Skip to main content
The Journal of Neuroscience logoLink to The Journal of Neuroscience
. 2007 Jul 11;27(28):7429–7437. doi: 10.1523/JNEUROSCI.1307-07.2007

Lymphotoxin β Receptor (LtβR): Dual Roles in Demyelination and Remyelination and Successful Therapeutic Intervention Using LtβR–Ig Protein

Sheila R Plant 1,2,*, Heather A Iocca 1,*, Ying Wang 1, J Cameron Thrash 4, Brian P O'Connor 1, Heather A Arnett 1,2, Yang-Xin Fu 5, Monica J Carson 4, Jenny P-Y Ting 1,2,3,✉
PMCID: PMC6672621  PMID: 17626203

Abstract

Inflammation mediated by macrophages is increasingly found to play a central role in diseases and disorders that affect a myriad of organs, prominent among these are diseases of the CNS. The neurotoxicant-induced, cuprizone model of demyelination is ideally suited for the analysis of inflammatory events. Demyelination on exposure to cuprizone is accompanied by predictable microglial activation and astrogliosis, and, after cuprizone withdrawal, this activation reproducibly diminishes during remyelination. This study demonstrates enhanced expression of lymphotoxin β receptor (LtβR) during the demyelination phase of this model, and LtβR is found in areas enriched with microglial and astroglial cells. Deletion of the LtβR gene (LtβR−/−) resulted in a significant delay in demyelination but also a slight delay in remyelination. Inhibition of LtβR signaling by an LtβR–Ig fusion decoy protein successfully delayed demyelination in wild-type mice. Unexpectedly, this LtβR–Ig decoy protein dramatically accelerated the rate of remyelination, even after the maximal pathological disease state had been reached. This strongly indicates the beneficial role of LtβR–Ig in the delay of demyelination and the acceleration of remyelination. The discrepancy between remyelination rates in these systems could be attributed to developmental abnormalities in the immune systems of LtβR−/− mice. These findings bode well for the use of an inhibitory LtβR–Ig as a candidate biological therapy in demyelinating disorders, because it is beneficial during both demyelination and remyelination.

Keywords: demyelination, cuprizone, glia, Ltαβ, LtβR, therapy

Introduction

Tumor necrosis factor α (TNFα) and lymphotoxin α (Ltα) (also known as TNFβ) are part of the large TNF superfamily of ligands (Ware et al., 1995; Locksley et al., 2001; Zhang, 2004). Membrane-bound or soluble TNFα signals through TNFRI (also p55) and TNFRII (also p75) to elicit a wide variety of signals in many different cell types. Homotrimeric secreted Ltα also signals through TNFRI and TNFRII. Additionally, Ltα can interact with membrane-bound lymphotoxin β (Ltβ) to form a Ltαβ heterotrimer, which is specific for lymphotoxin β receptor (LtβR) (Crowe et al., 1994; Ware et al., 1995). Signaling through LtβR causes the activation of TNF receptor-associated factor adaptor molecules and induces signals through both the classical and alternative nuclear factor-κB pathways (Baud and Karin, 2001; Dempsey et al., 2003).

The roles of TNFα, Ltα, TNFRI, and TNFRII have been extensively investigated in numerous rodent models of demyelination (Ruddle et al., 1990; Korner et al., 1997; Liu et al., 1998; Probert et al., 2000; Arnett et al., 2001, 2003; Kassiotis and Kollias, 2001). Although TNFα and Ltα are upregulated in multiple sclerosis (MS) and are believed to play an important detrimental role in the pathology of disease (Raine et al., 1998), inhibition of TNFα in patients leads to symptom exacerbation (van Oosten et al., 1996; The Lenercept Multiple Sclerosis Study Group and The University of British Columbia MS/MRI Analysis Group, 1999; Robinson et al., 2001; Sicotte and Voskuhl, 2001), highlighting the need for a comprehensive understanding of the role of TNF family ligands and receptors in demyelinating disease.

Using inhibitors of LtβR signaling to examine the role of LtβR in experimental autoimmune encephalomyelitis (EAE), one report demonstrates that signaling by Ltαβ heterotrimers is important in demyelination (Gommerman et al., 2003). In these studies, T-cell function was believed to be the primary target of LtβR–Ig. Although these results highlight the involvement of infiltrating T cells in demyelination, the role of CNS-derived Ltαβ and LtβR is not known. In addition, the capacity of signaling via LtβR to affect reparative remyelination has not been determined.

In the current investigation, we used the cuprizone model to study the involvement of LtβR in demyelination and remyelination. Cuprizone-induced demyelination and remyelination occur without T-cell involvement. We previously used the cuprizone model to demonstrate the detrimental nature of TNFα and Ltα during demyelination and the beneficial effect of TNFα in the remyelination phase (Arnett et al., 2001; Plant et al., 2005). In the present study, we demonstrate detrimental effects of LtβR in cuprizone-induced demyelination. In addition, we tested the efficacy of inhibitors of LtβR signaling (LtβR–Ig) and found significant benefits of blocking the LtβR pathway in both demyelination and remyelination phases of the model. These findings strongly suggest that inhibition of LtβR signaling in MS patients may be a beneficial treatment option.

Materials and Methods

Animals.

C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and bred in house at the University of North Carolina (UNC) animal facility. LtβR−/− mice (Futterer et al., 1998), previously backcrossed to C57BL/6 for at least five generations, were imported from the University of Chicago and bred in house at the UNC animal facility. All procedures were conducted in accordance with National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of UNC at Chapel Hill. All mice were 8–10 weeks of age before the start of cuprizone treatment.

Treatment of mice.

Male LtβR−/− and C57BL/6 wild-type mice were fed ad libitum 0.2% cuprizone [oxalic bis(cyclohexylidenehydrazide)] (Sigma-Aldrich, St. Louis, MO) mixed into milled chow. Mice were treated for 3, 3.5, 4, or 5 weeks to study the demyelination process. For remyelination, mice were treated for 6 full weeks with cuprizone and then were returned to a diet of normal pellet chow for 1, 2, 4, or 6 weeks (7, 8, 10, or 12 weeks of total treatment). Untreated mice were maintained on a diet of normal pellet chow. This protocol was used for all studies with the exception of those involving inhibitors of LtβR signaling.

Two versions of murine LtβR–IgG (LtβR–human IgG and LtβR–mouse IgG) and their controls were kindly provided by Dr. J. Browning (Biogen Idec, Cambridge, MA) and have been described previously (Gommerman et al., 2003). Separate treatment paradigms were used for studies using LtβR–Ig fusion molecules. To study demyelination, mice were intraperitoneally injected on day −1 and weekly thereafter with 5 mg/kg of either LtβR–human IgG-1 Fc (LtβR–hIg) or human IgG as a control. To study remyelination, a posttreatment paradigm was used, in which mice were treated with cuprizone for 6 full weeks. After 5 weeks plus 2 d of cuprizone treatment (approximate height of demyelination) and weekly thereafter out to 10 weeks, mice were given intraperitoneal injections of either LtβR–mouseIgG-1 (LtβR–mIg) or matched control mouse IgG-1, MOPC-21. This murine version of LtβR–Ig has been shown to be less antigenic in the mouse (J. Browning, personal communication).

Tissue preparation and histopathological analysis.

Paraffin-embedded coronal brain sections were prepared from the fornix region of the corpus callosum. Luxol fast blue–periodic acid Schiff (LFB–PAS) stained sections were read by three double-blinded readers and graded on a scale from 0 (complete myelination) to 3 (complete demyelination), as described previously (Arnett et al., 2001; Plant et al., 2005).

Immunohistochemistry.

Detection of mature oligodendrocytes and microglia/macrophages was performed by immunohistochemistry (IHC) as described previously (Plant et al., 2005). Quantitative analyses of glutathione S-transferase π-positive (GSTπ+) and Ricinus communis agglutinin-1-positive (RCA-1+) cells were restricted to a 0.033 mm2 area at midline corpus callosum. Only immunopositive cells with an observable 4′,6′-diamidino-2-phenylindole-stained nucleus were included in the quantification. Cell counts are averages of at least 9 and up to 14 mice per time point. Myelinated fibers were detected by immunohistochemistry with a primary antibody to myelin basic protein (MBP) (diluted 1:1000; Sternberger Monoclonals, Lutherville, MD) followed by fluorescein-conjugated anti-mouse IgG (Invitrogen, Carlsbad, CA) diluted 1:1000.

Dual in situ hybridization/immunohistochemical analysis.

After cuprizone treatment, mice were perfused with RNase-free PBS and then 4% paraformaldehyde. Brains were removed and incubated in fixative until mounted for cryosectioning. Detection of mRNA for LtβR was performed by in situ hybridization (ISH) on free-floating brain cryosections as described previously (Schmid et al., 2002). Briefly, 25 μm sections were hybridized overnight at 55°C with 33P-labeled riboprobes (107 cpm/ml). Excess probe was removed by successive washing with 0.03 m NaCl, 0.003 m sodium citrate (2× SSC) containing 10 mm β-mercaptoethanol (β-ME), followed by a 1 h incubation with ribonuclease at 37°C, a 2 h incubation at 55°C with 0.5× SSC, 50% formamide, and 10 mm β-ME, and finally by a 1 h incubation at 68 C in 0.1× SSC, 5 mm β-ME and 5% sarcosyl. Myeloid cells and blood vessels were identified by their ability to bind biotinylated tomato lectin (Sigma, St. Louis, MO), and visualized by standard streptavidin–horseradish peroxidase methodology. Tissue sections were air dried onto superfrost plus slides (Fisher Scientific, Hampton, NH) and coated with Ilford K-5 emulsion (Polysciences, Warrington, PA). After 3 weeks, the emulsion-coated slides were developed with Kodak D19 developer and fixative (Fisher Scientific). Mayer's hematoxylin was used to visualize cellular nuclei, before dehydrating and preserving tissues sections under glass coverslips with Permount. Emulsion grains were counted in six microscopy fields per tissue section. Tissue sections from at least three mice were quantified. In each experiment, the basal (nonspecific) levels of grain counts were determined from quantifying grains over ventricles and areas without tissues. Induced expression was defined as threefold increase in grains per microscopic field.

To discern the cell types that express LtβR, the same tissue sections were also immunolabeled with either tomato lectin to visualize microglia, macrophages, and blood vessels or antibody to glial fibrillary acidic protein (GFAP) to visualize astrocytes. All immunolabeled cells were visualized by horseradish peroxidase staining (indicated by brown stain), whereas cells expressing the LtβR transcript were identified by black grains generated by in situ hybridization. Blood vessels are readily distinguished from microglia and macrophages by their tubular structure. Tomato lectin does not distinguish between microglia and macrophages.

Reverse transcription-PCR and quantitative real-time reverse transcription-PCR.

Total RNA was isolated from a dissected region of the brain containing the corpus callosum of wild-type and LtβR−/− mice at several points during and after cuprizone treatment. RNA isolation was performed using the Qiagen (Valencia, CA) RNeasy kit under RNase-free conditions. Reverse transcription (RT)-PCR for LIGHT (homologous to lymphotoxins, exhibits inducible expression, and competes with herpes simplex virus glycoprotein D for the herpes-virus entry mediator, a receptor expressed by T lymphocytes) was performed in 20 μl reactions using the following primers: 5′ primer, CTGGCATGGAGAGTGTGGTA; 3′ primer, GATACGTCAAGCCCCTCAAG.

TaqMan 5′ nuclease quantitative real-time PCR assays were performed using an ABI Prism 7900 sequence-detection system (Applied Biosystems, Foster City, CA) in a 15 μl reaction with universal master mix (Invitrogen), 200 nm LtβR target primers, and 100 nm probe. LtβR-specific primers were designed to span intron–exon junctions to differentiate between cDNA and genomic DNA. The primers and probe used to detect mouse LtβR were as follows: 5′ primer, GTACTCTGCCAGCCTGGCACAGAAGCCGAGGTCACAGATG; 3′ primer, GGTATGGGGTTGACAGCGGGCTCGAGGGGAGG; probe, 6-carboxyfluorescein (Fam)-ACGTCAACTGTGTCCC-6-carboxytetramethylrhodamine (Tamra). The primers and probe for mouse 18S ribosomal RNA were as follows: 5′ primer, GCTGCTGGCACCAGACTT; 3′ primer, CGGCTACCACATCCAAGG; probe, Fam-CAAATTACCCACTCCCGACCCG-Tamra. Thermal cycle parameters were optimized to 2 min at 50°C, 2 min at 95°C, and 40 cycles comprising denaturation at 95°C for 15 s and annealing–extension at 56°C for 1.5 min. Reactions for 18S were performed alongside LtβR during each experiment and used to normalize for amounts of cDNA.

Statistical analysis.

Unpaired Student's t tests were used to statistically evaluate significant differences. Data are expressed as mean ± SEM.

Results

LtβR and LIGHT expression in the brain

To assess LtβR expression in the cuprizone model, we performed quantitative real-time RT-PCR to examine the level of LtβR in the corpus callosum and surrounding tissue in untreated and cuprizone-treated mice. Low levels of LtβR were detected in control untreated mice, whereas the levels of LtβR rose moderately throughout demyelination but were then reduced to baseline levels during the remyelination phase (Fig. 1A).

Figure 1.

Figure 1.

Upregulation of LtβR during demyelination and inflammation. A, Upregulation of LtβR during demyelination and inflammation. Quantitative real-time RT-PCR analysis demonstrates an upregulation of LtβR mRNA expression in wild-type mice during cuprizone treatment (through week 5) and a decline to baseline levels during remyelination (weeks 7–10). B, Localization of LtβR mRNA by ISH during cuprizone treatment. At the level of autoradiogram analysis, LtβR mRNA expression is not detected by in situ hybridization in brains from untreated wild-type mice (i). Induction of LtβR mRNA is weakly detected within the corpus callosum of mice treated for 3 weeks (ii), and robust induction of LtβR is seen in the same regions in brains from mice treated for 5 weeks (iii). C, Microscopic examination of the same brain sections shows LtβR expression is highest in regions and time points with a large accumulation of microglia/macrophages. In i–vi, nuclei are visualized by hematoxylin (blue) and LtβR expression by 33P-labeled riboprobes (dark grains within the emulsion). In i–iii, microglia, blood vessels, and macrophages are visualized with tomato lectin (brown), whereas in iv–vi, astrocytes are visualized with GFAP antibodies (brown). In all panels, the focal plane is optimized to visualize the riboprobe-induced grains within the emulsion.

Numerous strategies to detect LtβR protein expression were used, including immunoblot, IHC, and flow cytometry. Unfortunately, high-quality specific antibodies for the detection of mouse LtβR by immunoblot or IHC have not been reported, and we verified that existing antibodies do not work in these assays. Although antibodies for flow cytometry have been reported (Crowe et al., 1994; Dejardin et al., 2002) for the staining of immune cells, flow cytometry of adult brain cells is exceedingly challenging, and the results appear suboptimal. Nonetheless, we performed flow cytometry for microglial (CD45+CD11b+) and astroglial (GFAP+) cell populations but were unable to obtain specific staining for LtβR by comparing brain cells isolated from wild-type versus LtβR−/− mice (supplemental Fig. 1, available at www.jneurosci.org as supplemental material). Because of the lack of appropriate serological reagents for the detection of LtβR protein, dual ISH/IHC analysis was used to simultaneously define the regions expressing the LtβR transcript and identify cell populations present in these regions during cuprizone treatment. LtβR mRNA expression was not detected in the CNS of untreated mice (Fig. 1Bi). By 3 weeks of cuprizone treatment, a low level of LtβR expression was detected in the corpus callosum region (Fig. 1Bii). By 5 weeks of treatment, robust expression of LtβR was detected throughout the corpus callosum and slightly weaker expression was detected in the striatal regions (Fig. 1Biii). By 3 weeks of cuprizone treatment, there was an increase in the hypercellularity of tomato lectin-stained cells in the corpus callosum, and this level was further enhanced at the 5 week time point, consistent with previous observations of robust microgliosis (Fig. 1Cii,Ciii). Comparison of regions with prominent microglia/macrophage accumulation at both time points revealed that robust LtβR ISH signal (black grains) was enhanced in all regions with strong induction of tomato lectin staining indicated by the brown coloration. Enhanced expression is defined as a threefold increase from controls in grain density. In a different set of samples, astrogliosis indicated by increased brown color attributed to GFAP immunoreactivity was observed at the 3 week time point, and it also became much more evident at the 5 week time point (Fig. 1Cv,Cvi). At the 3 week time point, there was little colocalization of grains with GFAP+ cells (Fig. 1Cv), but, at the 5 week time point (Fig. 1Cvi), GFAP+ cells were accompanied by LtβR grains. This indicates that, at the 3 week time point before the dramatic increase in hypercellularity, LtβR expression is preferentially detected in regions enriched for lectin-positive cells (Fig. 1, compare Cii, Cv). However, after 5 weeks of treatment, LtβR expression is most intense in areas enriched for microglia/macrophages, but it is also increased in areas of astrogliosis.

Because the membrane-bound ligand LIGHT (Granger and Ware, 2001) has the ability to interact with LtβR, at least in the periphery, we analyzed LIGHT expression levels by RT-PCR during cuprizone treatment. Although LIGHT is found at high levels in the control spleen and thymus, negligible levels were found in the brains of untreated or cuprizone-treated mice (Fig. 2A). In addition, LIGHT is not regulated by the presence of LtβR because mice lacking LtβR express similar levels of LIGHT in the brain (Fig. 2B). This suggests that LIGHT does not play a significant role during cuprizone-induced inflammation. This is similar to the conclusion reached by others using the EAE model (Gommerman et al., 2003).

Figure 2.

Figure 2.

PCR analysis of LIGHT during cuprizone treatment. A, RT-PCR for the ligand LIGHT was performed on cDNA from untreated and cuprizone-treated wild-type mouse brain. As controls, untreated thymus and spleen were analyzed. Representative results show that very low levels of LIGHT mRNA exist in the untreated and cuprizone-treated brain. B, RT-PCR on wild-type (WT) and LtβR−/− untreated (untrt) and treated brain cDNA demonstrate that the lack of LtβR has no effect on LIGHT RNA levels.

Delayed demyelination in LtβR−/− mice

To analyze the role of LtβR in demyelination, cuprizone-treated LtβR−/− mice were compared with treated wild-type mice. A significant delay in demyelination was observed in the LtβR−/− mice relative to wild-type mice, as assessed by LFB–PAS staining (Fig. 3A). These data indicate that signaling through LtβR exacerbates the inflammatory demyelinating process. This delay could be seen as early as 3 weeks (p < 0.02) of cuprizone treatment but was most pronounced at 3.5 weeks (p < 0.01) and 4 weeks (p < 0.001) of treatment and is clearly revealed by representative LFB–PAS images of wild-type and LtβR−/− mice at 4 weeks of treatment (Fig. 3B). Because the delay in demyelination in LtβR−/− mice is similar to the delay in demyelination seen in Ltα−/− mice (Plant et al., 2005), this suggests that membrane-bound Ltαβ signaling through the LtβR is involved in the demyelination process.

Figure 3.

Figure 3.

Time course of demyelination and remyelination in LtβR−/− and wild-type mice. A, LFB–PAS-stained paraffin sections were graded on a scale from 0 (normal myelination) to 3 (complete demyelination) by three double-blinded investigators. Each circle represents an individual mouse: open circles, C57BL/6 wild-type (Wt); filled circles, LtβR−/− mice. Horizontal lines indicate the median score of each group. Significant differences in demyelination were seen between wild-type and LtβR−/− mice at 3 weeks (p < 0.02), 3.5 weeks (p < 0.01), and 4 weeks (p < 0.001). Significant differences during remyelination were detected at 7 weeks (p < 0.001) and 10 weeks (p < 0.02). B, Representative LFB–PAS pictures at 4 weeks of treatment demonstrate the delay in demyelination in LtβR−/− mice (ii) compared with wild-type mice (i). Higher-magnification images of the corpus callosum of LtβR−/− (iv) and wild-type (iii) mice demonstrate the lack of myelinated fibers and increased inflammation in wild-type mice during demyelination.

Delayed remyelination in LtβR−/− mice

The ability of mature oligodendrocytes to remyelinate the corpus callosum was studied in LFB–PAS-stained paraffin sections from wild-type and LtβR−/− mice. Modest but significant differences in remyelination were observed between wild-type and LtβR−/− mice at 7 weeks (p < 0.001) and 10 weeks (p < 0.02) (Fig. 3A). By 12 weeks, LtβR−/− mice have remyelinated to the same extent as wild-type controls (p = 0.11). These differences during remyelination are <0.5 on the scale of severity of demyelination, whereas differences seen in studies of TNFα−/− versus wild-type mice were >1.5 on the scale (Arnett et al., 2001) and persisted up to 14 weeks (our unpublished data). We conclude that, although remyelination appears to be transiently delayed in LtβR−/− mice, it eventually occurs.

Delayed loss of oligodendrocytes in LtβR−/− mice during demyelination

To verify that the delay in demyelination observed by LFB–PAS is accompanied by changes in oligodendrocyte number, we performed immunohistochemistry for GSTπ, a marker shown to be specific for mature myelinating oligodendrocytes (Tansey and Cammer, 1991) on adjacent paraffin sections. GSTπ+ cells at the midline corpus callosum were quantitated. Abundant oligodendrocytes were detected in both wild-type and LtβR−/− untreated mice. As has been shown previously, the number of GSTπ+ oligodendrocytes is dramatically reduced after 3 weeks of cuprizone treatment (Mason et al., 2000; Arnett et al., 2002). This represents an actual loss of oligodendrocytes because these cells exhibit increased apoptosis rather than a simple loss of the marker (Arnett et al., 2002). However, after 3.5 weeks of treatment, significantly more oligodendrocytes were present in LtβR−/− mice compared with wild-type mice (p < 0.01) (Fig. 4A,B), indicating a delay in the death of oligodendrocytes in the absence of LtβR. No difference in oligodendrocyte number was found between wild-type and LtβR−/− mice at 4 weeks. These data are complementary to the LFB staining results (Fig. 3A). By 5 weeks of cuprizone treatment, few GSTπ+ oligodendrocytes were detected in the corpus callosum of wild-type and LtβR−/− mice. This data point is consistent with the severe demyelination shown in Figure 3A for both mouse strains at the 5 week time point.

Figure 4.

Figure 4.

Delayed loss of mature oligodendrocytes during demyelination in LtβR−/− mice. A, Mature oligodendrocytes were detected at midline corpus callosum of wild-type and LtβR−/− brains by GSTπ immunohistochemistry. More GSTπ+ cells were found in LtβR−/− mice compared with wild-type mice at 3 weeks (p = 0.09) (wild-type, gray bars; LtβR−/−, black bars). Significantly more GSTπ+ cells were found in LtβR−/− mice at 3.5 weeks (p < 0.03), although no differences in oligodendrocytes were found at 4 and 5 weeks of cuprizone treatment. After the removal of cuprizone, no differences in oligodendrocyte repopulation of the corpus callosum were observed between wild-type and LtβR−/− mice. B, Representative pictures of GSTπ+ cells from wild-type and LtβR−/− mice at 3 and 3.5 weeks of cuprizone treatment. C, Microglial/macrophage accumulation at midline corpus callosum is unaffected by LtβR. Microglia/macrophages were detected by RCA-1 lectin staining of paraffin sections from wild-type and LtβR−/− mice during demyelination and remyelination time points. No significant difference in numbers of RCA-1+ cells was observed between wild-type and LtβR−/− mice at any time point.

Normal oligodendrocyte repopulation of corpus callosum in LtβR−/− mice during remyelination

Although oligodendrocytes were rarely detected in the corpus callosum of 5 week cuprizone-treated mice, just 1 week after the removal of cuprizone (7 weeks), the corpus callosum was repopulated to ∼75% of the original number of mature oligodendrocytes. No difference in oligodendrocyte number was observed between wild-type and LtβR−/− mice. By week 10, the number of mature oligodendrocytes residing in the corpus callosum recovered to pretreatment levels in both wild-type and LtβR−/− mice. Thus, LtβR is not required for oligodendrocyte progenitor proliferation and maturation during the remyelination phase. This differs from our previous study that demonstrated a profound role for TNFα and TNFRII in the proliferation of oligodendrocyte progenitors (Arnett et al., 2001).

Recruitment of microglia/macrophage is not changed in LtβR−/− mice

Cuprizone induces a chronic inflammatory state in the brain including the recruitment of activated microglia and macrophages to the sites of insult (Matsushima and Morell, 2001). Paraffin sections from LtβR−/− and wild-type mice were stained with the lectin RCA-1, and microglia/macrophages at midline corpus callosum were quantitated. We found no difference between LtβR−/− and wild-type mice in the recruitment of activated microglia/macrophage during the demyelination or remyelination phases of this model (Fig. 4C).

Inhibition of functional LtβR reduces demyelination

It has been well established that mice lacking LtβR from birth have significant developmental abnormalities (Futterer et al., 1998). Functional inhibition of LtβR in wild-type mice is possible using a fusion decoy protein and has been shown to affect the time course of EAE as well as prevent disease relapse (Gommerman et al., 2003). To assess the validity of our findings in LtβR−/− mice demonstrating a detrimental role for LtβR during cuprizone-induced demyelination, we treated C57BL/6 mice with either LtβR–hIg fusion decoy protein or control human IgG during cuprizone treatment. LtβR–hIg was shown previously to effectively inhibit Ltαβ–LtβR signaling (Gommerman et al., 2003). Mice were pretreated with either LtβR–hIg or control human Ig 1 d before start of the cuprizone (day −1) and weekly thereafter by intraperitoneal injection (5 mg/kg) and were maintained on an ad libitum diet of 0.2% cuprizone for 3.5 weeks (Fig. 5A). Mice were then perfused, and paraffin brain sections were stained with LFB–PAS to assess the extent of demyelination at the midline corpus callosum. Mice treated with control human Ig were significantly more demyelinated than mice that received the LtβR–hIg inhibitor (p < 0.02) (Fig. 5B,Ci–Civ). Immunohistochemistry for MBP confirmed the increase of myelinated fibers in mice treated with LtβR–hIg relative to mice treated with control human Ig. In conclusion, demyelination in cuprizone-treated mice can be significantly delayed by inhibition of LtβR. This is similar to the effect observed in the EAE disease models using both mice and rats (Gommerman et al., 2003). Our data demonstrates that LtβR–hIg can reduce demyelination in a model without T-cell involvement.

Figure 5.

Figure 5.

Therapeutic inhibition of LtβR significantly delays demyelination. A, C57BL/6 mice were treated with 0.2% cuprizone for 3.5 weeks. Mice received weekly injections (indicated by small arrows) of either LtβR–hIg or control human Ig beginning at day −1 of cuprizone treatment. B, Significant differences in demyelination were observed between LtβR–hIg-treated and control human Ig-treated mice after 3.5 weeks of cuprizone treatment (p < 0.02). LFB–PAS-stained paraffin sections were graded on a scale of 0 (normal myelination) to 3 (complete demyelination) by three double-blinded investigators. Each circle represents an individual mouse: open circles, control human Ig-treated mice; filled circles, LtβR–hIg-treated mice. Horizontal lines indicate the median score of each group. C, Representative LFB–PAS pictures at 3.5 weeks of treatment demonstrate the delay in demyelination in control human Ig-treated mice (i) compared with LtβR–hIg-treated mice (ii). High-magnification images of the corpus callosum of control human Ig-treated mice (iii) and LtβR–hIg-treated mice (iv) demonstrate the lack of myelinated fibers and increased inflammation in control human Ig-treated mice during demyelination. Immunohistochemistry for MBP confirmed the presence of more myelinated fibers in LtβR–hIg-treated mice (vi) compared with control human Ig-treated mice (v).

Inhibition of LtβR enhances remyelination

Because our goal is to enhance the development of a therapeutic treatment for demyelinating disease, we investigated the ability of LtβR–Ig to alter the extent of remyelination after significant demyelination had already occurred. To investigate the role of LtβR in the process of remyelination, C57BL/6 mice were treated with cuprizone for 6 weeks. This period of cuprizone treatment reproducibly results in complete demyelination in all mice studied to date, including the wild-type C57BL/6 mice (Arnett et al., 2001; Plant et al., 2005). Because of the concern that human Fc might elicit an immune response in this prolonged experiment, a fusion protein consisting of LtβR–mIg was used in these studies. After 5 weeks plus 2 d of cuprizone treatment and weekly thereafter, mice were injected intraperitoneally with either LtβR–mIg or control mouse IgG-1. Cuprizone treatment was halted at the 6 week time point, and mice were returned to normal chow (Fig. 6A). Mice were killed after 10 weeks, and LFB-stained sections were analyzed as described above. Remarkably, mice treated with LtβR–mIg showed significantly enhanced remyelination (p < 0.007) relative to mice treated with the control mouse Ig as measured by LFB staining (Fig. 6B,Ci–Civ). Additionally, immunohistochemistry for MBP confirmed increased remyelination in mice treated with LtβR–mIg compared with control mouse Ig-treated mice (Fig. 6Cv,Cvi). The number of mature oligodendrocytes within the corpus callosum at 10 weeks was also quantitated. GSTπ-positive oligodendrocytes were modestly more prevalent in the corpus callosum of LtβR–mIg-treated mice compared with control mouse Ig-treated mice, and this difference is statistically significant (p < 0.04) (Fig. 6Cvii,Cviii). In conclusion, remyelination in cuprizone-treated mice was significantly enhanced by posttreatment with an inhibitor of LtβR signaling.

Figure 6.

Figure 6.

Therapeutic inhibition of LtβR significantly enhances remyelination in a posttreatment paradigm. A, C57BL/6 mice were treated with 0.2% cuprizone for 6 weeks and allowed to remyelinate for 4 weeks before they were killed. Mice received weekly injections of either LtβR–mIg or control mouse Ig beginning 5 weeks plus 2 d after the start of cuprizone treatment (the approximate height of demyelination), as indicated by small arrows. B, Remyelination was enhanced on inhibition of LtβR signaling. LFB–PAS-stained paraffin sections were graded on a scale of 0 (normal myelination) to 3 (complete demyelination) by three double-blinded investigators. Each circle represents an individual mouse: open circles, control mouse Ig-treated mice; filled circles, LtβR–mIg-treated mice. Horizontal lines indicate the median score of each group. Significant enhancement of remyelination was observed in LtβR–mIg-treated mice compared with mice treated with control mouse Ig (p < 0.007). C, Representative LFB–PAS pictures at 10 weeks demonstrate the enhanced remyelination in LtβR–mIg-treated mice (ii) compared with control mouse Ig-treated mice (i). High-magnification images of the corpus callosum of LtβR–mIg-treated (iv) and control mouse Ig-treated (iii) mice demonstrate the lack of myelinated fibers and greater inflammation in control mouse Ig-treated mice during remyelination. Immunohistochemistry for MBP confirmed enhanced remyelination in LtβR–mIg-treated mice (vi) compared with control mouse Ig-treated mice (v). Representative GSTπ-immunostained images of the corpus callosum demonstrating more oligodendrocytes in mice treated with LtβR–mIg inhibitor (viii) than mice treated with the control mouse Ig (vii).

Discussion

The results of our study demonstrate an exacerbatory role for LtβR in cuprizone-induced oligodendrocyte death and demyelination. Furthermore, they show a beneficial role of inhibitory LtβR–Ig proteins in both the demyelination and remyelination phases of this model. Initially, our comparison of LtβR−/− and wild-type mice demonstrates a strong exacerbatory role for LtβR during the demyelination phase, suggesting LtβR as a possible therapeutic target for treating demyelinating disorders. However, the moderate delay observed in LtβR−/− mice during remyelination raised concerns regarding the potential efficacy of using LtβR inhibitors to treat such disorders. Because of the severe developmental abnormalities in LtβR−/− mice, it was necessary to directly analyze LtβR inhibition in mice with an otherwise functional immune system and without the developmental abnormalities seen in LtβR−/− mice. The most important result of this study is the significant delay in demyelination and acceleration of remyelination induced by LtβR–Ig treatment of wild-type mice. The latter was observed in a posttreatment paradigm (Fig. 6). Despite the fact that mice exhibited complete demyelination at the initiation of posttreatment, LtβR–mIg significantly enhanced remyelination relative to treatment with control mouse Ig.

We recently reported that the presence of Ltα exacerbated demyelination induced by cuprizone treatment (Plant et al., 2005). We further showed that the lack of Ltα did not alter the course of remyelination or the proliferation of oligodendrocyte progenitors during the remyelination phase of the cuprizone model. Ltα can function as a homotrimeric molecule signaling through the TNF receptors, as well as a heterotrimeric molecule with Ltβ to signal through the LtβR. The role of TNF receptors in the cuprizone model has been analyzed previously (Arnett et al., 2001), but the role of LtβR in this model was unknown before this study.

Studies to assess the role of LtβR in normal or pathological states involving the CNS are limited. Using the Theilers murine encephalomyelitis virus model of demyelination, it has been shown that Ltα and LtβR are important for viral clearance and the prevention of demyelination within the CNS, but this role is primarily mediated by functional cytotoxic T cells, which require Ltα and LtβR for their development (Lin et al., 2003). Specific LtβR pathway inhibitors administered in the EAE model revealed a detrimental role of Ltαβ–LtβR signaling in demyelination, although the major cellular players in this model are also T cells (Gommerman et al., 2003).

In contrast to the above-mentioned disease models, cuprizone-induced demyelination is not a T-cell-mediated event. T cells are not prevalent during cuprizone-induced demyelination, and the onset of demyelination and remyelination is similar in recombination activating gene RAG-1−/− mice that lack T and B cells (Arnett et al., 2001; Matsushima and Morell, 2001). Although the CD4+ T-cell-mediated EAE models have provided significant insight, they have not always had predictive value for MS therapies. Furthermore, there is evidence to suggest that MS is not strictly a CD4+ Th1-mediated disease (Lassmann and Ransohoff, 2004), and some demyelinating lesions can be found in the brain that do not coincide with T-cell infiltration but are marked by glial infiltrates (Lucchinetti et al., 2000; Peterson et al., 2001; Barnett and Prineas, 2004). The demyelinating lesions in the cuprizone model of demyelination are also characterized by massive microglia/macrophage and astrocyte infiltrates without evidence of T cells and thus effectively mimic this subtype of MS lesion. Strikingly, in this report we also find LtβR upregulation primarily in the corpus callosum in which massive inflammation and demyelination is consistently observed (Fig. 1B). By in situ hybridization, LtβR was localized to areas enriched for activated microglia/macrophages (Fig. 1C), although some expression is also found in astroglial-enriched regions, suggesting that LtβR on glial cells actively participates in inflammation and demyelination during cuprizone treatment. The fact that mice lacking functional LtβR show delayed onset of demyelination reinforces this possibility.

In a previous publication, we used an antibody against Ltα to unequivocally demonstrate Ltα expression by astrocytes in the inflamed corpus callosum of cuprizone-treated mice (Plant et al., 2005). This result coupled with the present finding that microglia are a major source of LtβR expression suggests that Ltαβ–LtβR signaling between astrocytes and microglia is a primary mediator in the inflammatory demyelinating process that occurs during cuprizone treatment. In addition to Ltαβ, LtβR interacts with the membrane-bound ligand LIGHT. LIGHT has been studied to a lesser extent but appears to be localized primarily to T cells, immature dendritic cells, granulocytes, and monocytes (Gommerman and Browning, 2003). We show that LIGHT is present at very low to undetectable levels in the brain, and its expression level is not altered by the presence of LtβR or by cuprizone treatment (Fig. 2). These data suggest a scenario in which the Ltα produced by activated astrocytes binds and activates LtβR on microglia/macrophages. Because Ltα is known to signal through LtβR in a heterotrimeric membrane-bound complex with Ltβ and not in the soluble Ltα form (Ware et al., 1995), this interaction likely requires cell-to-cell contact at the site of inflammation and demyelination. The present study indicates that glial-derived Ltαβ–LtβR signaling plays an important role in the demyelination process. Considering the large numbers of microglia and astrocytes that infiltrate the corpus callosum from 3–6 weeks of cuprizone treatment, this cell–cell interaction is highly plausible (Hiremath et al., 1998; Matsushima and Morell, 2001).

Our data obtained in LtβR−/− mice indicate that LtβR has a significant exacerbatory effect on demyelination and a potentially modest beneficial effect during remyelination. This result is similar to our previous findings using Ltα−/− mice with respect to demyelination, but Ltα−/− mice remyelinated normally (Plant et al., 2005). There is evidence that mice lacking LtβR from birth have significant developmental abnormalities; LtβR−/− mice lack mesenteric lymph nodes, Peyer's patches, and colon-associated lymphoid tissues. In addition, T- and B-cell segregation is lost, follicular dendritic cell networks are not defined in the spleen, and antibody affinity maturation is defective (Futterer et al., 1998). It is known that LtβR exerts control over chemokine and cytokine synthesis (Chin et al., 2003), although the full impact on the CNS is not known. Furthermore, natural killer cells in LtβR−/− mice do not have surface expression of the NK1.1 receptor attributable to the proximity of the encoding gene and the Ltbr gene (Wu et al., 2001). For these reasons, it is possible that our results with LtβR−/− mice do not accurately reflect the true role of LtβR in inflammation and demyelination attributable to the developmental abnormalities found in LtβR−/− mice.

LtβR–Ig inhibitors have been successful in reducing disease severity in the EAE model of demyelination (Gommerman et al., 2003). The same inhibitory fusion Igs were used in conjunction with the cuprizone model here to analyze the effect of functional LtβR inhibition in wild-type C57BL/6 mice. Compared with human Ig protein-treated mice, LtβR–hIg-treated mice exhibited a significant delay in demyelination after 3.5 weeks of cuprizone treatment (Fig. 5B,C), providing support for the Gommerman et al. study (2003). Variations observed between wild-type mice in these studies are within the normal range for the cuprizone model (Figs. 3, 5, 6), and, for this reason, wild-type animals are included in each experiment. However, this study was undertaken using an EAE model, and it was postulated that the effects of LtβR–Ig were mediated primarily by its action on T cells. Because cuprizone is not a T-cell-mediated model, our study represents the first evidence that LtβR inhibition effects pathology other than that induced by T cells. The role of LtβR in remyelination had not been analyzed before this study. Mice treated with LtβR–mIg showed an increased number of GSTπ+ oligodendrocytes in the corpus callosum and were able to remyelinate more efficiently as determined by LFB and MBP staining (Fig. 6B,C). Thus, by inhibiting Ltα–LtβR signaling, both proliferation and maturation of oligodendrocyte progenitor cells were enhanced. The mechanism of action of LtβR–Ig is unclear but deserving of in depth analysis because it may unveil important regulatory events that lead to remyelination.

In conclusion, we hypothesize that LtβR on glial cells, likely through direct interaction with membrane Ltαβ heterotrimers on astrocytes, contribute to exacerbated demyelination and impede remyelination. This study bodes well for the use of LtβR–Ig as a candidate biological therapy in demyelinating disorders, because inhibition has dual beneficial outcomes, both delaying demyelination and promoting remyelination. This provides a substantial rationale to explore LtβR inhibitors for treating demyelinating disorders. The pharmacologic inhibition of TNFα, which once was believed to be strictly proinflammatory, was detrimental to MS patients and resulted in symptom exacerbation (van Oosten et al., 1996; The Lenercept Multiple Sclerosis Study Group and The University of British Columbia MS/MRI Analysis Group, 1999; Arnett et al., 2001). Since the realization that TNFα has dual roles, being both detrimental during demyelination but required for oligodendrocyte progenitor proliferation and remyelination (Liu et al., 1998; Arnett et al., 2001; Kassiotis and Kollias, 2001), the results of the clinical studies are easier to interpret. In contrast, we find that inhibition of Ltαβ–LtβR signaling is beneficial during both demyelination and remyelination, thus making lymphotoxin inhibitors better candidate biological therapies for the control of inflammatory demyelinating disorders.

Footnotes

This work was supported by National Institutes of Health Grants NS34190 (J.P.-Y.T.), NS39508 (M.J.C.), NS045735 (M.J.C.), and DK58891 (Y.-X.F.) and National Multiple Sclerosis Society Grant RG1785 (J.P.-Y.T.). H.A.I. is a fellow of the National Multiple Sclerosis Society (Grant FG1605A). B.P.O. is a fellow of the Irvington Institute for Immunological Research. We thank Jeff Browning and Biogen Idec (Cambridge, MA) for generously supplying LtβR–human IgG-1 Fc, LtβR–mouse IgG-1 Fc, and matched controls human Ig and MOPC-21, as well as providing a critical review of this manuscript.

References

  1. Arnett HA, Mason J, Marino M, Suzuki K, Matsushima GK, Ting JP. TNF alpha promotes proliferation of oligodendrocyte progenitors and remyelination. Nat Neurosci. 2001;4:1116–1122. doi: 10.1038/nn738. [DOI] [PubMed] [Google Scholar]
  2. Arnett HA, Hellendall RP, Matsushima GK, Suzuki K, Laubach VE, Sherman P, Ting JP. The protective role of nitric oxide in a neurotoxicant-induced demyelinating model. J Immunol. 2002;168:427–433. doi: 10.4049/jimmunol.168.1.427. [DOI] [PubMed] [Google Scholar]
  3. Arnett HA, Wang Y, Matsushima GK, Suzuki K, Ting JP. Functional genomic analysis of remyelination reveals importance of inflammation in oligodendrocyte regeneration. J Neurosci. 2003;23:9824–9832. doi: 10.1523/JNEUROSCI.23-30-09824.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barnett MH, Prineas JW. Relapsing and remitting multiple sclerosis: pathology of the newly forming lesion. Ann Neurol. 2004;55:458–468. doi: 10.1002/ana.20016. [DOI] [PubMed] [Google Scholar]
  5. Baud V, Karin M. Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol. 2001;11:372–377. doi: 10.1016/s0962-8924(01)02064-5. [DOI] [PubMed] [Google Scholar]
  6. Chin R, Wang J, Fu YX. Lymphoid microenvironment in the gut for immunoglobulin A and inflammation. Immunol Rev. 2003;195:190–201. doi: 10.1034/j.1600-065x.2003.00066.x. [DOI] [PubMed] [Google Scholar]
  7. Crowe PD, VanArsdale TL, Walter BN, Ware CF, Hession C, Ehrenfels B, Browning JL, Din WS, Goodwin RG, Smith CA. A lymphotoxin-beta-specific receptor. Science. 1994;264:707–710. doi: 10.1126/science.8171323. [DOI] [PubMed] [Google Scholar]
  8. Dejardin E, Droin NM, Delhase M, Haas E, Cao Y, Makris C, Li ZW, Karin M, Ware CF, Green DR. The lymphotoxin-beta receptor induces different patterns of gene expression via two NF-kappaB pathways. Immunity. 2002;17:525–535. doi: 10.1016/s1074-7613(02)00423-5. [DOI] [PubMed] [Google Scholar]
  9. Dempsey PW, Doyle SE, He JQ, Cheng G. The signaling adaptors and pathways activated by TNF superfamily. Cytokine Growth Factor Rev. 2003;14:193–209. doi: 10.1016/s1359-6101(03)00021-2. [DOI] [PubMed] [Google Scholar]
  10. Futterer A, Mink K, Luz A, Kosco-Vilbois MH, Pfeffer K. The lymphotoxin beta receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity. 1998;9:59–70. doi: 10.1016/s1074-7613(00)80588-9. [DOI] [PubMed] [Google Scholar]
  11. Gommerman JL, Browning JL. Lymphotoxin/light, lymphoid microenvironments and autoimmune disease. Nat Rev Immunol. 2003;3:642–655. doi: 10.1038/nri1151. [DOI] [PubMed] [Google Scholar]
  12. Gommerman JL, Giza K, Perper S, Sizing I, Ngam-Ek A, Nickerson-Nutter C, Browning JL. A role for surface lymphotoxin in experimental autoimmune encephalomyelitis independent of LIGHT. J Clin Invest. 2003;112:755–767. doi: 10.1172/JCI18648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Granger SW, Ware CF. Turning on LIGHT. J Clin Invest. 2001;108:1741–1742. doi: 10.1172/JCI14651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hiremath MM, Saito Y, Knapp GW, Ting JP, Suzuki K, Matsushima GK. Microglial/macrophage accumulation during cuprizone-induced demyelination in C57BL/6 mice. J Neuroimmunol. 1998;92:38–49. doi: 10.1016/s0165-5728(98)00168-4. [DOI] [PubMed] [Google Scholar]
  15. Kassiotis G, Kollias G. Uncoupling the proinflammatory from the immunosuppressive properties of tumor necrosis factor (TNF) at the p55 TNF receptor level: implications for pathogenesis and therapy of autoimmune demyelination. J Exp Med. 2001;193:427–434. doi: 10.1084/jem.193.4.427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Korner H, Lemckert FA, Chaudhri G, Etteldorf S, Sedgwick JD. Tumor necrosis factor blockade in actively induced experimental autoimmune encephalomyelitis prevents clinical disease despite activated T cell infiltration to the central nervous system. Eur J Immunol. 1997;27:1973–1981. doi: 10.1002/eji.1830270822. [DOI] [PubMed] [Google Scholar]
  17. Lassmann H, Ransohoff RM. The CD4-Th1 model for multiple sclerosis: a crucial re-appraisal. Trends Immunol. 2004;25:132–137. doi: 10.1016/j.it.2004.01.007. [DOI] [PubMed] [Google Scholar]
  18. Lin X, Ma X, Rodriguez M, Feng X, Zoecklein L, Fu YX, Roos RP. Membrane lymphotoxin is required for resistance to Theiler's virus infection. Int Immunol. 2003;15:955–962. doi: 10.1093/intimm/mcg094. [DOI] [PubMed] [Google Scholar]
  19. Liu J, Marino MW, Wong G, Grail D, Dunn A, Bettadapura J, Slavin AJ, Old L, Bernard CC. TNF is a potent anti-inflammatory cytokine in autoimmune-mediated demyelination. Nat Med. 1998;4:78–83. doi: 10.1038/nm0198-078. [DOI] [PubMed] [Google Scholar]
  20. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell. 2001;104:487–501. doi: 10.1016/s0092-8674(01)00237-9. [DOI] [PubMed] [Google Scholar]
  21. Lucchinetti C, Bruck W, Parisi J, Scheithauer B, Rodriguez M, Lassmann H. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann Neurol. 2000;47:707–717. doi: 10.1002/1531-8249(200006)47:6<707::aid-ana3>3.0.co;2-q. [DOI] [PubMed] [Google Scholar]
  22. Mason JL, Jones JJ, Taniike M, Morell P, Suzuki K, Matsushima GK. Mature oligodendrocyte apoptosis precedes IGF-1 production and oligodendrocyte progenitor accumulation and differentiation during demyelination/remyelination. J Neurosci Res. 2000;61:251–262. doi: 10.1002/1097-4547(20000801)61:3<251::AID-JNR3>3.0.CO;2-W. [DOI] [PubMed] [Google Scholar]
  23. Matsushima GK, Morell P. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 2001;11:107–116. doi: 10.1111/j.1750-3639.2001.tb00385.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Peterson JW, Bo L, Mork S, Chang A, Trapp BD. Transected neurites, apoptotic neurons, and reduced inflammation in cortical multiple sclerosis lesions. Ann Neurol. 2001;50:389–400. doi: 10.1002/ana.1123. [DOI] [PubMed] [Google Scholar]
  25. Plant S, Arnett H, Ting J. Astroglial-derived lymphotoxin-alpha exacerbates inflammation and demyelination, but not remyelination. Glia. 2005;49:1–14. doi: 10.1002/glia.20089. [DOI] [PubMed] [Google Scholar]
  26. Probert L, Eugster HP, Akassoglou K, Bauer J, Frei K, Lassmann H, Fontana A. TNFR1 signalling is critical for the development of demyelination and the limitation of T-cell responses during immune-mediated CNS disease. Brain. 2000;123:2005–2019. doi: 10.1093/brain/123.10.2005. [DOI] [PubMed] [Google Scholar]
  27. Raine CS, Bonetti B, Cannella B. Multiple sclerosis: expression of molecules of the tumor necrosis factor ligand and receptor families in relationship to the demyelinated plaque. Rev Neurol (Paris) 1998;154:577–585. [PubMed] [Google Scholar]
  28. Robinson WH, Genovese MC, Moreland LW. Demyelinating and neurologic events reported in association with tumor necrosis factor alpha antagonism: by what mechanisms could tumor necrosis factor alpha antagonists improve rheumatoid arthritis but exacerbate multiple sclerosis? Arthritis Rheum. 2001;44:1977–1983. doi: 10.1002/1529-0131(200109)44:9<1977::AID-ART345>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  29. Ruddle NH, Bergman CM, McGrath KM, Lingenheld EG, Grunnet ML, Padula SJ, Clark RB. An antibody to lymphotoxin and tumor necrosis factor prevents transfer of experimental allergic encephalomyelitis. J Exp Med. 1990;172:1193–1200. doi: 10.1084/jem.172.4.1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Schmid CD, Sautkulis LN, Danielson PE, Cooper J, Hasel KW, Hilbush BS, Sutcliffe JG, Carson MJ. Heterogeneous expression of the triggering receptor expressed on myeloid cells-2 on adult murine microglia. J Neurochem. 2002;83:1309–1320. doi: 10.1046/j.1471-4159.2002.01243.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sicotte NL, Voskuhl RR. Onset of multiple sclerosis associated with anti-TNF therapy. Neurology. 2001;57:1885–1888. doi: 10.1212/wnl.57.10.1885. [DOI] [PubMed] [Google Scholar]
  32. Tansey FA, Cammer W. A pi form of glutathione-S-transferase is a myelin- and oligodendrocyte-associated enzyme in mouse brain. J Neurochem. 1991;57:95–102. doi: 10.1111/j.1471-4159.1991.tb02104.x. [DOI] [PubMed] [Google Scholar]
  33. The Lenercept Multiple Sclerosis Study Group and The University of British Columbia MS/MRI Analysis Group. TNF neutralization in MS: results of a randomized, placebo-controlled multicenter study. Neurology. 1999;53:457–465. [PubMed] [Google Scholar]
  34. van Oosten BW, Barkhof F, Truyen L, Boringa JB, Bertelsmann FW, von Blomberg BM, Woody JN, Hartung HP, Polman CH. Increased MRI activity and immune activation in two multiple sclerosis patients treated with the monoclonal anti-tumor necrosis factor antibody cA2. Neurology. 1996;47:1531–1534. doi: 10.1212/wnl.47.6.1531. [DOI] [PubMed] [Google Scholar]
  35. Ware CF, VanArsdale TL, Crowe PD, Browning JL. The ligands and receptors of the lymphotoxin system. Curr Top Microbiol Immunol. 1995;198:175–218. doi: 10.1007/978-3-642-79414-8_11. [DOI] [PubMed] [Google Scholar]
  36. Wu Q, Sun Y, Wang J, Lin X, Wang Y, Pegg LE, Futterer A, Pfeffer K, Fu YX. Signal via lymphotoxin-beta R on bone marrow stromal cells is required for an early checkpoint of NK cell development. J Immunol. 2001;166:1684–1689. doi: 10.4049/jimmunol.166.3.1684. [DOI] [PubMed] [Google Scholar]
  37. Zhang G. Tumor necrosis factor family ligand-receptor binding. Curr Opin Struct Biol. 2004;14:154–160. doi: 10.1016/j.sbi.2004.03.003. [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Neuroscience are provided here courtesy of Society for Neuroscience

RESOURCES