains. Accordingly, we have worked to develop and validate a murine model of ACL reconstruction that would allow study of the role of important cell-signaling molecules in graft healing, given the availability of transgenic animals and biologic assays for molecular investigation.

Several of the signaling molecules critical to the initiation and regulation of insertion-site formation during embryogenesis include scleraxis, Mohawk, Indian hedgehog, EGR1 and EGR2 (early growth response 1 and 2), Sox-9, Wnt, and PTHrP (parathyroid hormone-related protein)16,17. Scleraxis and Sox-9 are factors that play a fundamental role in insertion-site formation in the developing embryo, as tendon attachment-site progenitor cells express both scleraxis and Sox-918-20. It seems reasonable that recapitulation of the events that occur during embryogenesis would lead to optimal insertion-site healing. In order to begin to study the role of these signaling molecules in graft healing, the purposes of this work were to develop a murine model of ACL reconstruction and to define the healing process at the histological and molecular levels as well as to test the hypothesis that signaling molecules that direct enthesis formation during embryogenesis will not be expressed in the fibrovascular scar response at the healing tendon-bone interface.

Materials and Methods

A total of 94 C57BL/6 male mice (age,12 weeks; weight, 22 to 30 g) were utilized (Fig. 1). Biomechanical (7 mice), immunohistochemical (5 mice), and quantitative real-time polymerase chain reaction (qRT-PCR) (3 mice) analysis was performed on 15 mice without surgery to provide a baseline for comparison. Seventy-nine mice underwent unilateral ACL reconstruction. Postoperatively, animals were allowed free activity within the cage and received standard postoperative care. Three mice were killed on postoperative day 7 (Group 1) for qRT-PCR analysis, and 12 were killed for histological analysis. Half (32) of the remaining mice were killed on postoperative day 14 (Group 2), while the remaining 32 were killed on day 28 (Group 3). Within each of these last 2 study groups, 7 mice underwent biomechanical testing, 5 underwent microcomputed tomography (microCT), 12 were analyzed with histology (7, with routine histology and 5, with immunohistochemistry), and the remaining 8 were used for qRT-PCR analysis.

Fig. 1.

Fig. 1

Open in a new tab

Allocation of animals to the intact-ACL and ACL-reconstruction groups. IHC = immunohistochemistry.

For the surgical technique, a novel murine ACL reconstruction model using loupe magnification and microsurgical techniques was developed21. We practiced extensively on cadaveric specimens to identify isometric graft-attachment points. Graft isometry was established by attaching the graft to a load cell in order to measure tension through knee range of motion. We verified that the surgeon could consistently demonstrate reproducibility of the technique and graft isometry on a minimum of 6 consecutive specimens before performing the procedure on live animals. The surgical procedures were performed by a fellowship-trained orthopaedic surgeon. (Video 1).

Video 1 Demonstration of the surgical technique for performing ACL reconstruction in a mouse.

Animals were placed on a custom operative table (Fig. 2-A). The flexor digitorum longus (FDL) was harvested through 2 percutaneous incisions on the leg and plantar aspect of the foot. The FDL was freed proximally and retrieved through the distal incision. A surgical clip was applied to the distal end, and a 7-0 PROLENE suture (Ethicon) was tied to the proximal end (Fig. 2-B).

Fig. 2.

Fig. 2

Open in a new tab

Figs. 2-A and 2-B For the ACL reconstruction, the mouse is placed in the supine position (Fig. 2-A) and the FDL is harvested through 2 small incisions in the hindlimb (Fig. 2-B). Figs. 2-C and 2-D A medial parapatellar arthrotomy is performed to access the knee (Fig. 2-C), and the femoral tunnel is drilled in the center of the footprint with use of a 23-gauge needle (Fig. 2-D). Fig. 2-E Once both the femoral and tibial tunnels are created, the graft is passed from the femoral tunnel into the knee, exiting the tibial tunnel. Fig. 2-F The clip provides suspensory fixation on the femoral side, and transosseous suture fixation is used on the tibial side.

A medial parapatellar arthrotomy was performed (Fig. 2-C), and the patella was subluxated laterally. With the knee in flexion, the femoral tunnel was drilled using a 23-gauge needle (diameter, 0.64 mm) (Fig. 2-D), beginning in the center of the native ACL footprint and exiting the femur laterally, just proximal to the trochlea. The native ACL was cut with a number-11 blade. Soft tissue from the anteromedial surface of the tibia was removed and the tibial tunnel was drilled using a 23-gauge needle, beginning at the anteromedial aspect of the tibia, entering the joint in the footprint of the native ACL.

The graft was passed through the femoral and tibial tunnels using the attached suture (Fig. 2-E). The clip provided extracortical (suspensory) fixation on the femoral side. With the knee extended, the graft was pretensioned using a 50-g weight and fixed to the tibia using a transosseous 4-0 ETHIBOND suture (Ethicon) passed through the anterior crest of the tibia (Fig. 2-F). The arthrotomy site and skin incisions were closed in layers.

For biomechanical assessment, the femur and tibia were independently placed in 2.0-mL tubes of Bondo Lightweight Filler 265 (3M), and all soft-tissue structures other than the ACL were dissected. The surgical clip and suture used for the initial fixation were removed. The specimen was placed into the biomechanical testing device in a position that allowed distraction in line with the axis of the graft (Fig. 3). The specimen was loaded to failure at a rate of 10 mm/min (167 μm/s). Load-to-failure data (N) were recorded, and stiffness (N/mm) was calculated from the load-deformation curves. The site of graft failure (femoral tunnel, midsubstance, or tibial tunnel) was recorded.

Fig. 3.

Fig. 3

Open in a new tab

For biomechanical analysis, specimens are dissected free of all soft tissue other than the ACL, and the tibia and femur are potted in Bondo filler to allow fixation into the testing apparatus.

For microCT analysis, soft tissue from the leg was removed and a Scanco µCT 35 system (Scanco Medical) was used. Imaging was performed with a 15-μm voxel size, at 55 kVp, a 0.36° rotation step (180° angular range), and a 400-ms exposure per view. Scanco μCT software (DECwindows Motif 1.6; Hewlett-Packard) was used for viewing, image analysis, and 3-dimensional reconstruction, by identifying a cylindrical volume of interest with a diameter of 0.64 mm (the same diameter as the needle used to create the tunnels) and a height of 1 mm. The amount of newly formed bone within the tunnel was measured at the aperture, midtunnel, and tunnel exit and was reported as bone volume (BV), total volume (TV), and directly measured bone volume fraction (BV/TV [voxels/mm3]).

For histological analysis, specimens were fixed in 10% formalin for 24 hours, decalcified in Immunocal (Decal Chemical), dehydrated, and embedded in paraffin. Tissues were sectioned in a sagittal plane into 5-µm-thick slices and were stained with hematoxylin and eosin as well as Safranin-O/Fast Green. Images were obtained using a Nikon Eclipse microscope with transmitted light at 4× and 20× magnification.

Sections were stained for tartrate-resistant acid phosphatase (TRAP) to localize osteoclasts. The slides were deparaffinized in xylene, rehydrated, and placed in sodium-acetate buffer (pH, 5.0) for 30 minutes. They were then treated with a prewarmed TRAP staining solution mixture (sodium nitrite, basic fuchsin, sodium-acetate buffer, tartaric acid, naphthol phosphate, and dimethylformamide) and incubated at 37°C for 15 minutes. The sections were counterstained with hematoxylin, dehydrated through graded alcohols, cleared in xylene, and mounted.

For immunohistochemical analysis, the sections were incubated with primary antibodies specific to Indian hedgehog, Gli1, Patched, β-catenin, Wnt3A, Sox-9, and PTHrP for 1 hour at 37°C after endogenous peroxidase activity was quenched with 3% hydrogen peroxide. The specimens were then incubated with a biotinylated secondary antibody for 1 hour. Bovine serum albumin was used as a negative control by replacing the primary antibody. The tissues were developed using a goat avidin-biotin peroxidase system with 3,3′-diaminobenzidine chromogen (DAB; Dako). The sections were examined using light microscopy (Eclipse E800; Nikon). Digital images were made using a SPOT RT camera (Diagnostic Instruments). Table I provides information on the antibodies that were used.

TABLE I.

Antibodies Used to Study the Tendon-Bone Healing Process

Antibody Signaling Pathway Manufacturer Catalog No. Dilution
Indian hedgehog Indian hedgehog Abcam Ab-39634 1:500
Gli1 Indian hedgehog Abcam Ab-151796 1:800
Patched Indian hedgehog Abcam Ab-53715 1:1,000
β-catenin* Wnt Abcam Ab-79089 1:800
Wnt3A Wnt EMD Millipore 09-162 1:500
Sox-9 Sox-9 EMD Millipore AB5535 1:400
PTHrP PTH LifeSpan Biosciences LS-B12325 1:1,000
Open in a new tab
*

The β-catenin antibody binds to both active and nonactive forms.

Photomicrographs taken under 10× magnification were imported into ImageJ analysis software (National Institutes of Health) (Fig. 4). A 760-µm circle was drawn on each image and was centered at the middle of the tunnel (drill-bit diameter, 640 µm) to include both the interface and the adjacent bone. The graft, along with any interposing empty space, was then manually delineated and removed. The area between these 2 delineations, representing the interface and adjacent bone, was cropped to cover DAB-positive areas. The total percentage of DAB-positive area was then calculated.

Fig. 4.

Fig. 4

Open in a new tab

Figs.4-A and 4-B Photomicrographs taken under 10× magnification were imported into ImageJ analysis software. Fig. 4-A Because of variation in the tunnel width and absence of a sharp transition between the interface and the surrounding osseous structure, for each image a 760-µm circle (arrow) was drawn and centered at the middle of the tunnel (drill-bit diameter, 640 µm), to include both the interface and the adjacent bone. The graft, along with the interposing empty space, was then manually delineated and removed (arrowhead). Fig. 4-B The area between these 2 delineations, representing the interface and adjacent bone, was cropped and “thresholded” to cover DAB (3,3′-diaminobenzidine)-positive areas. The total percentage of DAB-positive area was then calculated using ImageJ measurement functionality.

For gene-expression analysis, tissue from the tendon-bone interface inside the tunnels was collected. The tissue was immersed in RNAlater (Thermo Fisher Scientific). Total RNA was isolated using a mirVana miRNA Isolation kit (Ambion). Complementary DNA (cDNA) was generated from 50 ng of total RNA using a QuantiTect Reverse Transcription kit (Qiagen). qRT-PCR was performed on a CFX96 Touch real-time PCR detection system (Bio-Rad) using Maxima SYBR Green/ROX qPCR Master Mix (ThermoFisher Scientific) and 10 mouse-specific primers relevant to tendon healing (Table II). The data were normalized to a housekeeping gene (glyceraldehyde 3-phosphate dehydrogenase [GAPDH]), and the relative expression was analyzed using the delta-delta cycle threshold (ΔΔCt) method, where the fold differences of gene expression were analyzed by 2–ΔΔCt. Temporal changes in gene expression were calculated using the intact FDL tendon as a control.

TABLE II.

Oligonucleotides Used in qRT-PCR

Gene Forward Reverse Accession No.
Aggrecan CCGCTTGCCAGGGGGAGTTG CCTGCAGCCAGCCAGCATCA NM_007424.2
Collagen 1α1 AATGGCACGGCTGTGTGCGA AACGGGTCCCCTTGGGCCTT NM_007742.3
Collagen 3α1 TGACTGTCCCACGTAAGCAC GAGGGCCATAGCTGAACTGA NM_009930.2
GAPDH GGGCTCATGACCACAGTCCATGC CCTTGCCCACAGCCTTGGCA NM_001289726.1
MMP3 TGTGTGCTCATCCTACCCATTGC CCCTGTCATCTCCAACCCGAGGA NM_010809.2
MMP13 ATGGTCCAGGCGATGAAGACCCC GTGCAGGCGCCAGAAGAATCTGT NM_008607.2
MMP14 AACTTCAGCCCCGAAGCCTGG ACAGCGAGGGCGCCTCATGG NM_008608.3
Mohawk ACGCTAGTGCAGGTGTCAAA AGCGTTGCCCTGAACATACT NM_177595.4
Scleraxis CCTCAGCAACCAGAGAAAGTTGAGCA GCCATCACCCGCCTGTCCATC NM_198885.3
Sox-9 AAGCTCTGGAGGCTGCTGAACGAG CGGCCTCCGCTTGTCCGTTCT NM_011448.4
Tenomodulin ATGAGCAATGGGTGGTCCCGC ACAGACACGGCGGCAGTAACG NM_022322.2
Open in a new tab

For statistical analysis, 1-way analysis of variance testing was used to compare mean differences across groups (native-ACL group and Groups 2 and 3). Mean differences are reported with 95% confidence intervals (CIs). Post-hoc pairwise comparisons were performed using a Tukey test, and significance was set at p < 0.05.

Results

All animals underwent ACL reconstruction without complication and resumed normal cage activity. They all survived until their scheduled sacrifice date without complication.

Biomechanical analysis showed that the mean failure force and standard deviation of the native, intact ACL was 5.60 ± 0.75 N and the stiffness was 3.44 ± 1.47 N/mm ( Fig. 5). All 7 native ligaments failed in the midsubstance. For Group 2 (2 weeks), the mean failure force and stiffness were 1.29 ± 0.47 N and 1.72 ± 0.75 N/mm, respectively. Five of the 7 failed at the tibial tunnel, 1 failed at the femoral tunnel, and 1 failed in the graft midsubstance. In Group 3 (4 weeks), the mean failure force and stiffness were 1.79 ± 0.40 N and 2.59 ± 0.87 N/mm, respectively. Three of the 7 failures occurred at the femoral tunnel, 3 occurred at the tibial tunnel, and 1 occurred in the midsubstance. While failure force differed significantly across the 3 groups (p < 0.001), stiffness did not (p = 0.241). Post-hoc Tukey testing revealed significant differences in failure force between the intact-ACL group and Group 2 (mean difference, 4.31 N; 95% CI, 3.55 to 5.08 N; p < 0.001) and between the intact-ACL group and Group 3 (mean difference, 3.81 N; 95% CI, 3.06 to 4.58 N; p < 0.001) but not between Groups 2 and 3 (mean difference, 0.50 N; 95% CI, −0.265 to 1.265 N; p = 0.244).

Fig. 5.

Fig. 5

Open in a new tab

Bar graphs showing mean ultimate force to failure (Fig. 5-A) and stiffness (Fig. 5-B) for all groups. An asterisk indicates a significant difference (p < 0.05), and the error bars indicate the standard deviation.

MicroCT analysis showed new bone formation at the tendon-bone interface along the bone tunnel. The parameters of the newly formed bone in the tunnels are summarized in Figure 6. Although the amount of bone was greater for most measures in Group 3, these differences did not reach significance (p > 0.05 for all).

Fig. 6.

Fig. 6

Open in a new tab

Fig. 6-A and 6-B Two-dimensional and reconstructed 3-dimensional microCT images following ACL reconstruction. The yellow circle has a diameter of 0.64 mm (the same diameter as the needle that is used to drill the tunnel) and indicates the region of interest (ROI). The amount of new bone formed within this ROI was quantified at the aperture, midportion, and exit of each tunnel. Fig. 6-C Mean bone volume fraction formed within the tunnels at the time of animal sacrifice for each of the study groups. TV = total volume, BV = bone volume, and BV/TV = bone volume fraction. The horizontal line is the median, the box represents the first quartile and third quartile, and the bars represent the minimum and maximum.

Histological analysis showed that healing occurred by formation of fibrovascular tissue between the tendon and bone. There were occasional chondrocytes at the healing interface, but a regular fibrocartilaginous enthesis was not seen (Fig. 7 [Link to hematoxylin and eosin as well as safranin O-stained whole slide images]). There was progressive maturation of this fibrovascular interface tissue. TRAP histochemical staining demonstrated osteoclasts along the tendon-bone interface. The number of positively stained osteoclasts was highest at 1 week and declined over time.

Fig. 7.

Fig. 7

Open in a new tab

Fig. 7-A Safranin-O staining showing the hypercellularity of the interface tissue at 2 weeks (A and A′ [inset]) and progressive graft healing by 4 weeks. Scale bar = 100μm. Fig. 7-B Decreased cellularity and the appearance of chondrocyte-like cells proliferating within the tendon at 4 weeks (B and B′ [inset]). Scale bar = 100μm. (Link to hematoxylin and eosin as well as safranin O-stained whole slide images.) Fig. 7-C A histological section of the native murine ACL insertion site (10×), shown for comparison, demonstrates a well-organized fibrocartilage interface with columnar organization of the chondrocytes. Fig. 7-D Hematoxylin and eosin and safranin-O staining (D and D′ [inset]) showing an ACL reconstruction with a graft in both the femoral and tibial tunnels at 4 weeks post-surgery.

Immunohistochemical analysis showed that there was positive expression of mediators in the Indian hedgehog, Wnt, and PTHrP pathways in both the native insertion site and the healing tissues. Positive staining was seen in fibrochondrocytes at the native insertion site and was generally weaker than the staining in the repaired tissues (Fig. 8). We found positive localization of signaling proteins that are part of the Wnt, Indian hedgehog, and PTHrP pathways in cells in the healing graft-bone interface. The number of positively staining cells was generally similar at each time point among most markers (Fig. 9).

Fig. 8.

Fig. 8

Open in a new tab

Representative sagittal histological sections of the native ACL insertion site showing immunohistochemical staining for Wnt, β-catenin, Gli1, PTHrP, Patched, and Indian hedgehog (Ihh). F = femur, and T = tibia.

Fig. 9.

Fig. 9

Open in a new tab

Representative axial histological sections of graft, interface, and surrounding bone showing immunohistochemical staining for Wnt, β-catenin, Indian hedgehog (Ihh), Gli1, Sox-9, PTHrP, Patched, and TRAP, at the 1, 2, and 4-week time points. Graphs next to each row plot the percentage of DAB (3,3′-diaminobenzidine)-positive area at each time point. For TRAP, the number of positively stained osteoclasts was highest at 1 week and declined over time (10× magnification, specific antibody staining with use of DAB as a chromogen and hematoxylin as a counterstain). I-bars indicate the standard deviation.

qRT-PCR analysis revealed no change in expression of the transcription factors scleraxis and Sox-9 compared with the time-0 control tendon. We found that matrix metalloproteinases (MMPs) 3 and 13 were transiently upregulated on postoperative days 7 and 14, respectively, and declined thereafter (Fig. 10). MMP14 expression increased by postoperative day 14 (p = 0.137) and remained elevated on day 28. There was a trend toward increased expression of collagen type 1α1 (COL1) over time (p > 0.05) and significantly increased aggrecan (ACAN) (p = 0.020) (Fig. 10).

Fig. 10.

Fig. 10

Open in a new tab

qRT-PCR analysis of scleraxis (SCX), Mohawk (MKX), tenomodulin (TNM), COL3, COL1, Sox-9, aggrecan (ACAN), MMP3, MMP13, and MMP14 gene expression at the bone-tunnel interface following ACL reconstruction, using the native FDL as the control. An asterisk indicates a significant difference (p < 0.05). I-bars indicate the standard deviation.

Discussion

Our hypothesis that signaling molecules that direct enthesis formation during embryogenesis would not be expressed at the healing tendon-bone interface was not supported, as we found expression of mediators in the Indian hedgehog, Wnt, and PTHrP pathways in the healing tissues. We found that healing proceeds by formation of a fibrovascular scar-tissue interface between the tendon graft and bone, similar to published findings in larger animal models where the normal enthesis microstructure is not reformed. Our microCT findings suggest that graft incorporation occurs by infiltration of new bone into the outer tendon, consistent with findings in prior animal studies. Osteoclast accumulation with subsequent bone resorption is consistent with the phenomenon of tunnel-widening that is seen in humans. These findings demonstrate that expression of signaling molecules that direct enthesis formation during prenatal and early postnatal development is not sufficient to direct reformation of the complex microstructure and composition of the native attachment site.

The graft failure force reached approximately one-third of the native ACL failure load at 4 weeks, similar to findings in prior animal models11,12. The majority of graft failures occurred at 1 of the tunnels, in contrast to the native ACL, where failure occurs in the midsubstance. These findings verify that the healing tendon-bone interface represents the weakest link in the healing process11,15,21-25.

The signaling molecules that we examined are known to play a fundamental role during insertion-site development in embryogenesis. Our findings are consistent with prior work in our laboratory, where we reported Indian hedgehog immunostaining at the healing tendon-bone interface in a rat ACL-reconstruction model and a rat rotator cuff-repair model26,27. Our data indicate that factors other than these signaling molecules are required for formation of the complex microstructure and composition of the enthesis, and the data support the prevailing concept that recapitulation of developmental events in the animal in the postnatal period is difficult.

The failure to reform a native insertion site is likely due to one of several factors. First, it is not known which temporal pattern, spatial pattern, and magnitude of expression of these signaling molecules are necessary to direct insertion-site formation. We found no change in gene expression of the transcription factors scleraxis (tendon-specific) and Sox-9 (cartilage-specific), although our study was likely underpowered to find a difference. These factors are known to play a fundamental role in insertion-site formation in the developing embryo18.

Second, we hypothesize that there is an absence or insufficiency of appropriate responding cells present at the healing site. A progenitor cell population is necessary for tissue regeneration. There are likely important differences in the phenotype and function of cells present in the animal in the postnatal period compared with the cells present during embryogenesis.

A third factor that may play a role in the failure of insertion-site formation is the local mechanical environment during healing. Mechanical loads have a profound effect on the biologic events of tissue formation and remodeling. The important role of mechanical loading is illustrated by studies showing abnormal insertion-site formation in animals where the developing limb was paralyzed with botulinum toxin in the immediate postnatal period28. It is likely that the mechanical forces acting on cells in the bone tunnel differ from those present during embryonic development.

A final factor that may account for the failure of insertion-site formation is the role of inflammation postoperatively in the animal in the postnatal period. The presence of cell populations and inflammatory mediators associated with the inflammatory process may well have a profound effect on tissue regeneration. Wounds heal by tissue regeneration in the developing embryo prior to the development of a functional immune system and the associated inflammatory response rather than by the typical scar formation that is seen in the animal in the postnatal period. The presence of inflammation in our animal model likely has a considerable effect on the function of these signaling molecules.

The major limitation of this work is the small size of the murine knee and the unknown translation of quadruped models to humans. The procedure requires development of microsurgical skills and has a substantial learning curve. We recommend extensive cadaveric practice sessions and quantitative biomechanical evaluation of the ability to achieve graft isometry and secure graft fixation before studying live animals. The small number of specimens analyzed with PCR and the large variability across samples limits our ability to make firm conclusions about gene expression.

In conclusion, we have developed a reproducible and realistic murine model of ACL reconstruction that simulates techniques used in human ACL reconstruction. Despite expression of several signaling molecules that direct embryologic insertion-site formation, the spatial and temporal pattern of expression was not adequate to restore the structure and composition of the native insertion site. This clinically realistic murine model of ACL reconstruction will allow for eventual use of genetically modified animals to study the role of specific molecular pathways in healing in order to identify interventions that improve healing in our patients16,18,29.

Acknowledgments

Note: The authors thank Guang-Ting Cong and Andre Carbone, MD, Liang Ying for assistance with the surgical model and the histology, biomechanical testing, microCT, qPCR, and histological analysis required for this work.

Footnotes

Investigation performed at the Hospital for Special Surgery, New York, NY

Disclosure: This work was supported in part by a grant from the National Institutes of Health. The Disclosure of Potential Conflicts of Interest forms are provided with the online version of the article (http://links.lww.com/JBJS/E871).

References

  • 1.Grana WA, Egle DM, Mahnken R, Goodhart CW. An analysis of autograft fixation after anterior cruciate ligament reconstruction in a rabbit model. Am J Sports Med. 1994. May-Jun;22(3):344-51. [DOI] [PubMed] [Google Scholar]
  • 2.Rodeo SA, Arnoczky SP, Torzilli PA, Hidaka C, Warren RF. Tendon-healing in a bone tunnel. A biomechanical and histological study in the dog. J Bone Joint Surg Am. 1993. December;75(12):1795-803. [DOI] [PubMed] [Google Scholar]
  • 3.Thomopoulos S, Williams GR, Gimbel JA, Favata M, Soslowsky LJ. Variation of biomechanical, structural, and compositional properties along the tendon to bone insertion site. J Orthop Res. 2003. May;21(3):413-9. [DOI] [PubMed] [Google Scholar]
  • 4.Cooper RR, Misol S. Tendon and ligament insertion. A light and electron microscopic study. J Bone Joint Surg Am. 1970. January;52(1):1-20. [PubMed] [Google Scholar]
  • 5.Whiston TB, Walmsley R. Some observations on the reactions of bone and tendon after tunnelling of bone and insertion of tendon. J Bone Joint Surg Br. 1960. May;42-B:377-86. [DOI] [PubMed] [Google Scholar]
  • 6.Panni AS, Milano G, Lucania L, Fabbriciani C. Graft healing after anterior cruciate ligament reconstruction in rabbits. Clin Orthop Relat Res. 1997. October;343:203-12. [PubMed] [Google Scholar]
  • 7.Aga C, Wilson KJ, Johansen S, Dornan G, La Prade RF, Engebretsen L. Tunnel widening in single- versus double-bundle anterior cruciate ligament reconstructed knees. Knee Surg Sports Traumatol Arthrosc. 2017. April;25(4):1316-27. Epub 2016 Jun 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Biswal UK, Balaji G, Nema S, Poduval M, Menon J, Patro DK. Correlation of tunnel widening and tunnel positioning with short-term functional outcomes in single-bundle anterior cruciate ligament reconstruction using patellar tendon versus hamstring graft: a prospective study. Eur J Orthop Surg Traumatol. 2016. August;26(6):647-55. Epub 2016 Jul 4. [DOI] [PubMed] [Google Scholar]
  • 9.Brophy RH, Kovacevic D, Imhauser CW, Stasiak M, Bedi A, Fox AJ, Deng XH, Rodeo SA. Effect of short-duration low-magnitude cyclic loading versus immobilization on tendon-bone healing after ACL reconstruction in a rat model. J Bone Joint Surg Am. 2011. February 16;93(4):381-93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gimbel JA, Van Kleunen JP, Williams GR, Thomopoulos S, Soslowsky LJ. Long durations of immobilization in the rat result in enhanced mechanical properties of the healing supraspinatus tendon insertion site. J Biomech Eng. 2007. June;129(3):400-4. [DOI] [PubMed] [Google Scholar]
  • 11.Hettrich CM, Gasinu S, Beamer BS, Stasiak M, Fox A, Birmingham P, Ying O, Deng XH, Rodeo SA. The effect of mechanical load on tendon-to-bone healing in a rat model. Am J Sports Med. 2014. May;42(5):1233-41. Epub 2014 Apr 1. [DOI] [PubMed] [Google Scholar]
  • 12.Packer JD, Bedi A, Fox AJ, Gasinu S, Imhauser CW, Stasiak M, Deng XH, Rodeo SA. Effect of immediate and delayed high-strain loading on tendon-to-bone healing after anterior cruciate ligament reconstruction. J Bone Joint Surg Am. 2014. May 7;96(9):770-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bedi A, Fox AJS, Kovacevic D, Deng XH, Warren RF, Rodeo SA. Doxycycline-mediated inhibition of matrix metalloproteinases improves healing after rotator cuff repair. Am J Sports Med. 2010. February;38(2):308-17. Epub 2009 Oct 13. [DOI] [PubMed] [Google Scholar]
  • 14.Thomopoulos S, Williams GR, Soslowsky LJ. Tendon to bone healing: differences in biomechanical, structural, and compositional properties due to a range of activity levels. J Biomech Eng. 2003. February;125(1):106-13. [DOI] [PubMed] [Google Scholar]
  • 15.Bedi A, Kovacevic D, Fox AJS, Imhauser CW, Stasiak M, Packer J, Brophy RH, Deng XH, Rodeo SA. Effect of early and delayed mechanical loading on tendon-to-bone healing after anterior cruciate ligament reconstruction. J Bone Joint Surg Am. 2010. October 20;92(14):2387-401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zelzer E, Blitz E, Killian ML, Thomopoulos S. Tendon-to-bone attachment: from development to maturity. Birth Defects Res C Embryo Today. 2014. March;102(1):101-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu H, Zhu S, Zhang C, Lu P, Hu J, Yin Z, Ma Y, Chen X, OuYang H. Crucial transcription factors in tendon development and differentiation: their potential for tendon regeneration. Cell Tissue Res. 2014. May;356(2):287-98. Epub 2014 Apr 8. [DOI] [PubMed] [Google Scholar]
  • 18.Schweitzer R, Chyung JH, Murtaugh LC, Brent AE, Rosen V, Olson EN, Lassar A, Tabin CJ. Analysis of the tendon cell fate using scleraxis, a specific marker for tendons and ligaments. Development. 2001. October;128(19):3855-66. [DOI] [PubMed] [Google Scholar]
  • 19.Blitz E, Sharir A, Akiyama H, Zelzer E. Tendon-bone attachment unit is formed modularly by a distinct pool of Scx- and Sox9-positive progenitors. Development. 2013. July;140(13):2680-90. Epub 2013 May 29. [DOI] [PubMed] [Google Scholar]
  • 20.Sugimoto Y, Takimoto A, Akiyama H, Kist R, Scherer G, Nakamura T, Hiraki Y, Shukunami C. Scx+/Sox9+ progenitors contribute to the establishment of the junction between cartilage and tendon/ligament. Development. 2013. June;140(11):2280-8. Epub 2013 Apr 24. [DOI] [PubMed] [Google Scholar]
  • 21.Rodeo SA, Voigt C, Ma R, Solic J, Stasiak M, Ju X, El-Amin S, Deng XH. Use of a new model allowing controlled uniaxial loading to evaluate tendon healing in a bone tunnel. J Orthop Res. 2016. May;34(5):852-9. Epub 2015 Nov 25. [DOI] [PubMed] [Google Scholar]
  • 22.Bowers AL, Bedi A, Lipman JD, Potter HG, Rodeo SA, Pearle AD, Warren RF, Altchek DW. Comparison of anterior cruciate ligament tunnel position and graft obliquity with transtibial and anteromedial portal femoral tunnel reaming techniques using high-resolution magnetic resonance imaging. Arthroscopy. 2011. November;27(11):1511-22. Epub 2011 Oct 1. [DOI] [PubMed] [Google Scholar]
  • 23.Hamner DL, Brown CH, Jr, Steiner ME, Hecker AT, Hayes WC. Hamstring tendon grafts for reconstruction of the anterior cruciate ligament: biomechanical evaluation of the use of multiple strands and tensioning techniques. J Bone Joint Surg Am. 1999. April;81(4):549-57. [DOI] [PubMed] [Google Scholar]
  • 24.Salzler MJ, Harner CD. Tunnel placement for the ACL during reconstructive surgery of the knee: acritical analysis review. JBJS Rev. 2014. April 15;2(4):1-10. [DOI] [PubMed] [Google Scholar]
  • 25.Osti M, Krawinkel A, Ostermann M, Hoffelner T, Benedetto KP. Femoral and tibial graft tunnel parameters after transtibial, anteromedial portal, and outside-in single-bundle anterior cruciate ligament reconstruction. Am J Sports Med. 2015. September;43(9):2250-8. Epub 2015 Jul 2. [DOI] [PubMed] [Google Scholar]
  • 26.Zong JC, Mosca MJ, Degen RM, Lebaschi A, Carballo C, Carbone A, Cong GT, Ying L, Deng XH, Rodeo SA. Involvement of Indian hedgehog signaling in mesenchymal stem cell-augmented rotator cuff tendon repair in an athymic rat model. J Shoulder Elbow Surg. 2017. April;26(4):580-8. Epub 2016 Nov 22. [DOI] [PubMed] [Google Scholar]
  • 27.Carbone A, Carballo C, Ma R, Wang H, Deng X, Dahia C, Rodeo S. Indian hedgehog signaling and the role of graft tension in tendon-to-bone healing: evaluation in a rat ACL reconstruction model. J Orthop Res. 2016. April;34(4):641-9. Epub 2015 Nov 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kim HM, Galatz LM, Patel N, Das R, Thomopoulos S. Recovery potential after postnatal shoulder paralysis. An animal model of neonatal brachial plexus palsy. J Bone Joint Surg Am. 2009. April;91(4):879-91. [DOI] [PubMed] [Google Scholar]
  • 29.Liu CF, Breidenbach A, Aschbacher-Smith L, Butler D, Wylie C. A role for hedgehog signaling in the differentiation of the insertion site of the patellar tendon in the mouse. PLoS One. 2013. June 10;8(6):e65411. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Bone and Joint Surgery. American Volume are provided here courtesy of Wolters Kluwer Health

RESOURCES