Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jul 30.
Published in final edited form as: Genesis. 2016 Jul 26;54(9):497–502. doi: 10.1002/dvg.22959

A new gain-of-function mouse line to study the role of Wnt3a in development and disease

Ravindra B Chalamalasetty 1, Rieko Ajima 2, Robert Garriock 1, Mark Kennedy 1, Lino Tessarollo 3, Terry P Yamaguchi 1
PMCID: PMC6667172  NIHMSID: NIHMS802811  PMID: 27411055

Summary

Wnt/β-catenin signals are important regulators of embryonic and adult stem cell self-renewal and differentiation and play causative roles in tumorigenesis. Purified recombinant Wnt3a protein, or Wnt3a-conditioned culture medium, has been widely used to study canonical Wnt signaling in vitro or ex vivo. To study the role of Wnt3a in embryogenesis and cancer models, we developed a Cre recombinase activatable Rosa26Wnt3a allele, in which a Wnt3a cDNA was inserted into the Rosa26 locus to allow for conditional, spatiotemporally defined expression of Wnt3a ligand for gain-of-function (GOF) studies in mice. To validate this reagent, we ectopically overexpressed Wnt3a in early embryonic progenitors using the T-Cre transgene. This resulted in up-regulated expression of a β-catenin/Tcf-Lef reporter and of the universal Wnt/β-catenin pathway target genes, Axin2 and Sp5. Importantly, T-Cre; Rosa26Wnt3a mutants have expanded presomitic mesoderm (PSM) and compromised somitogenesis and closely resemble previously studied T-Cre; Ctnnb1ex3 (β-cateninGOF) mutants. These data indicate that the exogenously expressed Wnt3a stimulates the Wnt/β-catenin signaling pathway, as expected. The Rosa26Wnt3a mouse line should prove to be an invaluable tool to study the function of Wnt3a in vivo.

Keywords: Wnt3a, growth factor, Primitve streak (PS), gastrulation, mouse embryo, pre-somitic mesoderm (PSM), stem cells, development

Introduction, Results and Discussion

Wnt proteins are lipid modified, secreted signaling molecules essential for self-renewal, differentiation, cell motility and cell proliferation in development and disease (Clevers et al., 2014; Clevers and Nusse, 2012; Kalani et al., 2008; ten Berge et al., 2011; Willert et al., 2003; Zeng and Nusse, 2010). Aberrant Wnt signaling is associated with several human diseases including cancer (Clevers and Nusse, 2012). In mammals there are 19 Wnt genes categorized into 12 conserved subfamilies (Wnt home page<http://wnt.stanford.edu>). Wnt ligands bind to Lrp and Frizzled cell-surface receptors to stabilize β-catenin, which then enters into the nucleus to bind to Tcf-Lef transcription factors to activate Wnt target genes (Logan and Nusse, 2004). The Wnt3a signal is transduced predominantly through β-catenin; however, Wnt3a has recently been shown to also signal through the Yap/Taz pathway, independently of β-catenin, to regulate various biological processes such as osteogenic differentiation, gene expression and cell migration (Park et al., 2015). Thus, in addition to its utility in the study of the Wnt/β-catenin signaling pathway, a transgenic Wnt3a GOF reagent may also prove useful for the study of alternative Wnt3a signaling pathways such as the Hippo pathway.

Wnt proteins are covalently modified by palmitate residue by the palmitoyl transferase enzyme, porcupine (Kadowaki et al., 1996). These post-translational modifications confer hydrophobicity to Wnt proteins, leading to the prediction that Wnts are short-range molecules that principally signal between neighboring cells (Clevers et al., 2014). Indeed, studies tracking the endogenous expression of Wnt3 protein in intestinal crypts suggests that Wnt3 predominantly functions as a short-range, graded, signal and does not freely diffuse (Farin et al., 2016). Wnt/β-catenin signaling is essential for the self renewal of embryonic stem cells (ESC), neural stem cells, haematopoietic stem cells, liver progenitors, skin stem cells, mammary gland stem cells, and intestinal stem cells (Clevers et al., 2014; Kalani et al., 2008; ten Berge et al., 2011; Willert et al., 2003). Wnt/β-catenin signaling also plays an important role in tissue regeneration, replenishing lost cells after normal tissue wear, injury and disease. Amongst the large Wnt protein family, Wnt3a has proven to be a popular choice to study Wnt signaling in mammalian cells. Conventionally, Wnt3a-conditioned media produced from L-cells, or purified recombinant Wnt3a, has been used to activate Wnt signaling in cell lines. Despite the widespread use of Wnt3a to stimulate Wnt/β-catenin signaling in vitro there are no mouse transgenic lines available to express Wnt3a in vivo.

Wnt3a is first expressed in the developing embryo at the blastocyst stage, and is subsequently expressed at PS stages in posteriorly located progenitor/stem cells that build the embryonic axis (Kemp et al., 2005; Takada et al., 1994). Null alleles of Wnt3a result in embryonic defects, apparent as early as the eighth day of gestation with a loss of PSM, which later manifests in a dramatic truncation of the embryonic axis (Takada et al., 1994). The defects in PSM development are due to defective β-catenin/Tcf1-Lef1 signaling as embryos lacking β-catenin in the PS or Tcf1/Lef1 double mutants display phenotypes similar to the Wnt3a null phenotype (Dunty et al., 2008; Galceran et al., 1999). Furthermore, Wnt3a-like phenotypes also arise when the Wnt/β-catenin target genes, Brachyury (T), or Sp5/Sp8 are mutated (Dunty et al., 2014; Yamaguchi et al., 1999). Conversely, activation of Wnt/β-catenin signaling in the PS using a conditional GOF allele of Ctnnb1 results in an expanded PSM, elevated expression of the Wnt target genes Brachyury (T) and Sp5, and the β-catenin/Tcf-Lef β-gal reporter, and can partially rescue the Wnt3a mutant phenotype (Aulehla et al., 2008; Dunty et al., 2008; Harada et al., 1999). As so much is known about the role of Wnt3a signaling in PSM formation, the PSM serves as an ideal tissue to characterize the effects of a transgenic Wnt3a-expressing reagent.

A gain-of-function allele of Wnt3a was generated by targeting a floxed-STOP-Wnt3a cassette into the Rosa26 locus by homologous recombination in ESCs (Fig. 1A). This allele is hereafter referred to as Rosa26Wnt3a. Positively targeted ESC clones were confirmed by Southern blot analysis. The correctly targeted construct generated 5.9kb and 11.6kb fragments, when hybridized with 5′ and 3′ probes respectively, in addition to a 15.6kb WT fragment (Fig. 1B and 1C). A PCR-based genotyping protocol was also developed to detect the WT and Rosa26Wnt3a knock-in (KI) allele (Fig. 1D). >20 positively targeted ESC clones were identified. Positive clones were injected into albino C57BL6 blastocysts to generate chimeric mice (F0). Male chimeras were crossed to C57Bl6 females to test for germline transmission of the targeted allele. F1 mice were genotyped by Southern blot analysis. Rosa26Wnt3a/+ heterozygotes were intercrossed to generate homozygous Rosa26Wnt3a/Wnt3a animals. Both heterozygous and homozygous animals were viable and fertile and indistinguishable from WT animals based on morphological features and fertility.

Figure 1. Schematic view of construction of Rosa26Wnt3a gain-of-function allele.

Figure 1

Open in a new tab

(A) Schematic diagram of targeting strategy to insert mWnt3a-IRES-AcGFP-Nuc between exons 1 and 2 of Rosa26 for conditional gene expression. Targeting vector comprised of “Splice acceptor-CAG promoter-LoxP-TK Neo-STOP-LoxP-Wnt3a-FRT-IRES AcGFP-Nuc-FRT-pA” was targeted to intron1 of the Rosa26 locus by homologous recombination. Black rectangles indicate the site of 5′ and 3′ probes used for Southern blot analysis. For PCR genotyping, oligonucleotide pairs Rosa10; Rosa11 were used to detect the wildtype (WT) allele and Rosa10; R26R2 were used for the knock-in allele (KI). Primer pairs StopF; mWnt3aR were used to specifically detect the KI allele. E; EcoR1 (B,C) Representative Southern blot analysis of positively targeted ESCs. Genomic DNA from Rosa26Wnt3a/+ and WT (+/+) cells was digested with EcoR1 enzyme and Southern blot was performed using 5′ and 3′ probes as shown in (A). Upon EcoR1 digestion, the WT locus generated a 15.6Kb fragment, while the targeted locus generated 5.9Kb and 11.6Kb DNA fragments as detected by 5′ Probe and 3′Probe. (D) Representative PCR genotyping of Rosa26Wnt3a/+ and WT (+/+) alleles using Rosa10, Rosa11 and R26R2 oligos. The WT band migrates at 322bp and the KI band at 192 bp. As an alternative, the KI allele can also be amplified using StopF and mWnt3aR oligos to generate a 407bp amplicon.

To determine if Wnt3a could be ectopically expressed from the Rosa26Wnt3a locus, we crossed Rosa26Wnt3a/+ mice to the T-Cre driver strain to excise the Floxed-STOP cassette and permanently activate Wnt3a expression in T-Cre-expressing cells. This should include the PS and the neuromesodermal progenitors (NMPs) that give rise to the trunk paraxial mesoderm, spinal cord progenitors and all of their descendants (Garriock et al., 2015; Perantoni et al., 2005) (Fig. 2A). The T-Cre; Rosa26Wnt3a/+ mutants are easily identified at embryonic day (E) 8.5 by their gross morphology, as they possess an elongated PSM and an enlarged allantois (Fig. 2B). In addition, E9.5 T-Cre; Rosa26Wnt3a/+ mutants failed to turn and the allantois frequently appeared bulb shaped. Mutant embryos from this intercross were generated at the expected Mendelian ratio and littermate controls appeared phenotypically identical to WT embryos. To verify that the T-Cre; Rosa26Wnt3a/+ mutant phenotype is due to ectopic expression of Wnt3a, we examined Wnt3a mRNA expression in control and T-Cre; Rosa26Wnt3a/+ mutant littermates by whole-mount in situ hybridization (WISH). Wnt3a is expressed in the PS and dorsal neural folds in control embryos at E8.5 and E9.5 stages (Fig. 2B). However, in T-Cre; Rosa26Wnt3a/+ mutants, highly elevated ectopic expression of Wnt3a was observed throughout the embryonic trunk in a pattern that is consistent with the activity of T-Cre (Perantoni et al., 2005). To confirm that the IRES-AcGFP-Nuc accurately reflects the expression of Wnt3a driven by the Rosa26 locus (Fig. 1A), we examined embryos for GFP expression. Although direct GFP fluorescence was not readily detectable, GFP was indirectly visualized by immunostaining (Fig. S1). Cross-sections through the trunk region of T-Cre; Rosa26Wnt3a/+ mutants revealed GFP, and hence Wnt3a, expression in the expected neural and mesodermal domains (Fig. S1). The grossly elongated PSM observed in T-Cre; Rosa26Wnt3a/+ mutants closely resembled that observed in T-Cre; β-cateninGOF mutants (Aulehla et al., 2008; Dunty et al., 2008) suggesting that the Rosa26Wnt3a allele is functional and that Wnt3a is likely signaling via the Wnt/β-catenin pathway, at least in T-Cre progenitors. Although not investigated directly, it is formally possible that ectopic Wnt3a is also stimulating β-catenin-independent pathways.

Figure 2. Conditional expression of Wnt3a in T-Cre progenitors and their descendants.

Figure 2

Open in a new tab

(A) Schematic of LoxP-Cre mediated activation of Wnt3a expression in T-Cre-expressing PS progenitors. (B) Lateral views of control and T-Cre; Rosa26Wnt3a/+ embryos at E8.5 and E9.5 stages analysed by WISH for expression of Wnt3a mRNA. (C) β-gal staining of BATlacZ control and BATlacZ; T-Cre; Rosa26Wnt3a/+ embryos at E8.5 stage. Arrows indicate expression in allantois and scale bar is 200μM.

To assess whether the β-catenin/Tcf-Lef signaling pathway was stimulated by ectopic expression of Wnt3a, we examined the activity of the transgenic BATlacZ β-catenin/Tcf-Lef reporter in T-Cre; Rosa26Wnt3a/+ mutants (Nakaya et al., 2005). β-galactosidase (β-gal) staining of BATlacZ; T-Cre; Rosa26Wnt3a/+ mutants revealed expanded and enhanced β-gal expression in the trunk, PSM and PS, compared to BATlacZ embryos alone, suggesting that the ectopic overexpression of Wnt3a enhanced β-catenin/Tcf-Lef signaling activity. Remarkably, the enlarged allantois in these mutants was negative for BATlacZ expression despite the ectopic expression of Wnt3a throughout the T-Cre; Rosa26Wnt3a/+ mutant allantois (Fig. 2B). This result suggests that the allantois phenotype originates in the PS, or that the BATlacZ reporter is not responsive to Wnt signals in the allantois. Nevertheless, these data are consistent with exogenously expressed Wnt3a stimulating the Wnt/β-catenin/Tcf-Lef signaling pathway.

If exogenous Wnt3a is activating the Wnt/β-catenin pathway then the expression of known target genes of Wnt3a and β-catenin should also be ectopically activated. We examined the expression of the well-characterized Wnt/β-catenin target genes Axin2, Sp5 and T/Brachyury (Dunty et al., 2014; Ikeda et al., 1998; Kishida et al., 1998; Yamaguchi et al., 1999) in T-Cre; Rosa26Wnt3a/+ mutants and found that all three genes are up-regulated and anteriorly expanded in the caudal embryo (Fig. 3A and 3B). These expression patterns are highly reminiscent of those observed when β-catenin is constitutively activated by T-Cre and suggests that ectopic Wnt3a may be similarly maintaining PSM progenitors and suppressing somitogenesis (Dunty et al., 2008). Indeed, examination of T-Cre; Rosa26Wnt3a/+ embryos for expression of the segmentally expressed, somite marker Uncx4.1 revealed a compressed Uncx4.1 expression domain and fewer segments, compared to controls (Fig. 3B). Our data suggests that exogenously expressed Wnt3a from our novel Rosa26Wnt3a mouse line is behaving similarly to endogenous Wnt3a by stimulating the Wnt/β-catenin pathway.

Figure 3. Conditional expression of Wnt3a results in up-regulated Wnt target genes and inhibition of somitogenesis.

Figure 3

Open in a new tab

WISH analysis of Axin2, Sp5, T and Uncx4.1 expression in E8.5 control and T-Cre; Rosa26Wnt3a/+ embryos. Lateral views of whole embryos and dorsal views of the caudal end of the same embryo are shown. Scale bars indicate 200μM.

We conclude that this Rosa26Wnt3a mouse line will be a useful reagent for the study of Wnt/β-catenin signaling during early embryonic development, organogenesis and pathogenesis.

Methods

Construction of Wnt3a gain-of-function (Rosa26Wnt3a) mice

Construction of targeting vectors, targeting and screening of ESCs were performed as described previously (Cha et al., 2014). CTV plasmid (Klaus Rajewsky, Addgene Plasmid# 15192)(Thai et al., 2007) was modified by replacing IRES-eGFP with IRES2-AcGFP-Nuc cassette isolated from pIRES2-AcGFP-Nuc (Clontech, Cat#632515). mWnt3a cDNA from pCIG-mWnt3a was subcloned and inserted into Asc1 restriction site. For gene targeting, SgfI- linearized targeting vector was electroporated into Bruce-4 C57BL6 ES cells and selected for G418 resistance. Genomic DNA was isolated from positively targeted ES cell colonies, digested with EcoR1 and probed with 5′ probe and 3′ probe (Fig. 1A). For Southern blot analysis, DIG labeled probes were synthesized and detected according to manufacturer’s recommendation (Roche). Positively selected ES cells were then injected into albino C57BL6 blastocysts and later transferred into the uteri of pseudopregnant recipients to obtain chimeric mice. For colony expansion, male chimeras were crossed to albino C57BL6 females and genotyped by Southern blot analysis and PCR genotyping (Fig. 1B–1D). The following primers were used for PCR genotyping:

  • Rosa10- 5′CTCTGCTGCCTCCTGGCTTCT3′,

  • Rosa11- 5′CGAGGCGGATCACAAGCAATA3′,

  • R26R2- 5′GCGAAGAGTTTGTCCTCAACC3′, Product size for WT allele: Rosa10+Rosa11= 322bp, Rosa26Wnt3a allele: Rosa10+R26R2=192bp,

  • StopF- 5′ GCCTTGACTAGAGATCATAATCAGC 3′

  • mWnt3aR- 5′ ACAGCCAAGGACCACCAGA 3′,

product size for WT allele-no band, Rosa26Wnt3a allele: 407bp. Refer to Fig. 1A for location of the primers. We also confirmed that the Frt sites in the targeting vector were functional in vitro. The targeting vector was transformed into EL250 E. coli strain, which has arabinose inducible flpe gene and colonies were picked to isolate plasmids and confirmed that the cassette flanked by FRT sites was removed. This mouse reagent will be made available to the research community upon acceptance of this manuscript.

Mice

Tg(T-Cre)1Lwd and BATlacZ mice were previously described (Nakaya et al., 2005; Perantoni et al., 2005). Rosa26Wnt3a mice were maintained on C57BL6 background as heterozygotes or homozygotes. To generate T-Cre; Rosa26Wnt3a/+ mutants, T-Cre mice were crossed with Rosa26Wnt3a/+, and wildtype and mutant littermates were dissected on embryonic day (E) 8.5 and 9.5. Embryos were dissected in PBS, fixed for overnight in 4% Paraformaldehyde at 4°C, and dehydrated in a graded Methanol series and stored in 100% Methanol at −20°C. Although mutant embryos ectopically expressed Wnt3a and AcGFP simultaneously in T-Cre progenitors, direct GFP fluorescence was not readily detectable. All animal experiments were performed according to the Guide for the Care and Use of Laboratory Animals (National Academies Press; 8th editions).

Whole mount In Situ Hybridization and Immunohistochemistry

For Whole mount In situ Hybridization (WISH), embryos were rehydrated in a graded Methanol series. One-color whole mount in situ hybridization was performed as described previously (Biris et al., 2007; Biris and Yamaguchi, 2014). T, Axin2 and Sp5 DIG labeled antisense RNA probes were synthesized from linearized DNA templates using digoxigenin (DIG) and RNA polymerase. DIG-labeled probes were detected using alkaline phosphate (AP) conjugated secondary antibodies and AP substrate (BM purple, Roche). Embryos were photographed using a Zeiss AxioCam HRc camera on a Leica MZFLIII microscope and processed with Axiovision software. Photographed embryos are representative of at least three replicates. For immunohistochemistry, embryos were fixed briefly in 4% Para-formaldehyde for 30 minutes and passed through 20% sucrose for over-night at 4°C and frozen blocks were prepared in OCT followed by 5μM sections as described previously using standard protocols (Chalamalasetty et al., 2014). For immunohistochemistry, sections were incubated using Rabbit anti-GFP (eBioscience, #14-6774-63, 1:100) and Mouse anti-Sox2 (R&D Systems, #mab2018,1:100) followed by Goat anti-rabbit Alexa flour 488 (1:500) and Goat anti-mouse Alexa flour 567 (1:500) antibodies. Slides were counter stained with 1 nM DAPI (Molecular probes) and mounted using aqua poly/mount (Polysciences Inc.) Images were photographed using Zeiss AxioplanII microscope.

β-galactosidase staining

Whole-mount β-galactosidase staining was performed as previously described (Chalamalasetty et al., 2014; Whiting et al., 1991). Embryos were dissected in PBS and fixed briefly in 1% Formaldehyde, 0.2% Glutaraldehyde, 2mM MgCl2, 5mM EGTA and 0.02% NP-40 for 30 min at room temperature and washed 3 times in PBS plus 0.02% NP-40. Embryos were stained in 5mM K3Fe(CN)6, 5mM K4Fe(CN)6, 2mM MgCl2, 0.01% Sodium deoxycholate, 0.02% NP-40 and 1mg/ml X-gal solution at 37°C for 5–30 min. Stained embryos were washed and postfixed in 4% Para-formaldehyde plus 0.2% Glutaraldehyde for 30 min at room temperature. Embryos were stored in 80% Glycerol/PBT.

Supplementary Material

Supp Fig S1. Figure S1. Characterization of AcGFP-Nuc expression in Rosa26Wnt3a gain-of-function allele.

Cross sections of E8.5 Control and T-Cre; Rosa26Wnt3a/+ mutant near trunk regions were stained for the expression of AcGFP-Nuc (Green) and Sox2 (Red). Arrows indicate expression in neural tube. Scale bar is 100μM.

Acknowledgments

We thank Ruth Wolfe for technical assistance with animal experiments. This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research.

References

  1. Aulehla A, Wiegraebe W, Baubet V, Wahl MB, Deng C, Taketo M, Lewandoski M, Pourquie O. A beta-catenin gradient links the clock and wavefront systems in mouse embryo segmentation. Nat Cell Biol. 2008;10:186–193. doi: 10.1038/ncb1679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Biris KK, Dunty WC, Jr, Yamaguchi TP. Mouse Ripply2 is downstream of Wnt3a and is dynamically expressed during somitogenesis. Dev Dyn. 2007;236:3167–3172. doi: 10.1002/dvdy.21342. [DOI] [PubMed] [Google Scholar]
  3. Biris KK, Yamaguchi TP. Two-color in situ hybridization of whole-mount mouse embryos. Methods Mol Biol. 2014;1092:17–30. doi: 10.1007/978-1-60327-292-6_2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cha J, Bartos A, Park C, Sun X, Li Y, Cha SW, Ajima R, Ho HY, Yamaguchi TP, Dey SK. Appropriate crypt formation in the uterus for embryo homing and implantation requires Wnt5a-ROR signaling. Cell Rep. 2014;8:382–392. doi: 10.1016/j.celrep.2014.06.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chalamalasetty RB, Garriock RJ, Dunty WC, Jr, Kennedy MW, Jailwala P, Si H, Yamaguchi TP. Mesogenin 1 is a master regulator of paraxial presomitic mesoderm differentiation. Development. 2014;141:4285–4297. doi: 10.1242/dev.110908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Clevers H, Loh KM, Nusse R. Stem cell signaling. An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control. Science. 2014;346:1248012. doi: 10.1126/science.1248012. [DOI] [PubMed] [Google Scholar]
  7. Clevers H, Nusse R. Wnt/beta-catenin signaling and disease. Cell. 2012;149:1192–1205. doi: 10.1016/j.cell.2012.05.012. [DOI] [PubMed] [Google Scholar]
  8. Dunty WC, Jr, Biris KK, Chalamalasetty RB, Taketo MM, Lewandoski M, Yamaguchi TP. Wnt3a/beta-catenin signaling controls posterior body development by coordinating mesoderm formation and segmentation. Development. 2008;135:85–94. doi: 10.1242/dev.009266. [DOI] [PubMed] [Google Scholar]
  9. Dunty WC, Jr, Kennedy MW, Chalamalasetty RB, Campbell K, Yamaguchi TP. Transcriptional Profiling of Wnt3a Mutants Identifies Sp Transcription Factors as Essential Effectors of the Wnt/beta-catenin Pathway in Neuromesodermal Stem Cells. PLoS One. 2014;9:e87018. doi: 10.1371/journal.pone.0087018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Farin HF, Jordens I, Mosa MH, Basak O, Korving J, Tauriello DV, de Punder K, Angers S, Peters PJ, Maurice MM, Clevers H. Visualization of a short-range Wnt gradient in the intestinal stem-cell niche. Nature. 2016;530:340–343. doi: 10.1038/nature16937. [DOI] [PubMed] [Google Scholar]
  11. Galceran J, Farinas I, Depew MJ, Clevers H, Grosschedl R. Wnt3a−/−-like phenotype and limb deficiency in Lef1(−/−)Tcf1(−/−) mice. Genes Dev. 1999;13:709–717. doi: 10.1101/gad.13.6.709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Garriock RJ, Chalamalasetty RB, Kennedy MW, Canizales LC, Lewandoski M, Yamaguchi TP. Lineage tracing of neuromesodermal progenitors reveals novel Wnt-dependent roles in trunk progenitor cell maintenance and differentiation. Development. 2015;142:1628–1638. doi: 10.1242/dev.111922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Harada N, Tamai Y, Ishikawa T, Sauer B, Takaku K, Oshima M, Taketo MM. Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 1999;18:5931–5942. doi: 10.1093/emboj/18.21.5931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S, Kikuchi A. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J. 1998;17:1371–1384. doi: 10.1093/emboj/17.5.1371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kadowaki T, Wilder E, Klingensmith J, Zachary K, Perrimon N. The segment polarity gene porcupine encodes a putative multitransmembrane protein involved in Wingless processing. Genes Dev. 1996;10:3116–3128. doi: 10.1101/gad.10.24.3116. [DOI] [PubMed] [Google Scholar]
  16. Kalani MY, Cheshier SH, Cord BJ, Bababeygy SR, Vogel H, Weissman IL, Palmer TD, Nusse R. Wnt-mediated self-renewal of neural stem/progenitor cells. Proc Natl Acad Sci U S A. 2008;105:16970–16975. doi: 10.1073/pnas.0808616105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kemp C, Willems E, Abdo S, Lambiv L, Leyns L. Expression of all Wnt genes and their secreted antagonists during mouse blastocyst and postimplantation development. Dev Dyn. 2005;233:1064–1075. doi: 10.1002/dvdy.20408. [DOI] [PubMed] [Google Scholar]
  18. Kishida S, Yamamoto H, Ikeda S, Kishida M, Sakamoto I, Koyama S, Kikuchi A. Axin, a negative regulator of the wnt signaling pathway, directly interacts with adenomatous polyposis coli and regulates the stabilization of beta-catenin. J Biol Chem. 1998;273:10823–10826. doi: 10.1074/jbc.273.18.10823. [DOI] [PubMed] [Google Scholar]
  19. Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004;20:781–810. doi: 10.1146/annurev.cellbio.20.010403.113126. [DOI] [PubMed] [Google Scholar]
  20. Nakaya MA, Biris K, Tsukiyama T, Jaime S, Rawls JA, Yamaguchi TP. Wnt3a links left-right determination with segmentation and anteroposterior axis elongation. Development. 2005;132:5425–5436. doi: 10.1242/dev.02149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Park HW, Kim YC, Yu B, Moroishi T, Mo JS, Plouffe SW, Meng Z, Lin KC, Yu FX, Alexander CM, Wang CY, Guan KL. Alternative Wnt Signaling Activates YAP/TAZ. Cell. 2015;162:780–794. doi: 10.1016/j.cell.2015.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Perantoni AO, Timofeeva O, Naillat F, Richman C, Pajni-Underwood S, Wilson C, Vainio S, Dove LF, Lewandoski M. Inactivation of FGF8 in early mesoderm reveals an essential role in kidney development. Development. 2005;132:3859–3871. doi: 10.1242/dev.01945. [DOI] [PubMed] [Google Scholar]
  23. Takada S, Stark KL, Shea MJ, Vassileva G, McMahon JA, McMahon AP. Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev. 1994;8:174–189. doi: 10.1101/gad.8.2.174. [DOI] [PubMed] [Google Scholar]
  24. ten Berge D, Kurek D, Blauwkamp T, Koole W, Maas A, Eroglu E, Siu RK, Nusse R. Embryonic stem cells require Wnt proteins to prevent differentiation to epiblast stem cells. Nat Cell Biol. 2011;13:1070–1075. doi: 10.1038/ncb2314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Thai TH, Calado DP, Casola S, Ansel KM, Xiao C, Xue Y, Murphy A, Frendewey D, Valenzuela D, Kutok JL, Schmidt-Supprian M, Rajewsky N, Yancopoulos G, Rao A, Rajewsky K. Regulation of the germinal center response by microRNA-155. Science. 2007;316:604–608. doi: 10.1126/science.1141229. [DOI] [PubMed] [Google Scholar]
  26. Whiting J, Marshall H, Cook M, Krumlauf R, Rigby PW, Stott D, Allemann RK. Multiple spatially specific enhancers are required to reconstruct the pattern of Hox-2.6 gene expression. Genes Dev. 1991;5:2048–2059. doi: 10.1101/gad.5.11.2048. [DOI] [PubMed] [Google Scholar]
  27. Willert K, Brown JD, Danenberg E, Duncan AW, Weissman IL, Reya T, Yates JR, 3rd, Nusse R. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature. 2003;423:448–452. doi: 10.1038/nature01611. [DOI] [PubMed] [Google Scholar]
  28. Yamaguchi TP, Takada S, Yoshikawa Y, Wu N, McMahon AP. T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm specification. Genes Dev. 1999;13:3185–3190. doi: 10.1101/gad.13.24.3185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zeng YA, Nusse R. Wnt proteins are self-renewal factors for mammary stem cells and promote their long-term expansion in culture. Cell Stem Cell. 2010;6:568–577. doi: 10.1016/j.stem.2010.03.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig S1. Figure S1. Characterization of AcGFP-Nuc expression in Rosa26Wnt3a gain-of-function allele.

Cross sections of E8.5 Control and T-Cre; Rosa26Wnt3a/+ mutant near trunk regions were stained for the expression of AcGFP-Nuc (Green) and Sox2 (Red). Arrows indicate expression in neural tube. Scale bar is 100μM.

NIHMS802811-supplement-Supp_Fig_S1.eps (27.7MB, eps)

RESOURCES