Skip to main content
NCBI home page
International Journal for Parasitology: Parasites and Wildlife logoLink to International Journal for Parasitology: Parasites and Wildlife
. 2019 Jul 25;10:87–92. doi: 10.1016/j.ijppaw.2019.07.008

Molecular survey on the occurrence of avian haemosporidia, Coxiella burnetii and Francisellatularensis in waterfowl from central Italy

Valentina Virginia Ebani a,*, Simona Nardoni a, Marinella Giani a, Guido Rocchigiani a, Talieh Archin b, Iolanda Altomonte a, Alessandro Poli a, Francesca Mancianti a
PMCID: PMC6664032  PMID: 31384551

Abstract

The aim of the present study was to evaluate the occurrence of some avian Haemosporidia, Coxiella burnetii and Francisella tularensis in waterfowl from Tuscany wetlands. One-hundred and thirty-three samples of spleen were collected from regularly hunted wild birds belonging to 13 different waterfowl species. DNA extracted from each sample was submitted to PCR assays and sequencing to detect the pathogens. Thirty-three samples (24.81%) were positive with PCR for at least one pathogen: 23 (17.29%) for Leucocytozoon spp., 6 (4.51%) for Plasmodium spp., 4 (3%) for C. burnetii, 2 (1.5%) for Haemoproteus spp. No specific F. tularensis amplifications (0%) were detected. To the best of our knowledge, this study firstly reports data about haemosporidian and C. burnetii infections in waterfowl from Italy.

Keywords: Waterfowl, Leucocytozoon spp., Plasmodium spp, Haemoproteus spp, Coxiella burnetii, Francisella tularensis

Graphical abstract

Coxiella burnetii and several haemosporidia species and strains are circulating in wild waterfowl in Central Italy. C.burnetii-infected birds are potential source of infection for humans.

Image 1

Open in a new tab

Highlights

  • •

    First report on avian haemosporidia and C. burnetii in waterfowl from Italy.

  • •

    Risk of transmission of C. burnetii from waterfowl to humans.

  • •

    Haemoproteus, Leucocytozoon and Plasmodium are circulating among waterfowl in Italy.

1. Introduction

Avian haemosporidia are a group of protozoan parasites, among which Plasmodium, Haemoproteus and Leucocytozoon genera are encountered. These parasites are transmitted by blood sucking dipteran vectors, with birds acting as intermediate hosts (Valkiunas, 2005). In detail, after the inoculation of sporozoite stages by the vectors during the bloodmeal, exoerytrhrocytic schizonts develop in different tissues (i.e. spleen, liver, lungs, heart, brain …) giving gametocytes into the blood cells. These latter stages are infective for the vectors.

Haemosporidians occur worldwide except in Antarctica (Beadell et al., 2009) and most infections are relatively benign, probably due to long-term host parasites evolutionary associations (Bennet et al., 1993). The occurrence of these protozoa has been reported from several birds’ species (Schmid et al., 2017; Dimitrov et al., 2018; Ferreira-Junior et al., 2018; Valkiunas et al., 2019; Schumm et al., 2019) and from dipteran species (Ionică et al., 2017; Žiegytė et al., 2017; Martin et al., 2019; Schoener et al., 2019).

Domestic Anatidae are highly susceptible to haemosporidia (Valkiunas, 2005) and wild waterfowl have been reported as infected in several countries (Loven et al., 1980; Reeves et al., 2015; Ramey et al., 2015; Meixell et al., 2016).

To the best of our knowledge, a unique survey by Sacchi and Prigioni (1986) evaluating occurrence of haemosporidia in wild waterfowl by microscopy in Italy yielded no positive results.

Coxiella burnetii is the etiologic agent of Q fever, a worldwide zoonotic bacterial disease. Even though domestic ruminants are considered as the main reservoirs for this pathogen, several wild mammals have been found to be hosts of this microorganism. C. burnetii has been found in birds (Babudieri and Moscovici, 1952; Stein and Raoult, 1999; Ebani et al., 2016), too, but little is known about the transmission patterns among avian populations. Animals as well as humans usually become infected through oral and inhalation routes, but the transmission of C. burnetii is also possible via tick bites (Porter et al., 2011).

Francisella tularensis is the causative agent of the severe zoonotic disease tularemia. It is a Gram negative bacterium, with a wide range of hosts including invertebrates and mammals. Birds have been experimentally infected with F. tularensis (Mörner and Mattsson, 1988) and naturally acquired infections have been reported in different avian species (Green and Wade, 1929; Green and Shillinger, 1932; Nakamura, 1950; Stahl et al., 1969; Mörner and Mattsson, 1983). However, studies about tularemia in avian populations were conducted many years ago and updated information is not available. Moreover, symptoms and lesions in birds are not known and some authors suggested that these animals may acquire the infection without developing disease (Mörner and Mattsson, 1988).

The transmission of F. tularensis may occur through haematophagous arthropods, as well as through direct or indirect contact with infected animals.

In view of the scant data available about the spreading of Haemosporidia, C. burnetii and F. tularensis among avian population in Italy, the aim of the present study was to investigate the occurrence of these pathogens among wild waterfowl hunted in Tuscany (Central Italy) wetlands.

2. Material and methods

2.1. Animals

The study was performed on 133 wild birds belonging to 13 different waterfowl species of the Orders Anseriformes, Charadriiformes and Gruiformes. More in detail, the analysis were executed on 63 common teals (Anas crecca), 21 mallards (Anas platyrhynchos), 19 eurasian wigeons (Anas penelope), 10 northern shovelers (Anas clypeata), 6 common snipes (Gallinago gallinago), 3 pintails (Anas acuta), 3 common pochards (Aythya ferina), 2 common shelducks (Tadorna tadorna), 2 gadwalls (Anas strepera), 1 garganey (Anas querquedula), 1 tufted duck (Aythya fuligula), 1 greylag goose (Anser anser), and 1 eurasian coot (Fulica atra).

All animals were regularly hunted during the 2016 and 2017 hunting seasons (September–January) in the Province of Pisa, in the wetland “Padule di Fucecchio” (43°48′N 10°48′E/43.8°N 10.8°E43.8), located on the migration route of waterfowls. All the animals were intended for human consumption, so the carcasses were immediately refrigerate until processing (about within 24 h). Bird's carcasses were submitted to assessment of body condition and examined for ectoparasites. Viscera were removed from each bird, maintained at 4 °C and sent to the laboratories. Impression smears were prepared from spleen of each animal for microscopical examination. The remaining portions were stored at −20 °C for molecular analysis. It was not possible to obtain blood specimens to investigate blood stage parasites and sellers allowed us to collect spleens, only. However this tissue was reported as sensitive in detecting haemosporidian parasites (Scaglione et al., 2016; Valkiunas and Iezhova, 2017). Spleen allows the detection of C. burnetii and F. tularensis, too, because hematogenous spread of these bacteria lead to involvement of several organs including this one (Bell, 1980; Maurin and Raoult, 1999).

2.2. Microscopical examination

The spleen impression smears were prepared on glass slide, fixed in methanol and stained with modified Wright's solution. Each smear was examined through 100 fields at low magnification (400X), then at least 100 fields were observed at high magnification (1000X).

2.3. Molecular analysis

Extraction of total DNA was carried out from up to 10 mg of each spleen sample using the DNeasy® Blood & Tissue kit (QIagen, Milano, Italy) and following the manufacturer's instructions. DNA specimens were stored at 4 °C until used as template for the PCR assays.

Different PCR protocols were carried out to detect DNA of pathogens. Haemoproteus spp., Plasmodium spp., Leucocytozoon spp. DNA were detected, with a nested PCR protocol, according to Hellgren et al. (2004) and Bensch et al. (2000). The extracted DNA was first subjected to an amplification common to Leucocytozoon, Haemoproteus and Plasmodium, and then, its product was submitted to two parallel PCRs, one amplifying both Haemoproteus and Plasmodium while the another one amplifying Leucocytozoon only.). C. burnetii and F. tularensis DNA were investigated, using primers and procedures previously described, respectively (Milutinović et al., 2008; Berri et al., 2009). Target genes, primers sequences and PCR conditions are summarized in Table 1.

Table 1.

PCR primers and conditions employed in the assays for the detection of each pathogen.

Pathogens Amplicons (target gene) Primers sequence (5’ – 3′) PCR conditions References
*
Haemoproteus spp. Plasmodium spp. Leucocytozoon spp.		 617 bp (cytochrome b) HAEMNFI (CATATATTAAGAGAATTATGGAG)
HAEMNR3 (ATAGAAAGATAAGAAATACCATTC)		 94 C - 30 s
50 C–30 s
72 C–45 s (20 cycles)		 [Hellgren et al., 2004]
**
Haemoproteus spp.
Plasmodium spp.		 480 bp (cytochrome b) HAEMF (ATGGTGCTTTCGATATATGCATG)
HAEMR2 (GCATTATCTGGATGTGATAATGGT)		 94 C- 30 s
50 C–30 s
72 C–45 s (35 cycles)		 [Bensch et al., 2000]
**
Leucocytozoon spp.		 478 bp (cytochrome b) HAEMFL (ATGGTGTTTTAGATACTTACATT)
HAEMR2L (CATTATCTGGATGAGATAATGGTGC)		 94 C- 30 s
50 C–30 s
72 C–45 s (35 cycles)		 [Hellgren et al., 2004]
Coxiella burnetii 687 bp (IS1111a) Trans-1 (TATGTATCCACCGTAGCCAGT)
Trans-2 (CCCAACAACACCTCCTTATTC)		 95 °C–30 s
64 °C–1 min
72 °C–1 min		 [Berri et al., 2009]
Francisella tularensis 400 bp (TUL4) TUL4-435 (TCGAAGACGATCAGATACCGTCG)
TUL4-863 (TGCCTTAAACTTCCTTGCGAT)		 96 °C–1 min
60.5 °C–1 min
72 °C–1 min		 [Milutinović et al., 2008]
Open in a new tab

*Primary amplification; ** Secondary amplification.

PCR amplifications were performed using the EconoTaq PLUS 2x Master Mix (Lucigen Corporation, Middleton, Wisconsin, USA) and an automated thermal cycler (Gene-Amp PCR System 2700, Perkin Elmer, Norwalk, Connecticut, USA).

PCR products were analysed by electrophoresis on 1.5% agarose gel at 100 V for 45 min; gel was stained with ethidium bromide and observed. SharpMass™ 100 Plus Ladder (Euroclone, Milano, Italy) was used as DNA marker.

Samples resulted positive for Haemoproteus spp., Plasmodium spp. and Leucocytozoon spp. were sequenced on both strands by the commercial laboratory BMR-Genomics (Padua, Italy), using the inner primers. The sequence obtained was assembled and corrected by visual analysis of the electropherogram using Bioedit v.7.0.233 and compared with those available in GenBank ® 4 using the BLASTn ® program (http://www.ncbi.nlm.nih.gov/BLAST). Sequences obtained by overlapping both sense and antisense strands were exclusively used in the article.

3. Results

All animals of the study were in good nutrition conditions and no lesions and ectoparasites were observed during the carcasses’ manipulation. No microorganisms or parasite stages were observed in smears.

Among the 133 tested samples, 33 (24.81%) were PCR positive for at least one pathogen. More in details, 23 (17.29%) birds were positive for Leucocytozoon spp., 6 (4.51%) for Plasmodium spp., 4 (3%) for C. burnetii, 2 (1.5%) for Haemoproteus spp. No specific F. tularensis amplifications (0%) were detected (Table 2).

Table 2.

Number of specimens and detail of positive reactions for Coxiella burnetii, Haemoproteus spp., Leucocytozoon spp. and Plasmodium spp. in relation to the tested avian species.

Animal species No. tested specimen Positive reactions
Anseriformes
Anas crecca 63 15 Leucocytozoon spp.
3 C. burnetii
2 Plasmodium spp.
Anas platyrhynchos 21 1 Haemoproteus spp.
Anas penelope 19 3 Leucocytozoon spp.
4 Plasmodium spp.
1 C. burnetii
Anas clypeata 10 2 Leucocytozoon spp.
Anas acuta 3 2 Leucocytozoon spp.
Aythya ferina 3 Negative
Tadorna tadorna 2 Negative
Anas strepera 2 1 Leucocytozoon spp.
Anas querquedula 1 Negative
Aythya fuligula 1 Negative
Anser anser 1 Negative
Charadriiformes
Gallinago gallinago 6 1 Haemoproteus spp.
Gruiformes
Fulica atra 1 Negative
Total 133 35
Open in a new tab

Sequence analysis for Leucocytozoon spp. revealed that the majority of the isolates fell in two broad groups.

One group (here called Leucocytozoon “lineage duck 1”) was composed of 9 isolates, showing 100% homology with parasites sequenced from previous studies (L. Kvleu MG593842; L; L. TS-2014a voucher MN-08-A-0235, KJ577823; L. MMSL02, KU295418; L. TUSW04 JQ314223).

The other group (Leucocytozoon “lineage duck 2”) was composed of 6 isolates, exhibiting 100% homology with different parasites sequenced (DUCK 18, KM386326; L. BWTE20, KU363710).

Six isolates showed 99% homology with haplotype duck 1, with two mismatches maximum.

One isolate exhibited 100% identity with L. DUCK40 KM386348.

One isolate exhibited 98% homology with L.duck. Duck32 KM386340 e Duck34 KM386342. The phylogenetic tree in Fig. 1 illustrates the leucocytozoon sequencing results.

Fig. 1.

Fig. 1

Open in a new tab

Phylogenetic tree showing the Leucocytozoon sequencing results.

Sequences analysis for Plasmodium found 100% homology with Plasmodium circumflexum for 3 samples and Plasmodium polare for one sample; one specimen scored 100% similar to P. Sybor2 isolate. One sample showed 99% homology with the sequence P. Sybor2. Two amplicons were identified as Haemoproteus spp.

A mixed infection by Leucocytozoon and P. circumflexum was observed in one A. penelope whereas a mixed infection by Leucocytozoon and C. burnetii was detected in one A. crecca.

More detailed data about hosts and agents are reported in Table 3, Table 4.

Table 3.

–Sequencing analysis results of the samples resulted PCR positive for Haemosporidia.

Host species Parasite genus Number bp % homology GenBank sequences
Anas crecca Leucocytozoon 514 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas crecca Leucocytozoon 501 100 L.DUCK18; L.BWTE20
Anas crecca Leucocytozoon 344 100 L.DUCK18; L.BWTE20
Anas crecca Leucocytozoon 504 100 L.DUCK18; L.BWTE20
Anas crecca Leucocytozoon 518 100 L.DUCK40
Anas crecca Leucocytozoon 444 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas crecca Leucocytozoon 511 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02
Anas crecca Leucocytozoon 466 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas crecca Leucocytozoon 439 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas crecca Leucocytozoon 443 100 L.DUCK18; L.BWTE20
Anas crecca Leucocytozoon 515 100 L.DUCK18; L.BWTE20
Anas crecca Leucocytozoon 507 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas acuta Leucocytozoon 495 100 L.DUCK18; L.BWTE20
Anas penelope Leucocytozoon 502 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas clypeata Leucocytozoon 518 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas clypeata Leucocytozoon 496 100 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04
Anas crecca Leucocytozoon 509 99 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04; TUSW03
Anas crecca Leucocytozoon 508 99 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04; TUSW03
Anas acuta Leucocytozoon 496 99 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04; TUSW03
Anas strepera Leucocytozoon 503 99 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04; TUSW03
Anas penelope Leucocytozoon 489 99 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04; TUSW03
Anas penelope* Leucocytozoon 355 99 L.Kvleu; L.TS-2014a vouch MN-08B-0298; L.TS-2014°vouch MN-08-A-0235; L.MMSL02; TUSW04; TUSW03
Anas crecca Leucocytozoon 455 98 LDUCK32; LDUCK34
Anas crecca Plasmodium 527 100 Plasmodium circumflexum
Anas crecca Plasmodium 64 100 Plasmodium polare
Anas penelope Plasmodium 290 100 Plasmodium circumflexum
Anas penelope Plasmodium 462 100 P.Sybor2
Anas penelope* Plasmodium 421 100 Plasmodium circumflexum
Anas penelope Plasmodium 145 99 P. Sybor2
Gallinago gallinago Haemoproteus 497 100 H230
Anasplatyrhynchos Haemoproteus 478 100 H230
Open in a new tab

Legend - *: one Anas penelope scored positive to Leucocytozoon and Plasmodium circumflexum.

Table 4.

PCR results for pathogen, lineage and host species. In each square it is indicated the number of animal scored positive for each pathogen with the percentage of sequence homology.

Animal species L. “lineage duck 1″ L. “lineage duck 2″ L. duck 40 L. duck 32 P. polare P. circumflexum P. sybor 2 H 230
Anas crecca 6 (100%)
2 (99%) 		5 (100%) 1 (100%) 1 (98%) 1 (100%) 1 (100%)
Anas acuta 1 (99%) 1 (100%)
Anas penelope 2 (100%)
1(99%) 		2 (100%) 1 (100%)
1 (99%)
Anas clypeata 2 (100%)
Anas streptera 1 (99%)
Gallinago gallinago 1 (100%)
Anasplatyrhynchos 1 (100%)
Open in a new tab

4. Discussion

The investigated subjects showed a 23.3% prevalence of infection by haemosporidia, with Leucocytozoon being the most abundant parasite detected via PCR (17.29%). In similar investigations this genus was the more frequently encountered in Anseriformes, both domestic (Ramey et al., 2012) and wild (Ramey et al., 2015; Reeves et al., 2015; Smith et al., 2016; Seimon et al., 2016). The L. “lineage duck 1” showed 100% identity with parasites detected from Anser domesticus (L. Kvleu MG593842, Turkey), Anser indicus (L. TS-2014a voucher MN-08-A-0235, KJ577823, Mongolia) A. platyrhynchos (L. MMSL02, KU295418, Alaska) and Cygnus colombianus (L. TUSW04 JQ314223, Alaska). The “lineage duck 2” exhibited 100% identity with isolates coming from Anas sp.(L. DUCK 18, KM386326, Pacific America) and Anas discors (L. BWTE20, KU363710, North America). These findings suggest that the lineages observed in the present study are well adapted to Anatidae birds. Additionally, since the same lineages were observed also in other continents, the isolates described in Italy don't seem to be confined only in Europe. Such findings needs further studies to strengthen this hypothesis.

Plasmodium was identified in 6 animals (4.51%), 2 A. crecca and 4 A. penelope. In these animals 2 species and different sequences were recognized. This haemosporidian genus, in contrast with Leucocytozoon and Haemoproteus, is not considered as a host specific parasite (Reeves et al., 2015; Smith et al., 2016). P. circumflexum has been recorded to have a low host specificity (Dimitrov et al., 2015), and in the present study was reported in a mixed infection with Leucocytozoon. P. polare was identified in one specimen from A. crecca. This haemosporidian species has been previously isolated from great tits (Parus major), from Switzerland (Rooyen et al., 2013). Haemoproteus was identified only in 2 samples (1.5%), from a G. gallinago and a A. platyrhynchos; however, isolated sequences did not allow us to recognize the species.

Data from Italy are scanty and consist of a study, carried out by microscopy, in which Leucocytozoon and Haemoproteus were not detected in Anatidae and Charadridae from North Italy (Sacchi and Prigioni, 1986). At the best of our knowledge, this is the first report of haemosporidian infection in A. penelope, A. strepera, A. querquendula, T. tadorna and G. gallinago.

Similar studies have been conducted on waterfowl in the USA (Ramey et al., 2015; Reeves et al., 2015; Meixell et al., 2016) in a lower number of bird species and in injured birds from Japan (Inumaru et al., 2017). Nevertheless, the above mentioned authors reported higher prevalence values in respect to the present study. Different results obtained in literature could be due to both extrinsic and intrinsic factors, such as methods used. The season in which the study is performed is important, because in dry environment the prevalence of infection would be lower (Smith and Ramey, 2015), even if in the present study sampling was conducted during autumn/winter seasons. The present investigation detected four animals (3 A. crecca and 1 A. penelope) positive (3%) for C. burnetii, whereas no F. tularensis-positive reactions were found. C. burnetii and F. tularensis may be transmitted by haematophagous arthropods, mainly ticks, but other transmission routes are possible. C. burnetii-positive birds could have contracted the pathogen by ticks’ bite, but it is easier to consider the oral route. In fact, waterfowl may travel large distances per day and reach areas where infected animals, wild and domestic, are present. Birds infected by C. burnetii play a relevant epidemiological role, because they can disperse the bacteria in the environment through their feces and they may be source of coxiellae for ticks during the blood meal.

On the basis of previous epidemiological studies in mammals and data relative to human infections, F. tularensis seems to not be largely present in Italy (Pascucci et al., 2015; Ebani et al., 2016, 2017; Graziani et al., 2016; Rocchigiani et al., 2018), thus the negative results of the tested waterfowl could reflect the true epidemiological status. F. tularensis has been proven to be able to infect different avian species, thus birds could be cause of infection for humans. Hunters are more at risk of infection having direct or indirect contact with wild birds, as suggested by Padeshki et al. (2010), who reported a case of tularemia with typical ulceroglandular form in a hunter who acquired the infection through a nail scratch from a buzzard (Buteo buteo).

Data about the transmission of C. burnetii and F. tularensis among avifauna are scant in scientific literature. Two studies have been carried out on ticks collected from birds in Italy: Toma et al. (2014) detected C. burnetii DNA in 42/127 analysed ticks collected from migratory birds of different species, but not waterfowl; Pajoro et al. (2018) did not detected C. burnetii and F. tularensis in any ticks collected from 124 wild birds. A recent investigation has been carried out on fecal samples collected from 673 migratory birds along the Mediterranean – Black Sea flyway and bacteriological and molecular analyses found neither F. tularensis nor C. burnetii (Najdenski et al., 2018).

5. Conclusions

The present study firstly reports data about haemosporidia and C. burnetii infections in waterfowl from Italy. In particular, these findings would add more data about haemosporidia species and strains circulating in avian population. Moreover, it has been confirmed the involvement of wild birds in the epidemiology of C. burnetii, suggesting that these animals may be direct and indirect source of infection for people. In fact, humans could be at risk when manipulating infected live birds or carcasses, as well as they could contract the infection because of the environment contamination with coxiellae excreted through birds’ droppings.

Funding

This work was supported by the University of Pisa.

Conflicts of interest

All authors disclose any financial and personal relationships with other people or organizations that could inappropriately influence their work.

References

  1. Babudieri B., Moscovici L. Experimental and natural infection of birds by Coxiella burnetii. Lancet. 1952;169:195–196. doi: 10.1038/169195a0. [DOI] [PubMed] [Google Scholar]
  2. Beadell J.S., Covas R., Gebhard C., Ishtiaq F., Melo M., Schmidt B.K., Perkins S.L., Graves G.R., Fleischer R.C. Host associations and evolutionary relationships of avian blood parasites from West Africa. Int. J. Parasitol. 2009;39:257e266. doi: 10.1016/j.ijpara.2008.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bell F. Tularemia. In: Steele J.H., editor. CRC Handbook Series in Zoonoses. Section A: Bacterial, Rickettsial, and Mycotic Diseases. CRC Press; Boca Raton,Florida: 1980. pp. 161–163. [Google Scholar]
  4. Bennett G.F., Peirce M.A., Ashford R.W. Avian hematozoa—mortality and pathogenicity. J. Nat. Hist. 1993;27:993–1001. [Google Scholar]
  5. Bensch S., Stjernman M., Hasselquist D., Ostman O., Hansson B., Westerdahl H., Pinheiro R.T. Host specificity in avian blood parasites: a study of Plasmodium and Haemoproteus mithocondrial DNA amplified from birds. Proc. R. Soc. Lond. B. 2000;267:1583–1589. doi: 10.1098/rspb.2000.1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Berri M., Rekiki A., Boumedine A., Rodolakis A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum, and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR. BMC Microbiol. 2009;9:130. doi: 10.1186/1471-2180-9-130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dimitrov D., Ilieva M., Ivanova K., Brlík V., Zehtindjiev P. Detecting local transmission of avian malaria and related haemosporidian parasites (Apicomlexa, Haemosporida) at a Special Protection Area of Natura 2000 network. Parasitol. Res. 2018;117:2187–2199. doi: 10.1007/s00436-018-5906-7. [DOI] [PubMed] [Google Scholar]
  8. Dimitrov D., Palinauskas V., Iezhova T.A., Bernotienė R., Ilgūnas M., Bukauskaitė D., Zehtindjiev P., Ilieva M., Shapoval A.P., Bolshakov C.V., Markovets M.Y., Bensch S., Valkiūnas G. Plasmodium spp.: an experimental study on vertebrate host susceptibility to avian malaria. Exp. Parasitol. 2015;148:1–16. doi: 10.1016/j.exppara.2014.11.005. [DOI] [PubMed] [Google Scholar]
  9. Ebani V.V., Bertelloni F., Mani P. Molecular survey on zoonotic tick-borne bacteria and chlamydiae in feral pigeons (Columba livia domestica) Asian Pac. J. Trop. Med. 2016;9:324–327. doi: 10.1016/j.apjtm.2016.03.005. [DOI] [PubMed] [Google Scholar]
  10. Ebani V.V., Rocchigiani G., Nardoni S., Bertelloni F., Vasta V., Papini R.A., Verin R., Poli A., Mancianti F. Molecular detection of tick-borne pathogens in wild red foxes (Vulpes vulpes) from Central Italy. Acta Trop. 2017;172:197–200. doi: 10.1016/j.actatropica.2017.05.014. [DOI] [PubMed] [Google Scholar]
  11. Ferreira-Junior F.C., de Angeli Dutra D., Silveira P., Pacheco R.C., Witter R., de Souza Ramos D.G., Pacheco M.A., Escalante A.A., Braga É.M. A new pathogen spillover from domestic to wild animals: Plasmodium juxtanucleare infects free-living passerines in Brazil. Parasitology. 2018;145:1949–1958. doi: 10.1017/S003118201800077X. [DOI] [PubMed] [Google Scholar]
  12. Graziani C., Duranti A., Morelli A., Busani L., Pezzotti P. Istituto Superiore di Sanità, Rapporti ISTISAN 16/1; 2016. Zoonoses in Italy in the Period 2009-2013; p. 72. [Google Scholar]
  13. Green R.C., Shillinger J.E. A natural infection of the sharp-tailed grouse and the ruffed grouse by Pasteurella tularensis. PSEBM (Proc. Soc. Exp. Biol. Med.) 1932;30:284–287. [Google Scholar]
  14. Green R.C., Wade E.M. A natural infection of quail by Bacterium tularense. PSEBM (Proc. Soc. Exp. Biol. Med.) 1929;26:626–627. [Google Scholar]
  15. Hellgren O., Waldenstrom J., Bensch S. A new PCR assay for simultaneous studies of Leucocytozoon, Plasmodium, and Haemoproteus from avian blood. J. Parasitol. 2004;90:797–802. doi: 10.1645/GE-184R1. [DOI] [PubMed] [Google Scholar]
  16. Inumaru M., Murata K., Sato Y. Prevalence of avian haemosporidia among injured wild birds in Tokyo and environs, Japan. Int. J. Parasitol. Parasites Wildl. 2017;6:299–309. doi: 10.1016/j.ijppaw.2017.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ionică A.M., Zittra C., Wimmer V., Leitner N., Votýpka J., Modrý D., Mihalca A.D., Fuehrer H.P. Mosquitoes in the Danube Delta: searching for vectors of filarioid helminths and avian malaria. Parasites Vectors. 2017;10(1):324. doi: 10.1186/s13071-017-2264-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Loven J.S., Bolen E.G., Cain B.W. Blood parasitemia in a south Texas wintering waterfowl population. J. Wildl. Dis. 1980;16:25–28. doi: 10.7589/0090-3558-16.1.25. [DOI] [PubMed] [Google Scholar]
  19. Martin E., Chu E., Shults P., Golnar A., Swanson D.A., Benn J., Kim D., Schneider P., Pena S., Culver C., Medeiros M.C.I., Hamer S.A., Hamer G.L. Culicoides species community composition and infection status with parasites in an urban environment of east central Texas, USA. Parasites Vectors. 2019;12(1):39. doi: 10.1186/s13071-018-3283-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Maurin M., Raoult D. Q fever. Clin. Microbiol. Rev. 1999;12(4):518–553. doi: 10.1128/cmr.12.4.518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Meixell B.W., Arnold T.W., Lindberg M.S., Smith M.M., Runstadler J.A., Ramey A.M. Detection, prevalence, and transmission of avian hematozoa in waterfowl at the Artic-sub-Artic interface: co-infections, viral interactions, and sources of variation. Parasites Vectors. 2016;9(1):390. doi: 10.1186/s13071-016-1666-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Milutinović M., Masuzawa T., Tomanović S., Radulović Z., Fukui T., Okamoto Y. Borrelia burgdorferi sensu lato, Anaplasma phagcoytophilum, Francisella tularensis and their co-infections in host-seeking Ixodes ricinus ticks collected in Serbia. Exp. Appl. Acarol. 2008;45:171–183. doi: 10.1007/s10493-008-9166-6. [DOI] [PubMed] [Google Scholar]
  23. Mörner T., Mattsson R. Tularemia in a rough-legged buzzard (Buteo lagopus) and a Ural owl (Strix uralensis) J. Wildl. Dis. 1983;19:360–361. doi: 10.7589/0090-3558-19.4.360. [DOI] [PubMed] [Google Scholar]
  24. Mörner T., Mattsson R. Experimental infection of five species of raptors and of hooded crows with Francisella tularensis biovar paleartica. J. Wildl. Dis. 1988;24:15–21. doi: 10.7589/0090-3558-24.1.15. [DOI] [PubMed] [Google Scholar]
  25. Najdenski H., Dimova T., Zaharieva M.M., Nikolov B., Petrova-Dinkova G., Dalakchieva S., Popov K., Hristova-Nikolova I., Zehtindjiev P., Peev S., Trifonova-Hristova A., Carniel E., Panferova Y.A., Tokarevich N.K. Migratory birds along the mediterranean – Black Sea flyway as carriers of zoonotic pathogens. Can. J. Microbiol. 2018;64:915–924. doi: 10.1139/cjm-2017-0763. [DOI] [PubMed] [Google Scholar]
  26. Nakamura M. Tularemia in the red-tailed hawk (Buteo jamaicensis calurus) Auk. 1950;67:383–384. [Google Scholar]
  27. Padeshki P.I., Ivanov I.N., Popov B., Kantardjiev T.V. The role of birds in dissemination of Francisella tularensis: first direct molecular evidence for bird-to-human transmission. Epidemiol. Infect. 2010;138:376–379. doi: 10.1017/S0950268809990513. [DOI] [PubMed] [Google Scholar]
  28. Pajoro M., Piston D., Varotto Boccazzi I., Mereghetti V., Bandi C., Fabbi M., Scattorin F., Sassera D., Montagna M. Molecular screening for bacterial pathogens in ticks (Ixodes ricinus) collected on migratory birds captured in northern Italy. Folia Parasitol. 2018;65:008. doi: 10.14411/fp.2018.008. [DOI] [PubMed] [Google Scholar]
  29. Pascucci I., Di Domenico M., Dall'Acqua F., Sozio G., Cammà C. Detection of Lyme disease and Q fever agents in wild rodents in central Italy. Vector Borne Zoonotic Dis. 2015;15:404–411. doi: 10.1089/vbz.2015.1807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Porter S.R., Czaplicki G., Mainil J., Guattéo R., Saegerman C. Q Fever: current state of knowledge and perspective of research of a neglected zoonosis. Internet J. Microbiol. 2011;2011:248418. doi: 10.1155/2011/248418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ramey A.M., Ely C.R., Pearce J.M., Schmutz J.A., Heard D.J. USGS Alaska Science Center; 4210 University Drive, Anchorage, AK 99508, USA: 2012. Molecular Detection of Hematozoa Infections in Tundra Swans Relative to Migration Patterns and Ecological Conditions at Breeding Grounds. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ramey A.M., Schmutz J.A., Reed J.A., Fujita G., Scotton B.D., Casler B., Fleskes J.P., Konishi K., Uchida K., Yabsley M.J. Evidence for intercontinental parasite exchange through molecular detection and characterization of hematozoa in northern pintails (Anas acuta) sampled throughout the North Pacific Basin. Int. J. Parasitol. Parasites Wildl. 2015;4:11–21. doi: 10.1016/j.ijppaw.2014.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Reeves A.B., Smith M.M., Meixell B.W., Fleskes J.P., Ramey A.M. Genetic diversity and host specificity varies across three genera of blood parasites in ducks of the Pacific Americas Flyway. PLoS One. 2015;10(2) doi: 10.1371/journal.pone.0116661. e0116661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rocchigiani G., Ebani V.V., Nardoni S., Bertelloni F., Bascherini A., Leoni A., Mancianti F., Poli A. Molecular survey on the occurrence of arthropod-borne pathogens in wild brown hares (Lepus europaeus) from Central Italy. Infect. Genet. Evol. 2018;59:142–147. doi: 10.1016/j.meegid.2018.02.005. [DOI] [PubMed] [Google Scholar]
  35. Rooyen J.V., Lalubin F., Glaizot O., Christe P. Altitudinal variation in haemosporidian parasite distribution in great tit populations. Parasites Vectors. 2013;6:139. doi: 10.1186/1756-3305-6-139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sacchi L., Prigioni C. Avian parasites in Ticino Park and in other Italian regions. Ann. Istituto Super. Sanita. 1986;22:111–116. [PubMed] [Google Scholar]
  37. Scaglione F.E., Cannizzo F.T., Pregel P., Perez Rodriguez A.D., Bollo E. Blood parasites in hooded crows (Corvus corone cornix) in Northwest Italy. Vet. Ital. 2016;52(2):111–116. doi: 10.12834/VetIt.110.307.2. [DOI] [PubMed] [Google Scholar]
  38. Schmid S., Fachet K., Dinkel A., Mackenstedt U., Woog F. Carrion crows (Corvus corone) of southwest Germany: important hosts for haemosporidian parasites. Malar. J. 2017;16(1):369. doi: 10.1186/s12936-017-2023-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schoener E.R., Harl J., Himmel T., Fragner K., Weissenböck H., Fuehrer H.P. Protozoan parasites in Culex pipiens mosquitoes in Vienna. Parasitol. Res. 2019;118(4):1261–1269. doi: 10.1007/s00436-019-06219-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schumm Y.R., Wecker C., Marek C., Wassmuth M., Bentele A., Willems H., Reiner G., Quillfeldt P. Blood parasites in Passeriformes in central Germany: prevalence and lineage diversit of Haemosporida (Haemoproteus, Plasmodium and Leucocytozoon) in six common songbirds. Peer J. 2019;6:e6259. doi: 10.7717/peerj.6259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Seimon T.A., Gilbert M., Neabore S., Hollinger C., Tomaszewicz A., Newton A., Chang T., McAloose D. Avian hemosporidian parasite lineages in four species of free-ranging migratory water birds from Mongolia, 2008. J. Wildl. Dis. 2016;52:682–687. doi: 10.7589/2015-11-311. [DOI] [PubMed] [Google Scholar]
  42. Smith M.M., Ramey A.M. Prevalence and genetic diversity of haematozoa in South American waterfowl and evidence for intercontinental redistribution of parasites by migratory birds. Int. J. Parasitol. Parasites Wildl. 2015;4:22–28. doi: 10.1016/j.ijppaw.2014.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Smith M.M., Van Hemert C., Merizon R. Haemosporidian parasite infections in grouse and ptarmigan: prevalence and genetic diversity of blood parasites in resident Alaskan birds. Int. J. Parasitol. Parasites Wildl. 2016;5:229–239. doi: 10.1016/j.ijppaw.2016.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Stahl I.W., Schnurrenserger P.R., Martin R.J. Water related cases of tularemia in Illinois. Ill. Med. J. 1969;136:276–277. [PubMed] [Google Scholar]
  45. Stein A., Raoult D. Pigeon pneumonia in Provence: a bird-borne Q Fever outbreak. Clin. Infect. Dis. 1999;29:617–620. doi: 10.1086/598643. [DOI] [PubMed] [Google Scholar]
  46. Toma L., Mancini F., Di Luca M., Cecere J.G., Bianchi R., Khoury C., Quarchioni E., Manzia F., Rezza G., Ciervo A. Detection of microbial agents in ticks collected from migratory birds in central Italy. Vector Borne Zoonotic Dis. 2014;14:199–205. doi: 10.1089/vbz.2013.1458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Valkiunas G. CRC Press; Boca Raton, Florida, USA: 2005. Avian Malaria Parasites and Other Haemosporidia. [Google Scholar]
  48. Valkiūnas G., Iezhova T.A. Exo-erythrocytic development of avian malaria and related haemosporidian parasites. Malar. J. 2017;16(1):101. doi: 10.1186/s12936-017-1746-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Valkiūnas G., Ilgūnas M., Bukauskaitė D., Chagas C.R.F., Bernotienė R., Himmel T., Harl J., Weissenböck H., Iezhova T.A. Molecular characterization of six widespread avian haemoproteids, with description of three new Haemoproteus species. Acta Trop. 2019;197:1050–1051. doi: 10.1016/j.actatropica.2019.105051. [DOI] [PubMed] [Google Scholar]
  50. Žiegytė R., Markovets M.Y., Bernotienė R., Mukhin A., Iezhova T.A., Valkiūnas G., Palinauskas V. The widespread biting midge Culicoides impunctatus (Ceratopogonidae) is susceptible to infection with numerous Haemoproteus (Haemoproteidae) species. Parasites Vectors. 2017;10(1):397. doi: 10.1186/s13071-017-2317-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal for Parasitology: Parasites and Wildlife are provided here courtesy of Elsevier

RESOURCES