Skip to main content
Helminthologia logoLink to Helminthologia
. 2018 Oct 27;55(4):334–342. doi: 10.2478/helm-2018-0034

Morphological and Molecular Characterization of Haplorchoides Mehrai Pande and Shukla 1976 (Digenea: Heterophyidae) from Chiang Mai Province

K Apiwong 1, CH Wongsawad 1,2,3,*, P Butboonchoo 1
PMCID: PMC6662004  PMID: 31662664

Summary

Cyprinoid fish in Chiang Mai province has been reported the presence of a large number of metacercariae, particularly the metacercariae of Haplorchoides and those not identified to species. This study aims to investigate morphological and molecular characteristic of the minute intestinal fluke H. mehrai metacercariae in two cyprinoid fish species from Chom Thong district, Chiang Mai province, Thailand: the Tinfoil barb (Barbonymus schwanenfeldii) and the White eye barb (Cyclocheilichthys repasson). A total of 180 fish (90 from B. schwanenfeldii and 90 from C. repasson) were collected over three seasons: cool, hot and the rainy season (December 2015 to August 2016). Fish were examined for H. mehrai metacercariae infection, including areas such as muscle and the inner side of body scales, by using a light microscope. The prevalence of H. mehrai metacercariae in B. schwanenfeldii and C. repasson was 73.33 % and 100 % respectively. Haplorchoides metacercariae were identified as H. mehrai based on the morphological characteristics; the position of the acetabulum and the number and arrangement of the acetabular spines. Phylogenetic analysis based on Cytochrome c Oxidase subunit I (COI) gene showed that H. mehrai metacercariae from B. schwanenfeldii and C. repasson were the same species as the adult stage of H. mehrai from Hemibagrus nemurus and Mystus multiradiatus. Both morphological and molecular characteristic could indicate that Haplorchoides metacercariae originated from this study were H. mehrai. Furthermore, it is a new record of the minute intestinal fluke Haplorchoides mehrai in Chiang Mai Province.

Keywords: Haplorchoides mehrai, Barbonymus schwanenfeldii, Cyclocheilichthys repasson, Metacercariae, COI, Chiang Mai province

Introduction

Haplorchoides mehrai is a minute intestinal fluke, first described by Pande and Shukla (1976). The Haplorchoides genus belongs to the subfamily Haplorchiinae, family Heterophyidae (Chen, 1949; Pearson & Ow Yang, 1982; Yamaguti, 1958). Freshwater fish, particularly cyprinoid fish served as the second intermediate host of H. mehrai metacercaria (Scholz et al., 1991; Manpratum et al., 2017). The adult stage of H. mehrai have been first recorded in the small intestines of Mystus vittatus from India (Pande & Shukla, 1976). Some previous studies, H. mehrai, adult stages have been reported from Yellow catfish, Hemibagrus nemurus in Khon Kaen Province, Northeast Thailand (Manpratum et al., 2017). In the Northern Thailand, the high prevalence of Haplorcoides spp. metacercariae in cyprinoid fish have been recorded in Phitsanulok (Noikong et al., 2011) and Chiang Mai province (Saenphet et al., 2001; Nithikathkul & Wongsawad, 2008). Moreover, the adult stage of Haplorchoides spp. have been reported to infect the Yellow catfish, H. nemurus in Chiang Mai (Wongsawad et al., 2004) and Chiang Rai province (Purivirojkul & Areechon, 2008). The Ping River is an important river in Chiang Mai province, containing many aquatic animals, particularly cyprinoid fish which act as the second intermediate hosts for Haplorchoides spp. The Ping river flows through the Chom Thong district, Chai Mai province an area that supports a large amount of agriculture and many fisheries. Kumchoo et al. (2005) recorded that cyprinoid fish, Barbonymus schwanenfeldii and Cyclocheilichthys repasson were infected with Haplochoides sp. metacercaria in Chom Thong district.

Mitochondrial DNA based Polymerase Chain Reaction (PCR) methods have been effective for identification and studying the phylogenetics of trematodes in the family Heterophyidae (Chontananarth et al., 2014). A COI primer was used in the differentiation of COI fragments from Heterophyidae (Haplorchis taichui) with fragments from Opisthorchiidae (Opisthorchis viverrini) by Thaenkham et al. (2007). The COI gene is useful for assessing the genetic variation in H. taichui (Dung et al., 2013).

This study aimed to examine the prevalence of Haplorchoides mehrai metacercariae in B. schwanenfeldii and C. repasson from Chom Thong district, Chiang Mai province, Thailand. A phylogeny based on the COI gene of H. mehrai and other heterophyid trematodes was also reconstructed. This data provides useful information for the control and prevention of H. mehrai infection in Chiang Mai province and for Thailand in general.

Materials and Methods

Parasite specimens

A total of 180 fish (90 from B. schwanenfeldii and 90 from C. repasson) were collected in the same river area (N18.403918, E98.702038) from Chom Thong district, Chiang Mai province, Thailand. Fish were collected over 3 seasons: cool (n = 30), hot (n = 30) and the rainy season (n = 30), from December 2015 to August 2016. Fish were transferred to the laboratory at the Department of Biology, Faculty of Science, Chiang Mai University. Standard length (cm) and weight (g) of the fish were recorded. The fish were individually examined, which included an examination of their body scales (30 scales per fish) and meat (2g). The scales were directly examined for metacercariae under light microscope. The fish meat was ground by blender, then mixed with pineapple juice and incubated at 37 °C for 1 – 2 hours. The processed meat was filtrated with graded sieves to remove large particles, rinsed twice with water and examined under light microscope.

Adults of Haplorchoides mehrai were collected from Yellow catfish (Hemibagrus nemurus), Asian redtail catfish (Hemibagrus wyckioides) and Iridescent mystus (Mystus multiradiatus).

For the species identification, encysted and excysted metacercariae and adults of Haplorchoides mehrai were fixed and flattened in 4 % formalin for preparation of permanent slides. The trematodes were stained with Delafield’ hematoxylin, then dehydrated in alcohol series, cleared in xylene and permanently mounted in permount. Specimens on permanent slides were illustrated using a compound microscope with a drawing tube. Measurements were obtained using an ocular micrometer and expressed in micrometers (μm). The identification was based on morphology according to Pande and Shukla (1976) and Shameem and Madhavi (1988). The prevalence of infection was calculated based on the equation of Margolis et al. (1982).

Genomic DNA extraction

Genomic DNA of all parasites was extracted from both adults and metacercariae based on the Chelex method used by Caron et al. (2010). The genomic DNA of the flukes was stored at -20 °C until used.

COI PCR

The PCR amplification of Cytochrome c Oxidase subunit I (COI) was followed the methods described in Chontananarth et al. (2014). It consists of a pair of primers: forward primer (JB3) 5’ TTTTTTGGGCATCCTGACGTTTAT 3’ and reverse primer (JB 4,5) 5’ TAAAGAAAGAACATAATGAAAATG 3’. The final volume of 20 μl PCR product mixture consisted of 1.0 μl genomic DNA, 2.0 μl PCR buffer, 2.0 μl (10 mM) of dNTPs, 0.7 μl (50mM) of MgCl 2, 1 μl of primer and 0.3 μl of Taq polymerase. PCR amplification followed an initial denaturation of 3 min at 95 °C, followed by 40 cycles, which consisted of denaturation for 1 min at 95 °C, 1 min of annealing at 50 °C, 1 min of elongation at 72 °C and a final elongation step for 7 minutes at 72 °C. The COI PCR product was checked using DNA Dye Non Tox (AappliChem) staining and separated on 1.4 % TBE agarose gel electrophoresis. All COI PCR products were subjected for purify and sequencing.

Phylogenetic tree construction

Phylogenetic trees were constructed using the program Mega version 6.06, and molecular data were analyzed using Maximum likelihood (ML) and Neighbor joining (NJ) methods. The reliability of internal branches in both methods was estimated using 1000 bootstrap replications. Sequences of the fluke Fasciola gigantica (Fasicolidae) were used as an outgroup for phylogenetic analysis.

Ethical Approval and/or Informed Consent

There are no the use of animal for experimentation but use only for surveyed research. We have animal use license number of U1-07209-2560 that issued by the Institute of Animal for Scientific Purpose Development (IAD), Thailand. However, this research related to animals use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

Results

Prevalence of infection

The results revealed that the prevalence of H. mehrai metacercaria infection (Table 1) in Barbonymus schwanenfeldii was 86.7 % in the cool, followed by 70 % in the hot and 63.3 % in the rainy season (Fig. 1). The average prevalence and intensity across all three seasons was 73.3 % (66/90) and 14.86 respectively. Prevalence in Cyclocheilichthys repasson was 100 % for all three seasons (90/90) (Fig. 1) with an intensity of 129.85. The metacercariae of H. mehrai were recovered from the inner side of body scales and the general muscular tissue of B. schwanenfeldii and C. repasson. Body scales and fish meat of B. schwanenfeldii respectively contained 17.21 % and 10 % of all metacercariae found, whereas the body scales and fish meat of C. repasson contained 43.39 % and 16.66 % of all metacercariae respectively.

Table 1.

Prevalence of Haplorchoides mehrai metacercariae in Cyprinoid fish from Chiang Mai province.

Cyprinoid fish No. of examined fish No. of infected fish Prevalence Intensity
Barbonymus schwanenfeldii 90 66 73.33 14.86
Cyclocheilichthys repasson 90 90 100 129.85

Fig. 1.

Fig. 1

Prevalence of Haplorchoides mehrai metacercaria during 3 seasons.

Morphological analysis

Metacercariae of Haplorchoides mehrai from Barbonymus schwanenfeldii and Cyclocheilichthys repasson

Encysted metacercariae of H. mehrai from B. schwanenfeldii (Fig. 2) and C. repasson (Fig. 3) are nearly spherical, with a double layered cystic wall. Both excysted metacercariae of H. mehrai from B. schwanenfeldii (Fig. 2c, 2d) and C. repasson (Fig. 3c, 3d) have lance-shaped bodies, with a scale like spine on the body surface. Oral sucker subterminal. Prepharynx longer than esophagus. Caeca extends slightly beyond posterior border of testes. Acetabulum submedian, located near intestinal bifurcation. Acetabulum with spines present in three groups. Testes rounded, median, located between the caecal ends and posterior body. Ovary spherical, pre-testicular, median. Excretory bladder saccular, post-testicular. The measurements of the excysted metacercariae were shown in Table 2.

Fig. 2.

Fig. 2

Encysted metacercariae of H. mehrai from B. schwanenfeldii (a) Acetabular spine (b). Excysted metacercariae stained Delafield’ hematoxylin (c,d).

Fig. 3.

Fig. 3

Encysted metacercariae of H. mehrai from C. repasson (a) Acetabular spine (b). Excysted metacercariae stained Delafield’ hematoxylin (c,d)

Table 2.

Comparing the Organs size (in μm) of H. mehrai excysted metacercariae from B. schwanenfeldii and C. repasson.

Organs Previous study This study
H. mehrai (Pande and H. mehrai H. mehrai
Shukla, 1976) from B. schwanenfeldii from C. repasson
Body length 225 – 565 499.6 (355 – 630) 494.4 (390 – 620)
Body width 90 – 180 120.3 (90 – 160) 130.3 (110 – 160)
Number of acetabular spines 15 – 32 19 – 27 19 – 27
Anterior group 5 – 14 5 – 7 5 – 7
Median group 5 – 9 7 – 10 7 – 10
Posterior group 5 – 9 7 – 10 7 – 10
Oral sucker length 25 – 50 41.6 (32.0 – 49.4) 41.3 (32.5 – 52.0)
Oral sucker width 32 – 54 46.6 ( 39.0 – 54.6) 48.3 ( 41.0 – 59.8)
Acetabulum length 18 – 40 27.9 (20.8 – 36.4) 27.8 (20.8 – 38.8)
Acetabulum width 14 – 40 27.4 (20.8 – 34.0) 27.1 (20.8 – 36.4)
Prepharynx length 14 – 94 139.8 (70.2 – 187.2) 136.6 (78.0 – 195.0)
Pharynx length 25 – 47 34.5 (23.4 – 44.2) 31.2 (25.0 – 44.2)
Pharynx width 14 – 36 31.5 (20.9 – 44.2) 30.6 (25.0 – 43.2)
Esophagus length 11 – 58 44.2 (23.4 – 78.0) 40.5 (23.4 – 65.0)
Ovary length 11 – 47 27.7 (20.8 – 36.4) 26.8 (15.6 – 36.4)
Ovary width 18 – 47 28.2 (20.8 – 39.0) 28.2 (18.2 – 39.0)
Testis length 29 – 58 46.1 (26.0 – 67.6) 44.0 (28.6 – 62.4)
Testis width 29 – 90 51.1 (33.8 – 70.2) 47.9 (28.6 – 62.4)

( ) = average value

Adult of Haplorchoides mehrai from Hemibagrus nemurus and Mystus multiradiatus

H. mehrai from H. nemurus (Fig. 4a, 4b) and M. multiradiatus (Fig. 4c, 4d) have a small body size. Body is lance-shaped. The body tegument has a scale like spine. Oral sucker subterminal. Prepharynx longer than esophagus. Caeca extend slightly beyond posterior border of testes. Acetabulum small, submedian, located near intestinal bifurcation. Acetabulum with spines in three groups. Seminal vesicle with two-chambers, behind intestinal bifurcation. Testes rounded, median, between caecal ends posterior to the body. Ovary spherical, pretesticular. Seminal receptacle pretesticular, lateral of ovary. Vitelline follicles around testes. Eggs small, numerous, operculate, with fully embryonated. The measurements of adult stages were shown in Table 3.

Fig. 4.

Fig. 4

Adult of H. mehrai from H. nemurus (a,b) and adult of H. mehrai from M. multiradiatus (c,d).

Table 3.

Comparing the organs size (in μm) of adult H. mehrai from H. nemurus and M. multiradiatus.

Organs Previous study This study
H. mehrai (Pande and Shukla, 1976) H. mehrai (Shameen and Madhavi, 1988) H. mehrai from H. nemurus H. mehrai from M. multiradiatus
Body length 255 – 720 928 – 1360 1,243.8 (830 – 1,975) 1,285 (910 – 1,625)
Body width 75 – 390 384 – 512 319 (250 – 470) 327.0 (230 – 450)
Number of acetabular spines 15 – 32 18 – 26 19 – 27 19 – 27
Anterior group 5 – 14 6 – 10 5 – 7 5 – 7
Median group 5 – 9 6 – 8 7 – 10 7 – 10
Posterior group 5 – 9 6 – 8 7 – 10 7 – 10
Oral sucker length 25 – 54 72 – 80 49.7 (33.8 – 67.6) 49.6 (31.2 – 65.0)
Oral sucker width 36 – 65 80 – 96 59.6 (44.2 – 72.0) 56.8 (41.6 – 70.2)
Acetabulum length 19 – 65 48 – 56 36.3 (27.0 – 46.8) 38.3 (31.2 – 47.0)
Acetabulum width 17 – 40 56 – 80 37.1 (27.0 – 42.6) 40.3 (26.0 – 52.0)
Prepharynx length 11 – 65 80 – 96 236.4 (91 – 350) 252.1 (122.2 – 400)
Pharynx length 14 – 54 52 – 56 42.6 (31.2 – 52.0) 46.8 (36.4 – 57.2)
Pharynx width 14 – 40 46 – 48 42.8 (28.6 – 59.8) 43.0 (31.2 – 56.9)
Esophagus length 108 ? 69.2 (27.0 – 117.0) 54.9 (13.0 – 132.6)
Seminal vesicle 1 length 36 – 79 96 – 128 74.7 (31.2 – 119.6) 83.7 (41.6 – 113.0)
Seminal vesicle 1width 29 – 90 80 – 112 50.8 (28.6 – 80.6) 60.0 (31.2 – 91.0)
Seminal vesicle 2 length 29 – 72 64 – 88 88.4 (52.0 – 153.4) 90.1 (57.2 – 140.4)
Seminal vesicle 2 width 25 – 79 48 – 56 61.5 (20.8 – 140.2) 73.7 (31.2 – 127.4)
Seminal receptacle length 32 – 72 92 – 112 87.0 (46.8 – 128.2) 98.1 (59.8 – 132.6)
Seminal receptacle width 25 – 72 90 – 110 71.7 (44.2 – 120.5) 84.9 (46.8 – 148.2)
Ovary length 25 – 76 96 – 112 93.9 (52 – 135.2) 101.4 (75.4 – 130.0)
Ovary width 36 – 90 96 – 128 103.8 (49.4 – 140.4) 105.5 (62.4 – 135.2)
Testis length 72 – 126 250 – 264 202.5 (124.8 – 280) 207.8(111.8 – 265)
Testis width 65 – 252 248 – 304 201.1 (130.0 – 270) 206.7 (101.4 – 266)
Egg length 30.6 – 37.7 36 – 38 28.0 (25.0 – 31.2) 28.1 (25.0 – 31.2)
Egg width 17 – 21.4 20 17.7 (15.0 – 19.5) 17.7 (15.0 – 19.5)

( ) = average value

Molecular analysis

Our COI sequence data revealed the partial size of 396 bp. in all specimens. Phylogenetic trees were constructed using the Neighbor joining method and the Maximum likelihood method (Fig 5). Bootstrap values were computed independently for 1000 replications. Both methods revealed the monophyletic group of Haplorchoides which separated from related group (Haplorchis and Metagonimus). In Haplorchoides group, Haplorchoides metacercariae originated from B. schwanenfeldii and C. repasson were clustered with the H. mehrai from Hemibagrus nemurus, H. wyckioides and Mystus multiradiatus, with high bootstrap support. The H. mehrai group in this study was separated from Haplorchoides sp. from previous studies with high bootstrap support.

Fig. 5.

Fig. 5

Phylogenetic tree of Haplorchoides spp. and related groups constructed using Neighbor joining (NJ) and Maximum likelihood (ML) (Tamura-Nei model for ML method) analysis of COI gene, with 1,000 bootstrap replicates. Statistic support values for individual nodes are shown on the tree (based on NJ/ML method).

Discussion

In this study, a high prevalence of H. mehrai metacercaria infection was found in C. repasson. This result was similar to Kumchoo et al. (2005), in which 100 % of C. repasson was infected by Haplorchoides sp. metacercariae, whereas the prevalence in B. schwanenfeldii was much lower. However, this result is quite different from Noikong et al. (2011), which reported 76.23 % and 56.26 % prevalences of Haplorchoides sp. metacercaria infection in C. repasson and B. Schwanenfeldii from the Kwae Noi Bamroongdan dam, Wat Bot district, Phitsanulok province, northern Thailand, respectively. The prevalence of infection of H. mehrai metacercariae in this study was higher than Noikong et al. (2011). However, prevalences over the three seasons were similar to Noikong et al. (2011); H. mehrai metacercariae were most prevalent in cool, followed by the hot and the rainy season respectively. Metacercariae of H. mehrai were found on the inner side of body scales and in muscle, which is in concordance with previous studies, such as Namue et al. (1998) Saenphet et al. (2001) and Kumchoo et al. (2005). Haplorchoides spp. metacercariae are found in common species of freshwater fish particularly cyprinoid fish. In Chiang Mai, they are often found together with metacercariae of Haplorchis taichui (Namue et al., 1998; Boonchot & Wongsawad, 2005; Nithikathkul & Wongsawad, 2008; Wongsawad et al., 2013).

In the morphological analysis, excysted H. mehrai from B. schwanenfeldii and C. repasson were similar to the adult stage of H. mehrai from Hemibagrus nemurus and M. Multiradiatus collected from Chiang Mai province, Thailand and other countries (Pande & Shukla, 1976; Shameem & Madhavi, 1988; Manpratum et al., 2017). They show the same position of ceaca, acetabulum and the same number of acetabular spines in three groups. However, the numbers of acetabular spines in H. mehrai from the four different fish species in this study were also some out of range at posterior and median group. The prepharynx length of both excysted and adult stage H. mehrai were longer than described in previous studies by Pande and Shukla (1976) and Shameem and Madhavi (1988). The body size of adult H. mehrai in this study was bigger than reported for H. mehrai in Northeast Thailand by Manpratum et al. (2017).

In previous studies, the High Annealing Temperature Random Amplified Polymorphic DNA (HAT-RAPD) technique was used to identify Haplorchoides spp. and other heterophyid species (Chuboon & Wongsawad, 2009; Wongsawad et al., 2013). HAT-RAPD was also used to compare metacercariae of Haplorchoides sp. from cyprinoid fish with the adult stage of Haplorchoides sp., which infect the same fish as those used in this study, such as the Yellow catfish, Hemibagrus nemurus. (Wongsawad & Wongsawad, 2011). Likewise, the COI gene can be used to identify H. mehrai metacercariae originated from this study. Phylogenetic trees using Neighbor joining and Maximum likelihood methods showed the monophyletic group of Haplorchoides. H. mehrai metacercariae clustered with H. mehrai adults and separated from Haplorchoides sp. originated from previous study (Chontananarth et al., 2014), with high bootstrap support. The COI gene can also be used to distinguish H. mehrai from other trematodes in family Herterophyidae. Our study could indicate that H. mehrai metacercariae originated from B. schwanenfeldii and C. repasson tended to be

H. mehrai associated with the similar morphology (three groups of acetabular spines).

In conclusion Haplorchoides mehrai metacercariae were found on the inner side of body scales and in the muscle of the cyprinoid fish, Barbonymus schwanenfeldii and Cyclocheilichthys repasson from Chom Thong district Chiang Mai province, Thailand. Both the prevalence and intensity of infection was high. Therefore, this is a high-risk area for H. mehrai infection in freshwater animals. This study revealed new records of both H. mehrai metacercaria (from B. schwanenfeldii and C. repasson) and adult stage (from Hemibagrus nemurus and Mystus multiradiatus) in Chiang Mai province, Northern Thailand.

Acknowledgements

Special thanks are extended to Parasitology Research Laboratory, Environmental Science Research Center (ESRC), Chiang Mai University and the Applied Technology Research Unit, Institute for Science and Technology Research Department of Biology, Faculty of Science, Chiang Mai University for their great assistances. Thank you Dr. Nattawadee Nantarat and website www.proof-reading-service.com for English correction.

Footnotes

Conflict of Interest The authors state no conflict of interest.

References

  1. Boonchot K., Wongsawad C.. A survey of Helminths in Cyprinoid fish the Mae Ngad Somboonchon reservoir, Chiang Mai province, Thailand. Southeast Asian J. Trop. Med. Public. Health. 2005;36(1):103–107. [PubMed] [Google Scholar]
  2. Caron Y., Righib S., Lempereura L., Saegermanc C., Lossona B. An optimized DNA extraction and multiplex PCR for the detection of Fasciola sp. inlymnaeid snails. Vet. Parasitol. 2010. pp. 1–7. –. [DOI] [PubMed]
  3. Chen H.T.. Systematic consideration of some heterophyid trematodes in the subfamilies Haplorchinae and Stellantchasminae. Ann. Trop. Med. Parasitol. 1949;43:304–312. doi: 10.1080/00034983.1949.11685415. [DOI] [PubMed] [Google Scholar]
  4. Chontananarth T., Wongsawad C., Chomdej S., Krailas D., Chai J.Y.. Molecular phylogeny of trematodes in Family Heterophyidae based on mitochondrial cytochrome c oxidase subunit 1 (mCO1) Asian Pac. J. Trop. Med. 2014;6(7):446–450. doi: 10.1016/S1995-7645(14)60072-9. DOI. [DOI] [PubMed] [Google Scholar]
  5. Chuboon S., Wondsawad C.. Molecular identification of larval trematode in intermediate hosts from Chiang Mai, Thailand. Southeast. Asian. J. Trop. Med. Public. Health. 2009;40(6):1216–1220. doi: 10.1017/S0022149X12000041. Dung, D.T., Hop, N.T., Thaenkham, U., Waikagul, J. (2013): Genetic differences among Vietnamese Haplorchis taichui populations using the COI genetic marker. J. Helminthol 87(66) 70. [DOI] [PubMed] [Google Scholar]
  6. Kumchoo K., Wongsawad C., Chai J.Y., Vanittanakom P., Rojanapaibul A.. High prevalence of Haplorchis taichui metacercariae in cyprinoid fish from Chiang Mai Province, Thailand. Southeast Asian J. Trop. Med. Public. Health. 2005;36(2):451–455. [PubMed] [Google Scholar]
  7. Manpratum Y., Kaewkes W., Echubard P., Sripa B., Kaewkes S.. New locality record for Haplorchoides mehrai and possible interactions with Opisthorchis viverrini metacercariae in cyprinid fishes in Northeast Thailand. Parasitol. Res. 2017;116:601–608. doi: 10.1007/s00436-016-5324-7. [DOI] [PubMed] [Google Scholar]
  8. Margolis L., Esch G.W., Holmes J.G., Kuris Schad G.A.. The use of ecological terms in parasitology. J. Parasitol. 1982;68:131–133. [Google Scholar]
  9. Namue C., Rojanapaibul A., Wongsawad C.. Occurrence of two Heterophyid metacercariae Haplorchis and Haplorchoides in Cyprinoid fish of some districts in Chiang Mai and Lumphun Province. Southeast Asian J. Trop. Med. Public. Health. 1998;2(29):401–405. [PubMed] [Google Scholar]
  10. Nithikathkul C., Wongsawad C.. Prevalence of Haplorchis taichui and Haplorchoides sp. metacercariae in freshwater fish from water reservoirs, Chiang Mai, Thailand. Korean J. Parasitol. 2008;46(2):109–112. doi: 10.3347/kjp.2008.46.2.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Noikong W., Wongsawad C., Phalee A.. Seasonal variation of metacercariae in cyprinoid fish from Kwae Noi Bamroongdan Dam, Phitsanulok Province, northern Thailand. Southeast Asian J. Trop. Med. Public. Health. 2011;42(1):58–62. [PubMed] [Google Scholar]
  12. Pande B.P., Shukla R.P.. Haplorchoides Chen, 1949 (Haplorchinae: Heterophyidae) in freshwater fishes. J Helminthol. 1976;50:181–192. doi: 10.1017/S0022149X00027735. [DOI] [PubMed] [Google Scholar]
  13. Pearson J.C., Ow Yang C.K.. New species of Haplorchis from Southeast Asia, together with keys to the Haplorchis Group of Heterophyid trematodes of the region. Southeast. Asian. J. Trop. Med. Public. Health. 1982;13(1):35–60. [PubMed] [Google Scholar]
  14. Purivirojkul W., Areechon N.. Parasitic Diversity of Siluriform Fishes in Mekong River, Chiang Rai Province. Kasetsart J. 2008;42:34–39. [Google Scholar]
  15. Saenphet S., Wongsawad C., Saenphet K.. A survey of Helminths in freshwater animals from some areas in Chiang Mai. Southeast Asian J. Trop. Med. Public. Health. 2001;32(2):2102–2113. Scholz, T., Ditrich, O., Giboda, M. (1991): Differential diagnosis of opisthorchiid and heterophyid metacercariae (Trematoda) infecting flesh of cyprinid fish from Nam Ngum Dam Lake in Laos. Southeast Asian J. Trop. Med. Public. Health 22: 171–173. [PubMed] [Google Scholar]
  16. Shameem U., Madhavi R.. The morphology, life-history and systematic position of Haplorchoides mehrai Pande and Shukla, 1976 (Trematoda: Heterophyidae) J. Syst. Parasitol. 1988;11:73–83. doi: 10.1016/j.actatropica.2007.05.006. Thaenkham, U., Visetsuk, K., Dungb, D.T., Waikagul, J. (2007): Discrimination of Opisthorchis viverrini from Haplorchis taichui using COI sequence marker. Acta trop 103: 26–. [DOI] [Google Scholar]
  17. Wongsawad C., Rojtinnakorn J., Wongsawad P., Rojanapaibul A., Marayong T., Suwattanacoupt S., Sirikanchana P., Sey O., Jadhav B.V.. Helminths of vertebrates in Mae Sa Stream, Chiang Mai, Thailand. Southeast Asian J. Trop. Med. Public. Health. 2004;35(1):140–145. [Google Scholar]
  18. Wongsawad C., Wongsawad P., Anontalabhochai S., Chai J.Y., Sukontason K.. Occurrence and molecular identification of liver and minute intestinal flukes metacercariae in freshwater fish from Fang-Mae Ai agricultural basin, Chiang Mai province, Thailand. Asian Biomed. 2013;7(1):97–104. doi: 10.5372/1905-7415.0701.155. [DOI] [Google Scholar]
  19. Wongsawad P., Wongsawad C.. Infection dynamics and molecular identification of metacercariae in cyprinoids from Chiang Mai and Sakonnakhon provinces. Southeast Asian. J. Trop. Med. Public. Health. 2011;42(1):53–57. [PubMed] [Google Scholar]
  20. Yamaguti S. Systema Helminthum Vol I. The Digenetic of Vertebrates. Part I and II. Interscience Publisher Inc; New York: 1958. p. 1575. [Google Scholar]

Articles from Helminthologia are provided here courtesy of De Gruyter

RESOURCES