Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Aug 3.
Published in final edited form as: J Nutr Biochem. 2014 Dec 5;26(4):337–344. doi: 10.1016/j.jnutbio.2014.10.016

Enhanced AMPK phosphorylation contributes to the beneficial effects of Lactobacillus rhamnosus GG supernatant on chronic alcohol-induced fatty liver disease

Min Zhang 1,2,3,#, Cuiling Wang 2,4,#, Chunhong Wang 2,5, Haiyang Zhao 1,3,6, Cuiqing Zhao 1,2,7, Yuhua Wang 1,2,*, Craig McClain 2,8, Wenke Feng 2,*
PMCID: PMC6679353  NIHMSID: NIHMS658436  PMID: 25622859

Abstract

Background:

We have previously demonstrated that Lactobacillus rhamnosus GG culture supernatant (LGGs) prevents acute alcohol exposure-induced hepatic steatosis and injury. The protective effects of LGGs were attributed to the improved intestinal barrier function leading to decreased endotoxemia. The purpose of this study was to determine whether LGGs was effective in protecting against chronic alcohol-induced hepatic steatosis and injury, and to evaluate the underlying mechanisms of LGGs on hepatic lipid metabolism.

Methods:

C57BL/6N mice were fed liquid diet containing 5% alcohol or pair-fed isocaloric maltose dextrin for 4 weeks. LGGs at a dose equivalent to 109 CFU/day/mouse was given in the liquid diet. Hepatic steatosis, liver enzymes and hepatic apoptosis were analyzed.

Results:

LGGs prevented alcohol-mediated increase in hepatic expression of lipogenic genes, sterol regulatory element binding protein-1 and Stearoyl-CoA desaturase-1 ; and increased the expression of peroxisome proliferator activated receptor-a, peroxisome proliferator-activated receptor gamma coactivator protein-1 α and carnitine palmitoyltransferase-1 leading to increased fatty acid β-oxidation. Importantly, chronic alcohol exposure decreased AMPK phosphorylation and increased acetyl-CoA carboxylase (ACC) activity, which were attenuated by LGGs administration. LGGs also decreased Bax expression and increased Bcl-2 expression, which attenuated alcohol-induced hepatic apoptosis. These LGGs regulated molecular changes resulted in the attenuation of chronic alcohol exposure-mediated increase in hepatic fat accumulation and liver injury.

Conclusions:

Probiotic LGG culture supernatant is effective in the prevention of chronic alcohol exposure-induced hepatic steatosis and injury. LGGs likely exerts its beneficial effects, at least in part, through modulation of hepatic AMPK activation and Bax/Bcl-2-mediated apoptosis.

Keywords: probiotics, alcohol, liver, lipid, AMPK

INTRODUCTION

Excessive alcohol exposure results in the development of fatty liver disease (steatosis). Although mild liver steatosis was initially considered to be generally benign, increasing evidence demonstrates that increased fat accumulation sensitizes the liver to a deleterious second “hit”, leading to progression to more advanced liver diseases, such as steatohepatitis, fibrosis, cirrhosis and even liver cancer (1, 11, 23). Eliminating or halting the hepatic fat accumulation may represent an attractive strategy for inhibition/treatment of alcoholic liver disease (ALD).

Our previous studies demonstrated that administration of probiotics improves liver enzymes in alcoholic steatohepatitis patients (19), and prevents or reverses alcohol-induced fatty liver and liver injury in experimental animals (32, 34). We further showed that Lactobacillus rhamnosus GG culture supernatant (LGGs) prevented acute alcohol-induced hepatic steatosis and injury (34). Mechanistic studies revealed that LGG, both the bacteria and secreted factors, attenuated alcohol-induced intestinal barrier dysfunction and endotoxemia (which may trigger a hepatic inflammatory response). However, whether LGGs can be used to prevent chronic alcohol-induced liver steatosis is unknown.

Alcohol induced fat accumulation occurs due to both increased in situ lipogenesis and reduced fatty acid β-oxidation (3, 5, 38). AMP-activated protein kinase (AMPK) is a key metabolic master switch which phosphorylates target enzymes involved in lipid metabolism in many tissues, including the liver (30, 39). It increases fatty acid oxidation by inactivating acetyl-CoA carboxylase (ACC). ACC is a rate limiting enzyme for fatty acid biosynthesis in the liver. It catalyzes the conversion of acetyl-CoA to malonyl-CoA, which is a precursor for the synthesis of fatty acids (31). Furthermore, AMPK also modulates sterol regulatory element binding protein-1 (SREBP-1) (39) and peroxisome proliferator activated receptor-α (PPAR-α) (20, 36), which are transcription factors playing a critical role in the regulation of the enzymes responsible for the synthesis of cholesterol, fatty acids, and triglycerides in the liver and other tissues. Alcohol ingestion caused a reduction of AMPK activity and increased fat accumulation in the liver (39). In this study, we showed that LGGs pretreatment increased hepatic AMPK phosphorylation and PPAR-α expression, decreased SREBP-1 expression and consequently attenuated alcohol-induced hepatic steatosis and injury.

MATERIAL AND METHODS

Culture of LGG.

LGG was purchased from American Type Culture Collection (ATCC 53103; Rockville, MD) and was cultured in Lactobacillus De Man, Rogosa, and Sharpe broth (MRS broth; Difco; BD, Sparks, MD) at 37°C in accordance with ATCC guidelines. LGGs was prepared as described in our previous study (34).

Animal model.

Male C57BL/6N mice were obtained from Harlan Laboratories (Indianapolis, IN). The mice were pair-fed liquid diet (Lieber DeCarli) for 4 weeks. The diet contains 17% of energy as protein, 40% as corn oil, 7.5% as carbohydrate, and 35.5% as either alcohol (alcohol-fed, AF) or isocaloric maltose dextrin (pair-fed, PF). LGGs at a dose at equivalent to 109 CFU/day/mouse was given to the mice in the liquid diet. Each group had 4–10 mice. Plasma and tissue samples were collected for assays. All mice were treated according to protocols reviewed and approved by the Institutional Animal Care and Use Committee of the University of Louisville.

Cell culture and treatment.

H4IIE, a hepatocarcinoma cell line, was purchased from ATCC. H4IIE cells were grown in EMEM supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, and 10% FBS, at 37°C in an atmosphere containing 5% CO2. H4IIE cells were treated with 100 mM ethanol or 1% LGGs for 24 hours, or pre-treated with an AMPK inhibitor, Compound C (25 μM), for 2 h followed by an incubation with 100 mM ethanol or 1% LGGs for additional 24 hours.

Biochemical assays.

Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured using ALT and AST Assay Kits (Thermo Fisher Scientific Inc., Middletown, VA), respectively. Plasma free fatty acids (FFA) were quantified using a commercial kit from Wako Chemicals (Richmond, VA).

Fatty liver assessment.

Liver triglyceride assay were performed as described in our previous study(34) using the Triglyceride Kit (Thermo Fisher Scientific Inc.). Liver FFA was assayed as described above. Fatty liver was also determined by Oil red O staining of frozen liver sections and then studied by light microscopy.

Liver apoptosis analysis.

Formalin-fixed paraffin liver sections were stained for terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) with the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Chemicon, CA, USA), according to the manufacturer’s instructions. At least five views in each slide were randomly selected and quantitated for positive staining. Five animals in each group were studied. Results were presented as TUNEL positive cells per 500 cells.

Western blot analysis.

Tissues were homogenized, and total protein was extracted using RIPA buffer (50 mM Tris-HCI, pH 7.4, 1% Triton X-100, 150 mM NaCI, 2 mM EDTA, 40 mM NaF, 4 mM Na3VO4, 1 mM PMSF, 1% protease inhibitor cocktail) and centrifuged at 14,000 g for 10 min. The supernatants were collected. Aliquots containing 30 μg protein were loaded onto 4–15% SDS-polyacrylamide gels. Proteins were transferred to nitrocellulose membrane. Membranes were probed using antibodies against phospho-AMPKα, phospho-ACC, AMPK, ACC (Cell Signaling, Danvers, MA), SREBP-1c , CPT-1, Bcl-2, Bax, β-actin and GAPDH (Santa Cruz Biotechnologies, Santa Cruz, CA). Protein bands were quantified by densitometry analysis with a normalization with β-actin, GAPDH or Pouceau S staining.

Quantitative Real time RT-PCR.

Total RNA was isolated from liver with Trizol according to manufacturer’s protocol (Invitrogen, Carlsbad, CA) and reverse-transcribed using GenAmp RNA PCR kit (Applied Biosystems, Foster City, CA). The cDNA was amplified in 96-well reaction plates with a SYBR green PCR Master Mix (Applied Biosystems) on an ABI 7500 real-time PCR thermo cycler. The sequences of forward and reverse primers are listed in Table 1. β-actin mRNA expression was used to normalize the obtained data. Relative mRNA expression was calculated using the △△Ct method.

Table 1.

Primer sequences for real-time RT-PCR

Gene Sequences (Forward/Reverse 5’−3’)
PPAR-α AGAGCCCCATCTGTCCTCTC ACTGGTAGTCTGCAAAACCAAA
PGC-1α AGACAAATGTGCTTCCAAAAAGAA GAAGAGATAAAGTTGTTGGTTTGGC
SCD-1 CCGGAGACCCTTAGATCGA TAGCCTGTAAAAGATTTCTGCAAACC
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
Open in a new tab

PPAR-α, peroxisome proiiferator activated receptor-α; PGC-1α, peroxisome proiiferator- activated receptor gamma coactivator protein-1 α; SCD-1, Stearoyl-CoA desaturase-1

Statistical analysis.

Data are expressed as means ± SE. ANOVA with Newman-Keuls multiple-comparison test was used for the determination of statistical significance. Differences between groups were considered significant at P < 0.05.

RESULTS

LGGs decreases chronic alcohol-induced hepatic lipid accumulation and liver injury.

To investigate the effect of LGGs on chronic alcohol-induced hepatic lipid accumulation, we measured hepatic steatosis with histological analysis and biochemical triglyceride determination. Mice exposed to chronic alcohol treatment had significantly increased hepatic lipid accumulation compared with control mice, as evaluated by Oil red O staining. However, LGGs treatment significantly attenuated fatty liver (Fig. 1A). Confirming the histological observations, we found that the hepatic triglyceride content was significantly elevated in alcohol-exposed mice compared with control mice. Pretreatment with LGGs markedly decreased the chronic alcohol-induced hepatic triglyceride accumulation (Fig. 1B). In addition, the levels of plasma and hepatic FFA were increased by chronic alcohol exposure, and these increases were blocked by LGGs supplementation (Fig. 1C and 1D). To assess liver injury, levels of liver enzymes were measured. Plasma ALT and AST levels were significantly elevated by alcohol exposure. LGGs pretreatment significantly attenuated these elevations (Fig. 2A and 2B). Taken together, LGGs treatment attenuated chronic alcohol-induced hepatic steatosis and liver injury.

Fig. 1.

Fig. 1.

Open in a new tab

Effects of LGGs treatment on chronic alcohol-induced liver steatosis. Mice were fed liquid diet containing 5% alcohol (AF) or pair-fed with isocaloric maltose dextrin (PF) for 4 weeks. LGGs was added to the diet in the treatment groups. Frozen liver sections of the mice were processed for staining with Oil red O (A). Liver triglyceride (B) and liver FFA (C) levels were determined. Plasma FFA levels were also measured (D). *P<0.05

Fig. 2.

Fig. 2.

Open in a new tab

Effects of LGGs treatment on alcohol-induced liver injury. Plasma ALT (A) and AST (B) were measured using ALT and AST Assay Kits, respectively. *P <0.05

LGGs down-regulates SREBP-1 and up-regulates PPAR-α.

SREBP-1 and PPAR-α are transcription factors in the regulation of hepatic lipid metabolism, and play central roles in de novo lipogenesis and fatty acid oxidation. To determine the effects of LGGs on the chronic alcohol exposure-induced lipid synthesis and clearance, we measured hepatic levels of SREBP-1 c protein and PPAR-α transcript levels. As shown in Figure 3A, chronic alcohol exposure markedly increased hepatic SREBP-1 c protein expression, which was prevented by LGGs supplementation. Alcohol feeding decreased hepatic PPAR-α and peroxisome proliferator-activated receptor gamma coactivator protein-1 α (PGC-1α) mRNA expression; this decrease was inhibited by LGGs supplementation (Fig. 3B). Furthermore, we found that LGGs treatment significantly decreased alcohol exposure-induced hepatic elevation of Stearoyl-CoA desaturase-1 (SCD-1) expression (Fig. 3C), which is a key enzyme responsible for fatty acid synthesis and a target of SREBP-1. On the other hand, LGGs pretreatment significantly increased carnitine palmitoyltransferase-1 (CPT-1) protein expression in the liver of chronic alcohol-exposed mice (Fig. 3D). Our results suggest that LGGs is effective in positively modulating chronic alcohol-induced alterations in lipogenesis and fat clearance mediated by SRBEP-1c and PPAR-α.

Fig. 3.

Fig. 3.

Open in a new tab

Effects of LGGs administration on hepatic expression in mice exposed to chronic alcohol. Protein levels of SREBP-1c were determined by Western blot, and the protein band densities were quantified by densitometry analysis (A). Hepatic mRNA levels of PPAR-α, PGC-1a (B) and SCD-1 (C) were analyzed by real-time RT-PCR. Protein levels of CPT-1 were analyzed by Western blot and quantified (D). *P<0.05

Effects of LGGs on hepatic AMPK signaling.

Previous studies showed that AMPK activation plays a critical role in hepatic lipid metabolism by regulating transcription factors including SREBP-1c and PPAR-α. Phosphorylation at Thr-172 of AMPK (p-AMPKα) is known to activate AMPK (15). Therefore, we measured the hepatic phosphorylation levels of AMPK in mice treated with chronic alcohol and LGGs. As expected, alcohol markedly decreased hepatic AMPK phosphorylation, and this was reversed by LGGs supplementation (Fig. 4A). It is known that activation of AMPK decreases ACC activity via phosphorylation (25, 31). As shown in Figure 4B, mice exposed to alcohol had a markedly lower level in ACC phosphorylation in the liver compared with control mice. Importantly, this decrease was completely inhibited by LGGs supplementation (Fig. 4B). To further confirm the effect of LGGs on AMPK-mediated ACC phosphorylation, we performed an in vitro study using H4IIE cells. Alcohol treatment decreased the levels of phosphorylated AMPK. Moreover, LGGs addition significantly inhibited this reduction (Fig. 5A). As expected, treatment with Compound C, an AMPK inhibitor, abolished LGGs-induced ACC phosphorylation (Fig. 5B), indicating an essential role of AMPK in the LGGs-mediated deactivation of hepatic lipogenic gene expression in the mice exposed to alcohol.

Fig. 4.

Fig. 4.

Open in a new tab

Effects of LGGs administration on hepatic AMPK and ACC phosphorylation in mice exposed to chronic alcohol. AMPK (A) and ACC phosphorylation (B) levels were determined by Western blot and quantified by densitometry analysis. *P<0.05

Fig. 5.

Fig. 5.

Open in a new tab

Effects of LGGs treatment on AMPK and ACC phosphorylation in H4IIE cells. H4IIE cells were treated with 100 mM ethanol or 1% LGGs for 24 hours, or pre-treated with AMPK inhibitor, Compound C (25 μM) for 2h followed by incubation with 100 mM ethanol or 1% LGGs for additional 24 hours. Protein levels of AMPK phosphorylation were determined by Western blot and quantified. (A) AMPK phosphorylation; (B) ACC phosphorylation (B). *P<0.05

LGGs attenuates alcohol-induced hepatic apoptosis.

Using TUNEL staining, we found the liver sections of the alcohol-fed mice exhibited an expected increase in apoptosis compared to wild type controls. LGGs pretreatment significantly decreased the TUNEL positive cells in the hepatic tissues (Fig. 6A). To determine the molecular mechanism by which chronic ethanol exposure induces greater hepatocyte apoptosis in control mice compared with that in LGGs-pretreated mice, the expression of anti-apoptotic and pro-apoptotic proteins was examined in pair-fed mice, alcohol-fed mice and LGGs pretreated alcohol-fed mice. As shown in Figure 6B, there was no significant alteration in Bcl-2 protein expression in alcohol-fed mice, but LGGs supplementation significantly increased hepatic Bcl-2 protein levels. By comparison, alcohol-feeding increased hepatic Bax protein levels, and this elevation was attenuated by LGGs supplementation (Fig. 6C).

Fig. 6.

Fig. 6.

Open in a new tab

Effects of LGGs treatment on alcohol-induced hepatic apoptosis. Liver apoptosis was evaluated by TUNEL staining. TUNEL-positive cells were quantitated by counting 5 randomly selected view fields and expressed as total TUNEL positive cells/500 cells (A). Protein levels of Bcl-2 (B) and Bax (C) were determined by Western blot and quantified. *P<0.05

DISCUSSION

We previously demonstrated that the probiotic strain, LGG, in the form of culture broth (containing live bacteria, LGG) provided effective treatment for alcohol-induced fat accumulation and injury in a mouse model of chronic alcohol exposure (32). Further research showed that LGG culture supernatant (without live bacteria, LGGs) prevented acute alcohol exposure-induced hepatic steatosis and injury (34). The protective effects of LGG have been attributed to multiple factors. LGG administration prevented the alcohol-induced pathologic changes in the gut microbiome (dysbiosis) (4) and endotoxemia (32), improved the intestinal microenvironment, and corrected the pH changes in the large intestine (4). Alcohol-induced down-regulation of intestinal tight junction and mucus proteins was prevented by LGG/LGGs, which led to an improved intestinal barrier function and inhibited endotoxemia (32, 34). Increased endotoxin concentrations alter hepatic responses to multiple cellular and molecular processes, such as inflammation, oxidative stress and lipid metabolism. We have shown that LGG/LGGs supplementation attenuated alcohol-induced hepatic inflammation by inhibiting of TNF-α production (33). In this study, we further demonstrated that LGGs inhibits alcohol-induced fat accumulation, likely through improved fatty acid β-oxidation and decreased lipogenesis via AMPK activation.

Chronic alcohol intake can promote the development of hepatic steatosis, which can progress to inflammation, fibrosis and cirrhosis (3, 10, 21). Therefore, reducing or preventing fat accumulation in the liver may be an effective strategy for preventing progression of ALD. Four-week alcohol exposure induced a significant increase in hepatic FFA, triglyceride and hepatic fat accumulation. These deleterious effects were markedly reduced by LGGs supplementation. Along with a previous study in an acute alcohol exposure model, our results demonstrated that LGGs is effective in the prevention of both acute and chronic alcohol-induced fatty liver formation. Furthermore, we also demonstrated that LGGs supplementation prevented chronic-alcohol induced liver injury as evaluated by liver enzymes and apoptosis.

AMPK is a well-established cellular energy sensor that switches on catabolic pathways, including fatty acid oxidation and switches off anabolic pathways, including fatty acid synthesis (14). Several studies have suggested that AMPK might be a therapeutic target for the treatment of alcoholic fatty liver (2, 28). In the present study, we examined whether LGGs alters cellular AMPK phosphorylation. Chronic alcohol exposure significantly reduced AMPK phosphorylation, which is in agreement with previous studies. AMPK inhibits de novo fatty acid synthesis by inactivating ACC and stimulates fatty acid β-oxidation by reducing malonyl-Co-A through inhibition of ACC and up-regulation of CPT-1 and PPAR-α. As expected, chronic alcohol exposure significantly reduced ACC phosphorylation, leaving the enzyme in an inactive state. Importantly, LGGs supplementation significantly attenuated chronic alcohol-decreased AMPK phosphorylation, which, in turn, attenuated the reduction of ACC phosphorylation and increased CPT-1 and PPAR-α expression. Consistent with our animal study, LGGs also increased AMPK phosphorylation in H4IIE cells in the presence or absence of alcohol. The effect of LGGs on fat metabolism was further demonstrated using an AMPK inhibitor, Compound C. Pre-incubation of the hepatic cells with Compound C significantly reduced ACC phosphorylation, supporting the role of LGGs in AMPK-mediated ACC regulation. It is worth to note that a recent study indicate that LGG treatment improves insulin sensitivity and reduces lipid accumulation by stimulating adiponectin secretion and consequent activation of AMPK (18).

SREBP-1c plays a unique role in the expression of genes involved in hepatic fatty acid synthesis. Increasing evidence shows that expression of hepatic SREBP-1c is increased by alcohol exposure (16, 17). Previous studies suggest that acétylation of SREBP-1c, owing to the alcohol-induced decreased activity of Sirtuin 1 (SIRT1), stabilizes SREBP-1c protein and up-regulates lipogeneic genes in the liver, which may contribute to the development of alcoholic fatty liver (22, 37). More recent studies showed that AMPK activation inhibited SREBP-1c activity, leading to an attenuation of hepatic steatosis (6). Consistent with previous studies, chronic alcohol exposure significantly increased hepatic SREBP-1c level, which was inhibited by LGGs supplementation. Moreover, chronic alcohol exposure decreased the phosphorylation levels of hepatic AMPK, which was reversed by LGGs supplementation. These results suggested that LGGs supplementation contributes to the increase in hepatic fatty acid β-oxidation and the decrease in de novo iipogenesis through activation of AMPK in the chronic alcohol exposed mouse liver.

LGGs supplementation also significantly attenuated alcohol feeding-induced hepatic apoptosis. Previous studies suggested that alcohol exposure may elevate the expression of pro-apoptotic protein, Bax, in the liver (12) or increase its mitochondrial localization (7), while Bcl-2, an anti-apoptosis protein, was not changed (8) or elevated (13). The current study did not show any change in hepatic Bcl-2 protein expression, but significantly increased hepatic Bax expression, suggesting that Bax elevation during chronic ethanol exposure may contribute to alcohol-induced apoptosis in the liver. Importantly, LGGs supplementation significantly increased Bcl-2 and inhibited Bax protein expression. Therefore, LGGs may play a role in preventing alcohol-induced hepatic apoptosis by promoting anti-apoptotic and inhibiting pro-apoptotic pathways.

Several studies have showed that the secreted factors produced by probiotics were beneficial, and some active ingredients in probiotic culture supernatant have been identified, including proteins (35, 40), histamine (29), polyphosphate (27), exopolysaccharide (26), conjugated linoleic acids (9) and polyamines (24). These active ingredients have been demonstrated to be effective in the treatment of inflammation-mediated intestinal disorders and liver disease through modulating the intestinal pH, improving the intestinal microenvironment, inhibiting cytokine-induced apoptosis, and increasing intestinal epithelial barrier function. Identifying the components that are responsible for the beneficial effects of LGGs is, therefore, important for understanding the underlying mechanisms and developing new approaches for the prevention/treatment of chronic alcohol-induced liver injury.

In summary, our findings in this study suggest that LGGs is effective in the prevention of hepatic steatosis and injury in mice chronically exposed to alcohol by increasing fatty acid β-oxidation and decreasing de novo lipogenesis, and by decreasing hepatic apoptosis. Recent studies have demonstrated that secreted factors from probiotic fermentation have multiple beneficial effects in gut and liver health. Thus, LGGs represents an attractive treatment/prevention strategy for alcoholic liver disease.

ACKNOWLEDGEMENTS

The authors thank Ms. Marion McClain for manuscript proofreading.

GRANTS

This study was supported by NIH grants R21 AA020848 (WF), R01AA018869–01, R01AA018016, U01AA021901–01, U01AA021893–01, and the VA (CJM), and NSFC grant H0306 (WF).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

REFERENCES

  • 1.Adachi M, and Brenner DA. Clinical syndromes of alcoholic liver disease. Dig Dis 23: 255–263, 2005. [DOI] [PubMed] [Google Scholar]
  • 2.Ajmo JM, Liang X, Rogers CQ, Pennock B, and You M. Resveratrol alleviates alcoholic fatty liver in mice. American journal of physiology Gastrointestinal and liver physiology 295: G833–842, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Beier JI, and McClain CJ. Mechanisms and cell signaling in alcoholic liver disease. Biological chemistry 391: 1249–1264, 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bull-Otterson L, Feng W, Kirpich I, Wang Y, Qin X, Liu Y, Gobejishvili L, Joshi-Barve S, Ayvaz T, Petrosino J, Kong M, Barker D, McClain C, and Barve S, Metagenomic Analyses of Alcohol Induced Pathogenic Alterations in the Intestinal Microbiome and the Effect of Lactobacillus rhamnosus GG Treatment. PloS one 8: e53028, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Crabb DW, Galli A, Fischer M, and You M. Molecular mechanisms of alcoholic fatty liver: role of peroxisome proliferator-activated receptor alpha. Alcohol 34: 35–38, 2004. [DOI] [PubMed] [Google Scholar]
  • 6.Crabb Dw, and Liangpunsakul S Alcohol and lipid metabolism. Journal of gastroenterology and hepatology 21 Suppl 3: S56–60, 2006. [DOI] [PubMed] [Google Scholar]
  • 7.Deaciuc IV, D’Souza NB, Burikhanov R, Nasser MS, Voskresensky IV, De Villiers WJS, and McClain CJ. Alcohol, but not lipopolysaccharide-induced liver apoptosis involves changes in intracellular compartmentalization of apoptotic regulators. Alcoholism, clinical and experimental research 28: 160–172, 2004. [PubMed] [Google Scholar]
  • 8.Deaciuc IV, Fortunato F, D’Souza NB, Hill DB, and McClain CJ. Chronic alcohol exposure of rats exacerbates apoptosis in hepatocytes and sinusoidal endothelial cells. Hepatology research : the official journal of the Japan Society of Hepatology 19: 306–324, 2001. [DOI] [PubMed] [Google Scholar]
  • 9.Ewaschuk JB, Walker JW, Diaz H, and Madsen KL. Bioproduction of conjugated linoleic acid by probiotic bacteria occurs in vitro and in vivo in mice. The Journal of nutrition 136: 1483–1487, 2006. [DOI] [PubMed] [Google Scholar]
  • 10.Frazier TH, Stocker AM, Kershner NA, Marsano LS, and McClain CJ. Treatment of alcoholic liver disease. Therapeutic advances in gastroenterology 4: 63–81, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gao B, and Bataller R. Alcoholic liver disease: pathogenesis and new therapeutic targets. Gastroenterology 141: 1572–1585, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Guo R, Zhong L, and Ren J. Overexpression of aldehyde dehydrogenase-2 attenuates chronic alcohol exposure-induced apoptosis, change in Akt and Pim signalling in liver. Clin Exp Pharmacol Physiol 36: 463–468, 2009. [DOI] [PubMed] [Google Scholar]
  • 13.Guo R, Zhong L, and Ren J. Overexpression of aldehyde dehydrogenase-2 attenuates chronic alcohol exposure-induced apoptosis, change in Akt and Pim signalling in liver. Clinical and experimental pharmacology & physiology 36: 463–468, 2009. [DOI] [PubMed] [Google Scholar]
  • 14.Hardie DG, and Pan DA. Regulation of fatty acid synthesis and oxidation by the AMP-activated protein kinase. Biochemical Society transactions 30: 1064–1070, 2002. [DOI] [PubMed] [Google Scholar]
  • 15.Hawley SA, Davison M, Woods A, Davies SP, Beri RK, Carling D, and Hardie DG. Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. The Journal of biological chemistry 271: 27879–27887, 1996. [DOI] [PubMed] [Google Scholar]
  • 16.Hu M, Wang F, Li X, Rogers CQ, Liang X, Finck BN, Mitra MS, Zhang R, Mitchell DA, and You M. Regulation of hepatic lipin-1 by ethanol: role of AMP-activated protein kinase/sterol regulatory element-binding protein 1 signaling in mice. Hepatology 55: 437–446, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ji C, and Kaplowitz N. Betaine decreases hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury in alcohol-fed mice. Gastroenterology 124: 1488–1499, 2003. [DOI] [PubMed] [Google Scholar]
  • 18.Kim S-W, Park K-Y, Kim B, Kim E, and Hyun OK. Lactobacillus rhamnosus GG improves insulin sensitivity and reduces adiposity in high-fat diet-fed mice through enhancement of adiponectin production. Biochemical and biophysical research communications 431: 258–263, 2013. [DOI] [PubMed] [Google Scholar]
  • 19.Kirpich IA, Solovieva NV, Leikhter SN, Shidakova NA, Lebedeva OV, Sidorov PI, Bazhukova TA, Soloviev AG, Barve SS, McClain CJ, and Cave M. Probiotics restore bowel flora and improve liver enzymes in human alcohol-induced liver injury: a pilot study. Alcohol 42: 675–682, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lee WJ, Kim M, Park HS, Kim HS, Jeon MJ, Oh KS, Koh EH, Won JC, Kim MS, Oh GT, Yoon M, Lee KU, and Park JY. AMPK activation increases fatty acid oxidation in skeletal muscle by activating PPARalpha and PGC-1. Biochemical and biophysical research communications 340: 291–295, 2006. [DOI] [PubMed] [Google Scholar]
  • 21.Lieber CS. Alcoholic fatty liver: its pathogenesis and mechanism of progression to inflammation and fibrosis. Alcohol 34: 9–19, 2004. [DOI] [PubMed] [Google Scholar]
  • 22.Lieber CS, Leo MA, Wang X, and Decarli LM. Effect of chronic alcohol consumption on Hepatic SIRT1 and PGC-lalpha in rats. Biochemical and biophysical research communications 370: 44–48, 2008. [DOI] [PubMed] [Google Scholar]
  • 23.Mann RE, Smart RG, and Govoni R. The epidemiology of alcoholic liver disease. Alcohol research & health : the journal of the National institute on Alcohol Abuse and Alcoholism 27: 209–219, 2003. [PMC free article] [PubMed] [Google Scholar]
  • 24.Matsumoto M, Kurihara S, Kibe R, Ashida H, and Benno Y. Longevity in mice is promoted by probiotic-induced suppression of colonic senescence dependent on upregulation of gut bacterial polyamine production. PloS one 6: e23652, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Munday MR, and Hemingway CJ. The regulation of acetyl-CoA carboxylase--a potential target for the action of hypolipidemic agents. Advances in enzyme regulation 39: 205–234, 1999. [DOI] [PubMed] [Google Scholar]
  • 26.Nowak B, Ciszek-Lenda M, Srottek M, Gamian A, Kontny E, Gorska-Fraczek S, and Marcinkiewicz J. Lactobacillus rhamnosus exopolysaccharide ameliorates arthritis induced by the systemic injection of collagen and lipopolysaccharide in DBA/1 mice. Archivum immunologiae et therapiae experimental is 60: 211–220, 2012. [DOI] [PubMed] [Google Scholar]
  • 27.Segawa S, Fujiya M, Konishi H, Ueno N, Kobayashi N, Shigyo T, and Kohgo Y. Probiotic-derived polyphosphate enhances the epithelial barrier function and maintains intestinal homeostasis through integrin-p38 MAPK pathway. PloS one 6: e23278, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Shearn CT, Smathers RL, Jiang H, Orlicky DJ, Maclean KN, and Petersen DR. Increased dietary fat contributes to dysregulation of the LKB1/AMPK pathway and increased damage in a mouse model of early-stage ethanol-mediated steatosis. The Journal of nutritional biochemistry 24: 1436–1445, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Thomas CM, Hong T, van Pijkeren JP, Hemarajata P, Trinh DV, Hu W, Britton RA, Kalkum M, and Versalovic J Histamine derived from probiotic Lactobacillus reuteri suppresses TNF via modulation of PKA and ERK signaling. PloS one 7: e31951, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Viollet B, Foretz M, Guigas B, Horman S, Dentin R, Bertrand L, Hue L, and Andreelli F. Activation of AMP-activated protein kinase in the liver: a new strategy for the management of metabolic hepatic disorders. The Journal of physiology 574: 41–53, 2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wakil SJ, and Abu-Elheiga LA. Fatty acid metabolism: target for metabolic syndrome. Journal of lipid research 50 Suppl: S138–143, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang Y, Kirpich I, Liu Y, Ma Z, Barve S, McClain CJ, and Feng W. Lactobacillus rhamnosus GG treatment potentiates intestinal hypoxia-inducible factor, promotes intestinal integrity and ameliorates alcohol-induced liver injury. The American journal of pathology 179: 2866–2875, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wang Y, Liu Y, Kirpich I, Ma Z, ffang C, Zhang M, Suttles J, McClain C, and Feng W. Lactobacillus rhamnosus GG reduces hepatic TNFalpha production and inflammation in chronic alcohol-induced liver injury. The Journal of nutritional biochemistry 24: 1609–1615, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang Y, Liu Y, Sidhu A, Ma Z, McClain C, and Feng W. Lactobacillus rhamnosus GG culture supernatant ameliorates acute alcohol-induced intestinal permeability and liver injury. American journal of physiology Gastrointestinal and liver physiology 303: G32–41, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yan F, Cao H, Cover TL, Whitehead R, Washington MK, and Polk DB. Soluble proteins produced by probiotic bacteria regulate intestinal epithelial cell survival and growth. Gastroenterology 132: 562–575, 2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yoon MJ, Lee GY, Chung JJ, Ahn YH, Hong SH, and Kim JB. Adiponectin increases fatty acid oxidation in skeletal muscle cells by sequential activation of AMP-activated protein kinase, p38 mitogen-activated protein kinase, and peroxisome proliferator-activated receptor alpha. Diabetes 55: 2562–2570, 2006. [DOI] [PubMed] [Google Scholar]
  • 37.You M, Cao Q, Liang X, Ajmo JM, and Ness GC. Mammalian sirtuin 1 is involved in the protective action of dietary saturated fat against alcoholic fatty liver in mice. The Journal of nutrition 138: 497–501, 2008. [DOI] [PubMed] [Google Scholar]
  • 38.You M, and Crabb DW. Molecular mechanisms of alcoholic fatty liver: role of sterol regulatory element-binding proteins. Alcohol 34: 39–43, 2004. [DOI] [PubMed] [Google Scholar]
  • 39.You M, Matsumoto M, Pacold CM, Cho WK, and Crabb DW. The role of AMP-activated protein kinase in the action of ethanol in the liver. Gastroenterology 127: 1798–1808, 2004. [DOI] [PubMed] [Google Scholar]
  • 40.Zhang W, Wang H, Liu J, Zhao Y, Gao K, and Zhang J Adhesive ability means inhibition activities for lactobacillus against pathogens and S-layer protein plays an important role in adhesion. Anaerobe 22: 97–103, 2013. [DOI] [PubMed] [Google Scholar]

RESOURCES