Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Aug 1.
Published in final edited form as: Alcohol Clin Exp Res. 2019 Jul 6;43(8):1682–1694. doi: 10.1111/acer.14131

Ethanol exposure impairs AMPK signaling and phagocytosis in human alveolar macrophages: Role of ethanol metabolism

Lata Kaphalia 1, Mukund P Srinivasan 2, Ramu D Kakumanu 2,3, Bhupendra S Kaphalia 2, William J Calhoun 1
PMCID: PMC6679779  NIHMSID: NIHMS1036702  PMID: 31211863

Abstract

Background:

Chronic alcohol consumption impairs alveolar macrophage’s (AM) function, and increases risk for developing lung infection and pneumonia. However, the mechanism and metabolic basis of alcohol-induced AM dysfunction leading to lung infection are not well defined, but may include altered ethanol (EtOH) and reactive oxygen species metabolism and cellular energetics. Therefore, oxidative stress, endoplasmic reticulum (ER) stress, formation of fatty acid ethyl esters [FAEEs, nonoxidative metabolites of EtOH], AMP-activated protein kinase (AMPK) signaling and phagocytic function were examined in freshly isolated AM incubated with EtOH.

Methods:

AM separated from bronchoalveolar lavage fluid (BALF) samples obtained from normal volunteers were incubated with EtOH for 24 hr. AMPK signaling and ER stress were assessed using western blotting, FAEEs by GC-MS, oxidative stress by immunofluorescence using antibodies to 4-hydroxynonenal and phagocytosis by latex beads. Oxidative stress was also measured in EtOH treated AMs with/without AMPK activator [5-Aminoimidazole-4-carboxamide ribonucleotide (AICAR)] or inhibitor (compound C), and in AMs incubated with FAEEs. mRNA Expression for interleukins (IL 6 and IL8), monocyte chemoattractant protein (MCP)1, and transforming growth factor (TGF) β was measured in AM treated with EtOH or FAEEs using RT-PCR.

Results:

EtOH exposure to AM increased oxidative stress, ER stress and synthesis of FAEEs, decreased phosphorylated AMPK and impaired phagocytosis. Attenuation or exacerbation of EtOH-induced oxidative stress by AICAR or compound C, respectively; suggest a link between AMPK signaling, EtOH metabolism and related oxidative stress. Formation of FAEEs may contribute to EtOH-induced oxidative stress as FAEEs also produced concentration dependent oxidative stress. An increased mRNA expression of IL-6, IL-8 and MCP1 by FAEEs is key finding to suggest a metabolic basis of EtOH-induced inflammatory response.

Conclusions:

EtOH-induced impaired phagocytosis, oxidative stress, ER stress and dysregulated AMPK signaling are plausibly associated with formation of FAEEs, and may participate in pathogenesis of non-specific pulmonary inflammation.

Keywords: Human alveolar macrophages, EtOH, Fatty acid ethyl esters, Phagocytosis, AMPKα signaling

Introduction

About 20 million US citizens diagnosed with alcohol use disorder may have an increased risk of respiratory diseases such as pneumonia, tuberculosis, acute respiratory distress syndrome and chronic obstructive pulmonary disease (Kaphalia and Calhoun, 2013). Alveolar macrophages (AM) are key first line of defenses in lungs, and orchestrate innate immune functions, provide immediate protection against bacterial invasion and infection. Alcohol use disorder is one of the greatest predisposing factors in the development of pneumonia and lung infection (Mehta and Guidot, 2012). The key immune cells involved in combating pulmonary conditions such as pneumonia, TB, RSV infection and ARDS are neutrophils, lymphocytes, alveolar macrophages, and the cells responsible for innate immune responses. We hypothesized that ethanol (EtOH) exposure impairs the functional capacity of AM, which consequently impairs innate immunity and increases susceptibility to lung infection. Although several characteristics of macrophages have been identified to date that underlie the cellular actions (including macrophage polarization and phenotypic diversity), a precise mechanism of pathogenic function of these cells in alcoholic lung disease is not well understood. Other analyses have focused on the contributions of resident versus infiltrating macrophages/monocytes, as well as on the roles of macrophage mediators in the development of lung disease (Karavitis and Kovacs, 2011, Mehta and Guidot, 2012, Kaphalia and Calhoun, 2013).

Chronic alcohol abuse reduces expression of hepatic alcohol dehydrogenase (ADH, a major enzyme involved in oxidative metabolism of EtOH to acetaldehyde), and induces a less efficient microsomal cytochrome P4502E1 to compensate the oxidative metabolism of EtOH (Cederbaum, 2010, Nuutinen et al., 1983, Panes et al., 1989, Panes et al., 1993). However, oxidative metabolism of EtOH catalyzed by cytochrome P4502E1 has been shown to generate reactive oxygen species (ROS) resulting in oxidative stress (Cederbaum, 2010). Chronic alcohol consumption, on the other hand, also promotes formation of fatty acid ethyl esters (FAEEs, nonoxidative metabolites of EtOH with endogenous fatty acids); this pathway is prevalent in the lungs of mice treated with hepatic ADH inhibitor (Manautou and Carlson, 1991, Manautou et al., 1992). Our initial studies in chronic EtOH feeding hepatic ADH-deficient (ADH−) deer mouse showed several fold increased formation of cytotoxic FAEEs, and increased oxidative stress and endoplasmic reticulum (ER) stress in the lungs (Kaphalia et al., 2014). We have also shown that both, acetaldehyde and FAEE induce inflammatory responses; FAEE are more proinflammatory than acetaldehyde in human airway smooth muscle cells (HASMCs) pretreated with lipopolysaccharide (Kaphalia et al., 2016). In this study, we have shown that FAEEs deactivate 5’ adenosine monophosphate-activated protein kinase (AMPK) α and alter its upstream and downstream signaling molecules in HASMCs.

AMPKα is a highly conserved sensor of cellular energetics and a well-known key regulator of cell metabolism and energy homeostasis, and activated in vivo by a variety of cell stressors, including hypoglycemia, toxins, hypoxia, and muscle exercise. Deactivation of AMPKα is associated with a wide variety of inflammatory and neoplastic disorders (Viollet et al., 2010). Importantly, therapeutic anti-diabetic agents including phenformin, metformin, and the thiazolidinedione class activate AMPK (O’Neill and Hardie, 2013). AMPK activation alleviates ER stress and protects bronchial cells from apoptosis (Liu et al., 2018). It is also likely that ER stress, inflammation and oxidative stress linked through various molecular pathways are influenced by chronic EtOH feeding (Zhang and Kaufman, 2008; Chaudhary et al., 2014).

Dysregulation of lipid metabolic homeostasis via AMPKα signaling and generation of cytotoxic metabolites such as FAEE could be one of the mechanisms of EtOH-induced impaired phagocytosis and innate immunity in AM. EtOH consumption has been associated with impaired phagocytosis by AM and increased risk of pulmonary infection (Liang et al., 2013, Mehta and Guidot, 2012). Additionally, EtOH exposure can also be proinflammatory and induce transforming growth factor (TGF) β1 causing lung injury leading to fibrosis (Kaphalia and Calhoun, 2013, Sueblinvong et al., 2014). Therefore, studies regarding inflammatory response, AMPK associated cellular energetics, ER stress, oxidative stress and the formation of FAEEs in AM treated with EtOH and/or FAEEs could be important in understanding the metabolic basis of alcoholic lung disease.

Materials and Methods

Non-isotopic and isotopic (1, 2-13C) EtOH (C2H5OH, ACS reagent, purity ≥99.5%), and 16:0 (palmitate), 17:0 (heptadecanoate; internal standard), 18:0 (stearate), 18:1 (oleate), 18:2 (linoleate) and 18:3 (linolenate) fatty acid ethyl esters (FAEEs, purity ≥99%) were obtained from Sigma Aldrich (St. Louis, MO). Other chemicals, reagents and solvents used in this study for chromatography were from either Sigma-Aldrich or Thermo Fisher Scientific (Houston, TX).

A detailed procedure for obtaining bronchoalveolar lavage (BAL) fluid obtained from volunteers has been described earlier (Calhoun et al., 1998, Calhoun et al., 1992) under a protocol approved by the UTMB Institutional Review Board. Subjects who volunteered for BAL were Caucasian, male and age ranging from 30–45 years, having with normal lung function tests, and with no known asthma and allergies. Based on the patient health information records, there were no smoking history and co-morbidities such as HIV for the donors used in this study. BAL fluid was obtained by bronchoscopy (2 60ml aliquots instilled and recovered by hand suction), and centrifuged (450 x g) for 10 min at 4°C. The sedimented cells were resuspended in culture medium (RPMI-1640 + 10% fetal bovine serum + 2 mM L-glutamine + penicillin [40 IU/ml], streptomycin [75 IU/ml], transferred to 25 cm3 polystyrene culture flasks supplied with purified air containing 5% CO2 and incubated at 37°C. After 3 hr of incubation, the media pipetted out to remove the non-adhering cells. The adhering alveolar macrophages (AM) were replenished with fresh media containing isotopic 1, 2-13C-labelled or non-isotopic EtOH (1, 2, 4 or 8 mg/ml) for 24 hr for measuring formation of FAEEs, and AMPKα signaling, oxidative stress and phagocytosis. Previously, we found a better inflammatory response in human primary airway smooth muscle cells incubated for 24 hr. vs 6 hr. (Kaphalia et al., 2016). Therefore, the AM incubated with EtOH for 24 hr. were used for this study. Trypan blue staining was used to measure viability

Western blot analysis for AMPKα signaling molecules

Alveolar macrophages incubated with non-isotopic EtOH were sedimented and lysed with 0.7 ml mammalian protein extraction reagent (Cat # 78501, Thermo Fisher Scientific, Houston, TX) containing phosphatase and protease inhibitors. Extraction reagent contained mild, non-denaturing detergent in 25mM bicine buffer (pH 7.6), which is sufficient to dissolve cell membrane and extract soluble proteins. Protein was measured by Pierce BCA protein assay kit. An equal amount of protein (45 μg) of each lysate was solubilized in a sample buffer by boiling for 5 min, and subjected to SDS-PAGE followed by Western blot analysis using nitrocellulose membrane (Kaphalia et al., 2014). The membrane was incubated with antibodies (rabbit; and isotype controls) against phosphorylated (p)-AMP-activated protein kinase (AMPK) α (62 kDa; Cat# 2535), Ca2+/calmodulin-dependent protein kinase (CaMKK) β (50 kDa; Cat# 11945), liver kinase β (LKB) 1 (54 kDa; Cat# 3047) or acetyl CoA carboxylase (ACC)1 (280 kDa; Cat # 3676) obtained from Cell Signaling (Cambridge, MA) followed by incubation with anti-rabbit IgG conjugated with horseradish peroxidase (secondary antibodies). Protein bands were developed with an ECL detection system (Amersham, Buckinghamshire, England), and their intensities were determined and compared using ImageJ program (version 1.50i; Bethesda, NIH).

Western blot analysis for the markers of ER stress and unfolded protein response

Key markers of ER stress and its responses are glucose-regulated protein (GRP) 78, protein kinase RNA-like endoplasmic reticulum kinase (PERK), Inositol-requiring enzyme (IRE) 1α and X-Box Protein (XBP) 1. The primary antibodies for GRP78 (75kDa; Cat #3177S) and PERK (150kDa; Cat #100-401-962) were obtained from Cell Signaling (Danvers, MA) and Rockland (Limerick, PA), respectively. Antibodies against IRE1α (110 kDa; Cat # NB100-2324) was from Novus Biologicals (Littleton, CO, USA). Spliced XBP1 (sXBP1, 40kDa; Cat #37152) and unspliced XBP1 (uXBP1, 29 kDa; Cat #37152), were purchased from Abcam Inc (Cambridge, MA, USA).

EtOH-induced oxidative stress and effect of AMPK activator and inhibitor

Oxidative stress was assessed in AM incubated with 4mg/ml EtOH and/or in the presence of AMPK inhibitor (Compound C, 10 μM) or AMPK activator (5-aminoimidazole-4-carboxamide-1-β-D-ribonucleotide, AICAR, 500 μM; Cal Biochem, San Diego, CA) in chamber slides supplied with pure air containing 5% CO2 at 37°C overnight (Zhou et al., 2001). The AM were pre-incubated with AICAR or Compound C for an hour followed by incubation with EtOH for 24 hr. The cells fixed with 4% paraformaldehyde were permeabilized with Triton X-100. After blocking with goat serum blocking serum, the slides were incubated with 4-hydroxynonenal (HNE) antibodies from Abcam (Cambridge, MA; Cat # 24645) followed by washing the primary antibodies and incubation with FITC conjugated secondary antibodies (Birmingham, AL; Cat # 4050–02; (Zhou et al., 2001, Kaphalia et al., 2016)). The fluorescence intensity was quantified by ImageJ and represented as arbitrary units.

EtOH-induced phagocytosis by AM

To evaluate the phagocytosis, freshly isolated AM were incubated with EtOH (4 mg/ml) along with latex Beads-Rabbit IgG-FITC complex [Cayman’s Phagocytosis Kit (IgG-FITC) coated with fluorescent-labeled rabbit-IgG] at 37°C for 24 hr (Cai et al., 2005). For assays, we used equal number of control and treated cells. Phagocytosis was determined by counting the total number of macrophages engulfing latex Beads-Rabbit IgG-FITC under microscope. The data expressed as percent of the control.

Formation of FAEEs

Extraction and analysis of FAEEs formed in the AM incubated with EtOH were similar to that described previously (Wu et al., 2006). After incubation, control and 1, 2-13C-labelled EtOH treated AM were scrapped and transferred into glass tubes along with the media followed by an addition of ethyl heptadecanoate (internal standard). The lipid contents of cells and culture media were extracted with chloroform: methanol (2:1, v/v), dried under gentle stream of nitrogen and the lipid extract was subjected to thin layer chromatography using 500 micron thick silica gel coated glass plates (Analtech, Delaware, PA) and petroleum ether: diethyl ether: acetic acid (75: 5: 1, v/v/v) as solvent. The silica gel corresponding to relative flow of FAEEs was scraped and eluted with methanol: water (6:1, v/v). The eluate was dried, re-dissolved in n-hexane and analyzed by gas chromatography-mass spectrometry (GC-MS) using Hewlett Packard 5975 Gas Chromatograph equipped with Inert XL Mass Selective Detector (Agilent Technologies, Santa Clara, CA).

FAEEs were separated by silica capillary column (DB 225MS, length 30M, internal diameter 0.25 mm, film thickness 0.25 micrometer; J & W Scientific, Folsom, CA) operated at initial temperature set at 150°C with an increase of 10°C/min to a final temperature of 225°C. The temperature of injector port was set at 200°C. GC-MS operated at 230 °C for GC–MS transfer line, 166 °C for source and 130 °C for the quadrupole. Helium was used as carrier gas flowing at 1 ml/min. Selected ion monitoring (SIM) with a dwell, time of 150 ms was used to identify individual isotopic FAEEs. Criteria for confirmation was the retention time and respective molecular fatty acid13C-ethyl ester ions (m/z, 286 for ethyl palmitate, 314 for ethyl stearate, 312 for ethyl oleate, and 310 for ethyl linoleate) and a signature fragmentation pattern of corresponding non-isotopic FAEE standards. Average recovery of internal standard was estimated to be >70%, and the final data corrected for the percent recovery.

FAEE-induced oxidative stress

Oxidative stress was evaluated in AM incubated with various concentrations of FAEEs [mixed in a ratio of 1.3, 2.0, 3.6, 1.0; wt/wt for 16:0, 18:0, 18:1 and 18:2 FAEEs, respectively, formed in the lungs of a deer mice fed EtOH for 3 months (Kaphalia et al., 2014)] in EtOH, at 37°C for 24 hr by immunofluorescence technique using antibodies against a key lipid peroxidation product, 4-HNE, as described earlier with EtOH treated AM. The final concentration of EtOH used to dissolve FAEEs was equivalent to 100 mg/ml along with a matching control containing 100mg/ml EtOH.

EtOH- and FAEE-induced inflammatory responses

Control or treated AM were centrifuged, and sedimented and the pellet preserved in RNAlater (Qiagen, www.qiagen.com). Total RNA was extracted using standard RNA isolation by TRIZOL RNA isolation protocol. During extraction, DNase I was added to digest and remove any DNA impurities. RNA quantification and assessment of its purity was measured using BioTek Epoch 2 microplate reader (BioTek, Winooski, VT). Total RNA (800 ng) was then reverse transcribed to cDNA using iScript cDNA synthesis kit (Bio-Rad, # 1708891, Hercules, CA). The primers for qPCR were designed using algorithm Primer 3. Quantitative real-time PCR (qPCR) analysis was performed using Eppendorf RealPlex2 Master cycler and iTaq Universal SYBR Green super mix ((Bio-Rad, # 1725121, Hercules, CA) with the primer sets described in Table 1. Amplicon sizes used for TGF β, IL-6, IL-8, MCP-1 and peptidylpropylisomerase A (PPIA, housekeeping gene) were 82, 102, 108, 95 and 112, respectively. Amplification efficiencies were normalized using PPIA. The relative fold change in expression was calculated by Livak method (Livak and Schittgen, 2011). Each experiment was performed in triplicate. mRNA expression was confirmed by Western blot analysis in a few remaining samples saved at −80°C using antibodies for IL-6 [Santa Cruz Biotech, # sc-130326, MW: 21 kDa], IL-8 [Santa Cruz Biotech, # sc-8427, MW: 8 kDa] and TGF-β1 [abcam,# ab9758, MW: 44 kDa] in the lysates of alveolar macrophages (AMs) incubated with EtOH or FAEEs as described earlier.

Table 1.

Primer sequences used for qPCR analysis various inflammatory genes

Gene Forward Primer (5′−3′) Reverse Primer (5′−3′) Product size, bp
IL-6 CTGGATTCAATGAGGAGACTTGC TCAAATCTGTTCTGGAGGTACTCTAGG 102
IL-8 CTTGGCAGCCTTCCTGATTT GGGTGGAAAGGTTTGGAGTATG 108
MCP-1 TCATAGCAGCCACCTTCATTC CTCTGCACTGAGATCTTCCTATTG 95
TGFB1 CTGAGATATGGGCTCCTGATTC GCCCAATAACCCTGTCAATTTC 82
PPIA CCCACCGTGTTCTTCGACATT GGACCCGTATGCTTTAGGATGA 112

IL-6, Interleukin −6; IL-8, Interleukin – 8; MCP-1, Monocyte chemoattractant protein-1; TGFB1, Transforming growth factor-β1; PPIA, Peptidylprolyl Isomerase A; bp-base pair

Statistical Analysis

The data sets were analyzed for statistical significance using Student’s t-test for two comparisons, and ANOVA or Student–Newman–Keul’s for multiple comparison tests and p value ≤ 0.05 was considered significant. The results are expressed as mean ± SEM (Standard Deviations of mean) of 3 samples per group.

Results

Overall, AM exposed to EtOH produced FAEEs in an EtOH-concentration dependent manner; likewise, impaired phagocytosis, oxidative stress, and dysregulated upstream and downstream AMPKα signaling. No significant cell death was observed in AM incubated with various concentrations of EtOH or FAEEs (data not shown).

AMPKα signaling

AM incubated with 1 mg/ml EtOH showed significantly increased expression of p-AMPKα in contrast to control and those incubated with 4 and 8 mg/ml EtOH (Fig. 1a). A similar pattern was observed for ACC1 expression as compared to the control. As expected, the expression of ACC1 in AM incubated with 2, 4 or 8 mg/ml EtOH was significantly increased (Fig. 1b). Expression of both p-AMPKα and p-ACC1 was decreased with increasing EtOH concentration. In contrast, expression of upstream AMPKα signaling molecules (LKB1 and CaMKKβ) was significantly decreased with increasing the concentration of EtOH (Fig. 1c & d). These results indicate that EtOH induces oxidative stress and/or ER stress and deactivate AMPKα in AM, particularly at higher EtOH concentrations.

Fig. 1.

Fig. 1.

Fig. 1.

EtOH-induced AMPKα signaling in AM (a- p-AMPKα and AMPKα; b- p-ACC1 and ACC1; c- LKB1; d- CaMKKβ). Western blots along with respective bar diagram show relative intensities of p-AMPK/β-actin and ACC1/ β-actin, and p-AMPK/AMPKα and p-ACC1/ACC1 ratios. Values are expressed as mean ± standard deviation (n=3). *- p value ≤ 0.05

EtOH induced ER stress

EtOH exposure to AM resulted in ER stress as indicated by increased expression of GRP78 and the unfolded protein responses IRE 1α, PERK and sXBP1 (Fig. 2a–c). GRP78, IRE 1α and PERK increased in a concentration-dependent manner with EtOH exposure. On the other hand, sXBP1 and uXBP1 increased only in AM treated with 2 and 4 mg/ml EtOH. Despite of increased expression of IRE1α, a lack of significant induction was found for sXBP1 and uXBP1 in AM treated with 8 mg/ml EtOH (Fig. 2d & e).

Fig. 2.

Fig. 2.

Fig. 2.

EtOH-induced GRP78 (ER stress marker) (a) and proteins involved in UPR to restore ER homeostasis. (b - e) in AM. Western blots along with respective bar diagram show relative intensities of IRE 1α (b), PERK (c), sXBP1 (d) and uXBP1 (e). Values are expressed as mean ± standard deviation (n=3). *- p value ≤ 0.05.

EtOH-induced oxidative stress and effect of AMPK activator and inhibitor

EtOH-induced oxidative stress was attenuated or exacerbated in AM incubated with AMPK activator (AICAR) or AMPK inhibitor (Compound C), respectively (Fig. 3). These results suggest the possibility of therapeutic benefit of AMPK activator (AICAR) in the treatment of impaired macrophage functions (innate immunity).

Fig. 3.

Fig. 3.

Immunofluorescence microscopy of oxidative stress using antibodies against 4-HNE in AM incubated with 4 mg/ml EtOH at 37°C for 24 hr in the presence of AMPK activator (AICAR) and AMPK inhibitor (compound C, CC). Upper panel- immunofluorescence, middle panel DAPI and lower- superimpose of immunofluorescence and DAPI (a). Relative intensities of immunofluorescence are shown by bar diagram using Image J (b). (n = 3). #, *- p value ≤ 0.05.

EtOH-induced phagocytosis

Phagocytosis assays demonstrated significantly decreased phagocytosis by AM incubated with EtOH (Fig. 4), although significant cell death was not observed in either group.

Fig. 4.

Fig. 4.

Phagocytosis by AM incubated with various concentrations of EtOH for 24 hr at 37°C using latex beads coated with fluorescent labelled rabbit IgG. The phagocytosis was measured as percent of the control cells (con). Values are mean ± standard deviation of total phagocytizing cells as compared to control cells (n = 3). *-p value ≤ 0.05.

Formation of FAEEs

Use of isotopic 1, 2-13C-EtOH to study in situ formation of FAEEs is advantageous over non-isotopic EtOH to exclude endogenously formed FAEEs, if any. 16:0, 18:0 and 18:1 FAEEs were abundant in AM incubated with 2–8 mg/ml EtOH. However, the above mentioned FAEEs were only in trace amounts or not detected in AM incubated with 1 mg/ml EtOH (data not shown). Representative SIM profiles for various FAEEs extracted from the controls and EtOH treated cells are shown in Fig. 5a & b, respectively. SIM profiles for various authentic standards as shown in Fig. 5c are in agreement with SIM profile corresponding to isotopic FAEEs formed in AM treated with EtOH. As shown in Fig. 5d, formation of FAEEs increased exponentially with increasing concentration of EtOH. The mean total FAEE levels were found to be 4.6, 8.7 and 27.3 ng/1.5X106 cells incubated with 2, 4 and 8 mg/ml 1, 2-13C EtOH, respectively. The total FAEE levels were ~2 and ~6 fold greater in AM incubated with 4 and 8 mg/ml EtOH, respectively, than those formed with 2 mg/ml EtOH. Among all the FAEEs, 18:1 FAEE was the most abundant ester formed in 1, 2-13C EtOH treated AM.

Fig. 5.

Fig. 5.

Fig. 5.

Formation of FAEEs in AM incubated with EtOH for 24 hr at 37°C. Representative GC-MS (SIM) profile of FAEEs in the lipid extracted from control AM (a), EtOH treated AM (b) and authentic standard mix of FAEEs (c). Peaks for 16:0 (palmitate), 17:0 (heptadecanoate; internal standard), 18:0 (stearate), 18:1 (oleate), 18:2 (linoleate) and linolenate (18:3) FAEEs are marked in various chromatograms. Bar diagram (d) shows individual and total FAEEs. Values are mean ± standard deviation (n=3). p value <0.05 * between FAEEs formed in AM incubated with 2 and 4 mg/ml EtOH; # between 4 and 8 mg/ml EtOH; † between 2 and 8 mg/ml EtOH.

FAEE-induced oxidative stress

AM incubated with FAEEs showed concentration-dependent increases for the oxidative stress (Fig. 6).

Fig. 6.

Fig. 6.

Immunofluorescence microscopy of oxidative stress using antibodies against 4-HNE in AM incubated with various concentrations of FAEEs at 37°C for 24 hr. Upper panel- immunofluorescence, middle panel- DAPI and lower panel- superimpose of immunofluorescence and DAPI (a). Relative intensities of immunofluorescence are shown by bar diagram using Image J (b). (n = 3) #, *- p value ≤ 0.05.

EtOH- and FAEE induced inflammatory responses

As shown in Fig. 7, in general, EtOH decreases inflammatory genes (IL-6, IL-8 and MCP-1) as compared to the ~ 2 to 4 fold increased expression in the AM incubated with 50 and 100 μg/ml FAEEs, respectively. Surprisingly, EtOH exposure caused a dose dependent increase for mRNA expression of TGF-β1. However, a similar mRNA expression for TGF-β1 was not observed in the AM incubated with FAEEs. mRNA expression of IL-6, IL-8 and TGF-β corroborates well with respective protein expression data analyzed by Western blotting (Supplemental data; Fig. 1 and 2). Therefore, a detailed study to establish a differential effect of FAEEs and acetaldehyde on TGF-β1 expression is needed.

Fig. 7.

Fig. 7.

RT-qPCR analysis of key inflammatory cytokines and chemokine and TGF-β1 in AM incubated with EtOH and FAEEs at 37°C for 24 hr. Values are mean ± standard deviation (n=3). *-p value ≤ 0.05.

Discussion

Alcohol abuse impairs innate and adaptive immunity in the lungs, increases susceptibility to infection and inflammatory lung diseases including pneumonia, acute respiratory distress syndrome and chronic obstructive pulmonary disease. Understanding the mechanisms of alcoholic lung injury could lead to the development of therapeutic strategies at early stages of the disease as preventive modalities. Immunosuppression by chronic alcohol abuse could be a key factor for onset of inflammatory lung disease. Although metabolic basis of EtOH induced lung injury is not fully understood, formation of FAEEs has been shown to be the predominant metabolic products in the lungs of chronic EtOH feeding model of hepatic ADH-deficient (ADH−) deer mouse (Kaphalia et al., 2014), which itself can model a reduced ADH activity as seen during chronic alcohol abuse. In general, EtOH exposure to AM impairs phagocytosis, increases oxidative stress and ER stress, and dysregulates upstream and downstream AMPKα signaling molecules in a concentration-dependent manner.

An adequate amount of ATP is pre-requisite for cellular cell functioning, including apoptosis. FAEEs are known to uncouple oxidative phosphorylation and cause mitochondrial toxicity (Lange and Sobel, 1983). This is the first report showing that human AM incubated with EtOH generate a significant concentration-dependent formation of FAEEs. Ethyl oleate is a major ester formed in the AM and poses a greater cytotoxic potential than other FAEEs (Kaphalia and Calhoun, 2013). An increased formation of FAEEs with increasing concentrations of EtOH could be critical for impairing the AM as >300 mg% blood alcohol levels were frequently seen in individuals with a history of chronic alcohol use (Kaphalia et al., 2004). Therefore, evaluation of cell death pathways and mitochondrial toxicity in AM exposed to chronic EtOH is critical for understanding the metabolic basis of EtOH-induced cytotoxicity. Ex vivo or in vitro cell culture model for understanding the mechanism of alcoholic lung disease has been advocated earlier using mice AMs and modular incubation chamber for long term 0.08% EtOH exposure (Yeligar et al., 2014; 2016). However, the dose, time and cell types used are major determining factors for most of the cell culture studies. Although, there are some limitations in this study in terms of chronic or binge EtOH exposure, we focused an acute EtOH response to develop a platform for chronic studies based upon our previous study in primary human airway smooth muscle cells (Kaphalia et al., 2016). However, an elaborated time dependent study could open new avenues to understand the mechanism of EtOH-induced inflammatory responses in alcoholic lung diseases.

AMPK activation is regulated by at least two upstream kinases (LKB1 and CaMKKβ); AMPK activation could attenuate neutrophil proinflammatory activity and decrease the severity of lung injury (Woods et al., 2005, Zhao et al., 2008). EtOH exposure reduces cellular ATP levels, deactivates AMPKα (a key isomer of AMPK), and inhibits fatty acid β-oxidation to facilitate lipogenesis (Wu et al., 2006, Garcia-Villafranca et al., 2008). Increased levels of fatty acids also cause oxidative stress (Soardo et al., 2011). In this regard, lipid metabolomics in various subcellular fractions, particularly in the mitochondrial, cytosolic and microsomal fractions would be informative. Previous studies indicate that human AM contain and release a serine esterase that is apparently identical to liver microsomal carboxylesterase (Munger et al., 1991). Serine esterases are major component of AM-nonspecific esterase activity and acts as a detoxication enzyme and could be involved in the synthesis of FAEE (Kaphalia and Calhoun, 2013). Alternatively, metabolism of EtOH via cytochrome P450 2E1 could also be involved in generation of oxidative stress. Therefore, a number of mechanisms could be functional for impairing AM in patients with ongoing chronic alcohol abuse and may be influenced by concentrations of FAEEs and blood alcohol. Therefore, altering oxidative or nonoxidative metabolism of EtOH using their specific regulators could help to dissect the metabolic basis of EtOH-induced oxidative stress in AM in a manner similar to AR42J cells (Bhopale et al., 2014). AM could also be susceptible to oxidative stress due to depleted glutathione (GSH) levels, because AM depend on hepatic GSH production in vivo (Gauthier et al., 2005, Mehta and Guidot, 2012). Decreased phagocytizing capacity of AM treated with 4mg/ml EtOH could also be associated with oxidative stress and/or impaired cellular energetics.

Inflammation is an initial response of immune system as a mechanism of protection against infection or injury. However, prolonged or chronic inflammation is fundamental to etiopathogenesis of various inflammatory diseases (Zhang and Kaufman, 2008). An increased expression of GRP78 (marker of ER stress) and such subsequent unfolded protein responses (UPR) as IRE1α and PERK in AM treated with increasing concentration of EtOH could also be linked to oxidative stress and impaired cellular energetics. The EtOH-concentration dependent enhancement of sXBP1 expression in AM explains the ongoing adaptive response towards ER homeostasis. Reduced expression of sXBP1 in AM treated with 8mg/ml EtOH suggest a lack of operational ER homeostasis, since sXBP1 is a key UPR molecule responsible for the transcriptional and translational regulation of ER homeostasis. Collectively, the ER stress responses we observed are consistent with a variety of other outcome measures evaluated in this study and suggest broad-based EtOH toxicity to AM. In this regard, inhibitor of FAEE synthesis such as 3-benzyl-6-chloro-2-pyrone (3-BCP) could be important (Wu et al., 2008). Use of inhibitors of oxidative and nonoxidative metabolism of ethanol and resultant phenotype are key to understand the metabolic basis of alcoholic lung disease.

Our findings herein suggest that oxidative stress related EtOH-induced lung injury is mediated by ER stress, AMPKα deactivation and altered lipid metabolism (Fig. 8). Increased intracellular ROS and resultant oxidative stress may also activate AMPKα and could promote either cell death or survival (Sid et al., 2013). Alternatively, impaired AMPKα activity in cultured hepatocytes isolated from rats fed EtOH has also been reported (You et al., 2004, Tomita et al., 2005, Garcia-Villafranca et al., 2008). Therefore, EtOH-induced modulation of AMPKα activity appears to be dependent on the concentration and metabolism of EtOH, cell type, and perhaps other unmeasured factors. Attenuation and exacerbation of oxidative stress by AICAR or Compound C, respectively, as found in this study suggests therapeutic potential of AICAR or similar drugs such as metformin to treat EtOH-induced lung disease. In this regard, our key finding is that EtOH activates AMPKα at low (1 mg/ml) and deactivates at higher concentrations (4 and 8 mg/ml). Each of these alterations were associated with changes in the downstream signaling molecule, ACC1, in the expected directions. Downregulation of CaMKKβ using RNA interference in vitro significantly reduced AMPK activation (Woods et al., 2005). LKB1 and CaMKKβ are sensitive to oxidative stress and increased cytosolic Ca2+ levels (ER stress), respectively (Schmitt et al., 2004, Woods et al., 2005) and regulate AMPKα activation/deactivation. Therefore, total body burden of EtOH and its metabolites could be determining factors in mediating EtOH-induced toxicity and impairment of AMPKα related cellular energetics in the AM.

Fig. 8.

Fig. 8.

Schematic presentation of lung injury via oxidative and nonoxidative metabolism of EtOH, and the role of AMPKα signaling. The scheme depicts the scenario only in AM incubated with higher concentration of EtOH (4 or 8 mg/ml) relevant to alcohol abusers.

Lung injury, in general, initiated by an inflammatory response could lead to fibrosis if persistent and unregulated (Pohlers et al., 2009). A significant EtOH concentration-dependent proinflammatory response as shown by mRNA expression of IL-6, IL-8 and MCP-1 in AM incubated with FAEE is parallel to our previous findings in human airway smooth muscle cells (Kaphalia et al., 2016). Lack of such response in AM incubated with EtOH is not surprising, since the levels of FAEEs formed in this study were substantially lower because of the short duration of EtOH exposure. However, a time dependent study to examine the formation of FAEEs, and response of the cells treated with EtOH, FAEE or acetaldehyde should address the toxic effects associated with acute and chronic exposures. To achieve a complete interventional scenario, in vitro; incubation of EtOH treated cells before, after or simultaneously with activators of AMPK, such as AICAR, should be helpful in devising therapeutic approach(s). However, our findings herein do indicate potential of AICAR as a therapeutic agent to mitigate EtOH effects on the AM and eventually treat the alcoholic lung disease. Therefore, measuring FAEEs in AM of subjects with chronic alcohol use disorder could provide more direct data, and lead to a better understanding of metabolic basis of alcoholic lung disease.

The concentration-dependent increase for TGF-β1 in AM incubated with EtOH was surprising, particularly in comparison to the effects of FAEE exposure. Increased expression of TGF-β1 has been reported in AM of rats fed EtOH and could be related to its oxidative metabolism to acetaldehyde as reported by others (Curry-McCoy et al., 2013). TGF-β1 has both accentuating and ameliorating effects on inflammation, depending upon its stage; it plays a central role in severe fibrotic diseases and remains to be an attractive therapeutic target (Pohlers et al., 2009). Therefore, the use of small molecules such as 3-BCP to alter nonoxidative metabolism of EtOH and consequent AM production of TGF-β1 would further inform the metabolic basis of fibrotic responses.

Conclusions

Oxidative stress is common in AM treated with EtOH and may be a primary cause of impaired phagocytosis. The formation of FAEEs in AM treated with EtOH might also play an important role in generating oxidative stress and altered cellular energetics. However, further studies to examine oxidative stress and resultant phagocytic function of AM exposed to EtOH and its oxidative and nonoxidative metabolites could lead to a better understanding of the mechanisms of pulmonary disease.

Supplementary Material

Supp FigS1

Fig. 1. Western blot analysis for IL-6 (a), IL-8 (b) and TGF-β1(c) in AMs incubated with EtOH at 37°C for 24 hr. β-actin was used as a loading control and to normalize the protein concentration. Values are mean ± standard deviation (n = 3). *- p value ≤0.05.

Supp FigS2

Fig. 2. Western blot analysis for IL-6 (a), IL-8 (b) and TGF-β1 (c) in AMs incubated with FAEEs (mixed in a ratio formed in the mice lungs) at 37°C for 24 hr. β-actin was used as a loading control and to normalize the protein concentration. Values are mean ± standard deviation (n=2).

Acknowledgement

This work was supported in part by the Institute for Translational Sciences at the University of Texas Medical Branch, supported in part by a Clinical and Translational Science Award (UL1TR000071) from the National Center for Advancing Translational Sciences, National Institutes of Health; National Institute on Alcohol abuse and Alcoholism (AA24699; AA25850; BSK) and National Institute of Environmental Health Sciences Center grant (P30ES006676). Its contents are solely the responsibility of the authors, and do not necessarily represent the official views of the NIH.

Abbreviations:

ACC

Acetyl CoA carboxylase

ADH

alcohol dehydrogenase

AICAR

5-Aminoimidazole-4-carboxamide ribonucleotide

AM

alveolar macrophage(s)

AMPK

AMP activated protein kinase

CAMMK

Ca+/calmodulin-dependent protein kinase

EtOH

ethanol

ER

Endoplasmic reticulum

FAEE

Fatty acid ethyl ester(s)

GRP

glucose regulated protein

IRE

inositol-requiring enzyme

LKB

Liver kinase β

PERK

Protein kinase RNA-like ER kinase

XBP

X-Box binding protein

References

  1. Bhopale KK, Falzon M, Ansari GA, Kaphalia BS (2014) Alcohol oxidizing enzymes and ethanol-induced cytotoxicity in rat pancreatic acinar AR42J cells. In Vitro Cell Dev Biol Anim 50:373–380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Cai P, Kaphalia BS, Ansari GA (2005) Methyl palmitate: inhibitor of phagocytosis in primary rat Kupffer cells. Toxicology 210:197–204. [DOI] [PubMed] [Google Scholar]
  3. Calhoun WJ, Lavins BJ, Minkwitz MC, Evans R, Gleich GJ, Cohn J (1998) Effect of zafirlukast (Accolate) on cellular mediators of inflammation: bronchoalveolar lavage fluid findings after segmental antigen challenge. Am J Respir Crit Care Med 157:1381–1389. [DOI] [PubMed] [Google Scholar]
  4. Calhoun WJ, Reed HE, Moest DR, Stevens CA (1992) Enhanced superoxide production by alveolar macrophages and air-space cells, airway inflammation, and alveolar macrophage density changes after segmental antigen bronchoprovocation in allergic subjects. Am Rev Respir Dis 145:317–325. [DOI] [PubMed] [Google Scholar]
  5. Cederbaum AI (2010) Role of CYP2E1 in ethanol-induced oxidant stress, fatty liver and hepatotoxicity. Dig Dis 28:802–811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chaudhari N, Talwar P, Parimisetty A, Lefebvre d’Hellencourt C, Ravanan P (2014) A molecular web: endoplasmic reticulum stress, inflammation, and oxidative stress.Front Cell Neurosci 8:213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Curry-McCoy TV, Venado A, Guidot DM, Joshi PC (2013) Alcohol ingestion disrupts alveolar epithelial barrier function by activation of macrophage-derived transforming growth factor beta1. Respir Res 14:39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Garcia-Villafranca J, Guillen A, Castro J (2008) Ethanol consumption impairs regulation of fatty acid metabolism by decreasing the activity of AMP-activated protein kinase in rat liver. Biochimie 90:460–466. [DOI] [PubMed] [Google Scholar]
  9. Gauthier TW, Drews-Botsch C, Falek A, Coles C, Brown LA (2005) Maternal alcohol abuse and neonatal infection. Alcohol Clin Exp Res 29:1035–1043. [DOI] [PubMed] [Google Scholar]
  10. Kaphalia BS, Cai P, Khan MF, Okorodudu AO, Ansari GA (2004) Fatty acid ethyl esters: markers of alcohol abuse and alcoholism. Alcohol 34:151–158. [DOI] [PubMed] [Google Scholar]
  11. Kaphalia L, Boroumand N, Hyunsu J, Kaphalia BS, Calhoun WJ (2014) Ethanol metabolism, oxidative stress, and endoplasmic reticulum stress responses in the lungs of hepatic alcohol dehydrogenase deficient deer mice after chronic ethanol feeding. Toxicol Appl Pharmacol 277:109–117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kaphalia L, Calhoun WJ (2013) Alcoholic lung injury: metabolic, biochemical and immunological aspects. Toxicol Lett 222:171–179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kaphalia L, Kalita M, Kaphalia BS, Calhoun WJ (2016) Effects of acute ethanol exposure on cytokine production by primary airway smooth muscle cells. Toxicol Appl Pharmacol 292:85–93. [DOI] [PubMed] [Google Scholar]
  14. Karavitis J, Kovacs EJ (2011) Macrophage phagocytosis: effects of environmental pollutants, alcohol, cigarette smoke, and other external factors. J Leukoc Biol 90:1065–1078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lange LG, Sobel BE (1983) Mitochondrial dysfunction induced by fatty acid ethyl esters, myocardial metabolites of ethanol. J Clin Invest 72:724–731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Livak KJ, Schittgen TD (2001) Analysis of reactive gene expression data using real time quantitative PCR and the z(-DeltaDeltaC/T) method. Methods 25: 404–408. [DOI] [PubMed] [Google Scholar]
  17. Liang Y, Harris FL, Jones DP, Brown LA (2013) Alcohol induces mitochondrial redox imbalance in alveolar macrophages. Free Radic Biol Med 65:1427–1434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu JQ, Zhang L, Yao J, Yao S, Yuan T (2018) AMPK alleviates endoplasmic reticulum stress by inducing the ER-chaperone ORP150 via FOXO1 to protect human bronchial cells from apoptosis. Biochem Biophys Res Commun 497:564–570. [DOI] [PubMed] [Google Scholar]
  19. Manautou JE, Buss NJ, Carlson GP (1992) Oxidative and non-oxidative metabolism of ethanol by the rabbit lung. Toxicol Lett 62:93–99. [DOI] [PubMed] [Google Scholar]
  20. Manautou JE, Carlson GP (1991) Ethanol-induced fatty acid ethyl ester formation in vivo and in vitro in rat lung. Toxicology 70:303–312. [DOI] [PubMed] [Google Scholar]
  21. Mehta AJ, Guidot DM (2012) Alcohol abuse, the alveolar macrophage and pneumonia. Am J Med Sci 343:244–247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Munger JS, Shi GP, Mark EA, Chin DT, Gerard C, Chapman HA (1991) A serine esterase released by human alveolar macrophages is closely related to liver microsomal carboxylesterases. J Biol Chem 266:18832–18838. [PubMed] [Google Scholar]
  23. Nuutinen H, Lindros KO, Salaspuro M (1983) Determinants of blood acetaldehyde level during ethanol oxidation in chronic alcoholics. Alcohol Clin Exp Res 7:163–168. [DOI] [PubMed] [Google Scholar]
  24. O’Neill LA, Hardie DG (2013) Metabolism of inflammation limited by AMPK and pseudo-starvation. Nature 493:346–355. [DOI] [PubMed] [Google Scholar]
  25. Panes J, Caballeria J, Guitart R, Pares A, Soler X, Rodamilans M, Navasa M, Pares X, Bosch J, Rodes J (1993) Determinants of ethanol and acetaldehyde metabolism in chronic alcoholics. Alcohol Clin Exp Res 17:48–53. [DOI] [PubMed] [Google Scholar]
  26. Panes J, Soler X, Pares A, Caballeria J, Farres J, Rodes J, Pares X (1989) Influence of liver disease on hepatic alcohol and aldehyde dehydrogenases. Gastroenterology 97:708–714. [DOI] [PubMed] [Google Scholar]
  27. Pohlers D, Brenmoehl J, Loffler I, Muller CK, Leipner C, Schultze-Mosgau S, Stallmach A, Kinne RW, Wolf G (2009) TGF-beta and fibrosis in different organs - molecular pathway imprints. Biochimica et biophysica acta 1792:746–756. [DOI] [PubMed] [Google Scholar]
  28. Schmitt JM, Wayman GA, Nozaki N, Soderling TR (2004) Calcium activation of ERK mediated by calmodulin kinase I. J Biol Chem 279:24064–24072. [DOI] [PubMed] [Google Scholar]
  29. Sid B, Verrax J, Calderon PB (2013) Role of AMPK activation in oxidative cell damage: Implications for alcohol-induced liver disease. Biochem Pharmacol 86:200–209. [DOI] [PubMed] [Google Scholar]
  30. Soardo G, Donnini D, Domenis L, Catena C, De Silvestri D, Cappello D, Dibenedetto A, Carnelutti A, Bonasia V, Pagano C, Sechi LA (2011) Oxidative stress is activated by free fatty acids in cultured human hepatocytes. Metab Syndr Relat Disord 9:397–401. [DOI] [PubMed] [Google Scholar]
  31. Sueblinvong V, Tseng V, Smith T, Saghafi R, Mills ST, Neujahr DC, Guidot DM (2014) TGFbeta1 mediates alcohol-induced Nrf2 suppression in lung fibroblasts. Alcohol Clin Exp Res 38:2731–2742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Tomita K, Tamiya G, Ando S, Kitamura N, Koizumi H, Kato S, Horie Y, Kaneko T, Azuma T, Nagata H, Ishii H, Hibi T (2005) AICAR, an AMPK activator, has protective effects on alcohol-induced fatty liver in rats. Alcohol Clin Exp Res 29:240S–245S. [DOI] [PubMed] [Google Scholar]
  33. Viollet B, Horman S, Leclerc J, Lantier L, Foretz M, Billaud M, Giri S, Andreelli F (2010) AMPK inhibition in health and disease. Crit Rev Biochem Mol Biol 45:276–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Woods A, Dickerson K, Heath R, Hong SP, Momcilovic M, Johnstone SR, Carlson M, Carling D (2005) Ca2+/calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells. Cell metabolism 2:21–33. [DOI] [PubMed] [Google Scholar]
  35. Wu H, Cai P, Clemens DL, Jerrells TR, Ansari GA, Kaphalia BS (2006) Metabolic basis of ethanol-induced cytotoxicity in recombinant HepG2 cells: role of nonoxidative metabolism. Toxicol Appl Pharmacol 216:238–247. [DOI] [PubMed] [Google Scholar]
  36. Wu H,Bhopale KK, Ansari GA, Kaphalia BS (2008) Ethanol-induced cytotoxicity in rat pancreatic acinar AR42J cells: role of fatty acid ethyl esters. Alcohol Alcohol. 43:1–8. [DOI] [PubMed] [Google Scholar]
  37. Yehualaeshet T, O’Connor R, Green-Johnson J, Mai S, Silverstein R, Murphy-Ullrich JE, Khalil N (1999) Activation of rat alveolar macrophage-derived latent transforming growth factor beta-1 by plasmin requires interaction with thrombospondin-1 and its cell surface receptor, CD36. Am J Pathol 155:841–851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yeligar SM, Mehta AJ, Harris FL, Brown LA, Hart CM. Peroxisome Proliferator-Activated Receptor γ Regulates Chronic Alcohol-Induced Alveolar Macrophage Dysfunction. Am J Respir Cell Mol Biol. 2016; 55(1):35–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yeligar SM, Harris FL, Hart CM, Brown LA. Glutathione attenuates ethanol-induced alveolar macrophage oxidative stress and dysfunction by downregulating NADPH oxidases. Am J Physiol Lung Cell Mol Physiol. 2014; 306(5):L429–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. You M, Matsumoto M, Pacold CM, Cho WK, Crabb DW (2004) The role of AMP-activated protein kinase in the action of ethanol in the liver. Gastroenterology 127:1798–1808. [DOI] [PubMed] [Google Scholar]
  41. Zhang K, Kaufman RJ (2008) From endoplasmic-reticulum stress to the inflammatory response. Nature 454:455–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhao X, Zmijewski JW, Lorne E, Liu G, Park YJ, Tsuruta Y, Abraham E (2008) Activation of AMPK attenuates neutrophil proinflammatory activity and decreases the severity of acute lung injury. Am J Physiol Lung Cell Mol Physiol 295:L497–504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ, Moller DE (2001) Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest 108:1167–1174. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp FigS1

Fig. 1. Western blot analysis for IL-6 (a), IL-8 (b) and TGF-β1(c) in AMs incubated with EtOH at 37°C for 24 hr. β-actin was used as a loading control and to normalize the protein concentration. Values are mean ± standard deviation (n = 3). *- p value ≤0.05.

Supp FigS2

Fig. 2. Western blot analysis for IL-6 (a), IL-8 (b) and TGF-β1 (c) in AMs incubated with FAEEs (mixed in a ratio formed in the mice lungs) at 37°C for 24 hr. β-actin was used as a loading control and to normalize the protein concentration. Values are mean ± standard deviation (n=2).

RESOURCES