Abstract
The ability of Staphylococcus aureus and other pathogens to consume glucose is critical during infection. However, glucose consumption increases the cellular demand for manganese sensitizing S. aureus to host-imposed manganese starvation. The current investigations were undertaken to elucidate how S. aureus copes with the need to consume glucose when metal-limited by the host. A critical component of host defense is production of the manganese binding protein calprotectin. S. aureus has two variants of phosphoglycerate mutase, one of which is manganese-dependent, GpmI, and another that is manganese-independent, GpmA. Leveraging the ability to impose metal starvation in culture utilizing calprotectin revealed that the loss of GpmA, but not GpmI, sensitized S. aureus to manganese starvation. Metabolite feeding experiments revealed that the growth defect of GpmA when manganese-starved was due to a defect in glycolysis and not gluconeogenesis. Loss of GpmA reduces the ability of S. aureus to cause invasive disease in wild type mice. However, GpmA was dispensable in calprotectin-deficient mice, which have defects in manganese sequestration, indicating that this isozyme contributes to the ability of S. aureus to overcome manganese limitation during infection. Cumulatively, these observations suggest that expressing a metal-independent variant enables S. aureus to consume glucose while mitigating the negative impact that glycolysis has on the cellular demand for manganese. S. aureus is not the only bacterium that expresses manganese-dependent and -independent variants of phosphoglycerate mutase. Similar results were also observed in culture with Salmonella enterica serovar Typhimurium mutants lacking the metal-independent isozyme. These similar observations in both Gram-positive and Gram-negative pathogens suggest that expression of metal-independent glycolytic isozymes is a common strategy employed by bacteria to survive in metal-limited environments, such as the host.
Author summary
Pathogens, such as Staphylococcus aureus and Salmonella species, must be able to consume glucose in order to cause infection. However, glycolysis can increase the need for manganese and sensitize invaders to the manganese-withholding defense of the host, known as nutritional immunity. How pathogens manage these conflicting pressures is currently unknown. The current investigations revealed that a second metal-independent variant of phosphoglycerate mutase possessed by both S. aureus and Salmonella enables them to grow and consume glycolytic substrates in the presence of the manganese-binding immune effector calprotectin. Infection experiments revealed that the manganese-independent isozyme critically contributes to the ability of S. aureus to overcome manganese starvation during infection. Together, these results suggest that using metal-independent isozymes to enable the consumption of sugars within the host or other metal-limited environments is a common strategy employed by diverse bacteria.
Introduction
The preferred carbon source for many pathogens is glucose and disruption of glycolysis reduces the ability of many invaders to cause infection [1–10]. The primacy of glucose as an energy source is emphasized by catabolite repression, which prevents bacteria from utilizing other carbon sources when glucose is present [1–3, 11–13]. The advantage that sugar consumption provides is highlighted by the increased sensitivity of individuals with diabetes, especially those with hyperglycemia, to infections by Staphylococcus aureus, Streptococcus pneumoniae, Mycobacterium tuberculosis, Escherichia coli, Klebsiella pneumoniae and Candida albicans [14–17]. At the same time, host defenses reduce the ability of pathogens to consume glycolytic substrates by limiting metal availability or via other mechanisms [18, 19]. The spread of antibiotic-resistant isolates has led the Centers for Disease Control and Prevention (CDC) and the World Health Organization (WHO) to call for the development of novel therapeutics to treat S. aureus and other pathogens [20, 21]. Understanding how pathogens generate energy and preserve the activity of critical metabolic pathways despite the concerted efforts of the immune system has the potential to identify new opportunities for therapeutic intervention.
Transition metals such as iron (Fe), manganese (Mn) and zinc (Zn) are essential for life, as they play an important role in facilitating the structure and function of proteins [22]. The host takes advantage of this essentiality by restricting the availability of Fe, Mn and Zn during infection, a defense known as nutritional immunity [23–28]. The prototypic example of Mn and Zn restriction is the staphylococcal abscess, which is virtually devoid of these metals [25, 29]. A key mediator of the host Mn-withholding response is the immune effector calprotectin (CP). A heterodimer of S100A8 and S100A9, CP possesses two transition metal binding sites that chelate Mn and Zn with nanomolar and femtomolar affinities, respectively [25, 27, 30–35]. Although CP binds other metals, including Fe (II) and nickel (Ni) [36, 37], the primary metals withheld from S. aureus are Mn and Zn. CP comprises ~50% of the total protein in the neutrophil cytoplasm and CP concentrations can exceed 1 mg/ml at sites of infection [38, 39]. Mice lacking CP have defects in Mn sequestration and are more sensitive to a range of bacterial and fungal pathogens, including S. aureus, Acinetobacter baumannii, K. pneumoniae and Aspergillus fumigatus [25–27, 40, 41].
During infection, nutritional immunity inactivates Mn-dependent bacterial processes such as the Mn-dependent superoxide dismutase possessed by S. aureus. This in turn renders S. aureus more sensitive to the oxidative burst of immune cells. While glycolysis is canonically believed to be a magnesium-dependent process [42], many bacteria possess Mn-dependent variants of glycolytic enzymes, including phosphoglycerate mutase, enolase and pyruvate kinase [43–50]. In fact, in a number of pathogens, including S. aureus and S. pneumoniae, the consumption of sugars is dependent on Mn availability [18, 51]. At the same time, glycolysis is critically important for the ability of S. aureus to cause infection and mutations that reduce the activity of this pathway frequently result in virulence defects and sensitize the bacterium to other host defenses such as NO· produced by immune cells [4–8]. While the best characterized mechanism utilized by bacteria to resist nutritional immunity is the use of high-affinity metal transporters, S. aureus and other pathogens also possess transporter-independent adaptations that critically contribute to the ability of the bacteria to overcome nutritional immunity [18, 29, 52–55]. However, mechanisms that would enable them to maximize the consumption of sugars via glycolysis when metal-starved have not been described.
Despite increasing the cellular demand for Mn and sensitizing S. aureus to Mn starvation, we recently observed that S. aureus prefers to consume glucose even when Mn-starved by CP [18, 55]. This paradoxical use of glycolysis despite the associated increase in cellular demand for Mn likely occurs in part as the fermentation of sugars enables the bacterium to generate energy when exposed to NO· produced by activated immune cells [8]. At the same time, it highlights a challenge faced by S. aureus and other pathogens, where adapting to one host defense sensitizes the bacterium to another aspect of the immune response [18, 55]. Many bacteria, including S. aureus, possess multiple copies of glycolytic enzymes. While the presence of multiple isozymes is frequently associated with glycolytic and gluconeogenic flux, we wondered if another reason for maintaining multiple isozymes might exist. Specifically, we hypothesized that multiple copies of glycolytic enzymes may help S. aureus and other pathogens mitigate the stress of consuming sugars when metal-starved. The current investigations revealed that expression of a second metal-independent variant of phosphoglycerate mutase enables S. aureus to maintain the ability to consume glucose when Mn-starved and critically contributes to resisting nutritional immunity during infection. Similar results were also observed with Salmonella enterica, suggesting that expression of metal-independent isozymes is a common strategy employed by bacteria to survive in metal-limited environments.
Results
Expression of metal-independent glycolytic enzymes increases in response to host-imposed metal starvation
As an initial step to identify how S. aureus promotes retention of glycolysis during infection, the repertoire of glycolytic enzymes possessed by S. aureus was assessed. This analysis revealed that S. aureus possess two copies of glyceraldehyde-3-phosphate dehydrogenase, aldolase and phosphoglycerate mutase. Notably, one of the phosphoglycerate mutase isozymes, GpmI, is predicted to be Mn-dependent, while the other, GpmA, is Mn-independent, utilizing 2,3-bisphosphoglycerate as a catalytic cofactor [56, 57]. GpmI is encoded by the glycolytic operon that contains gapR, gapA, pgk, tpiA and eno, whereas gpmA is not part of an operon and is expressed independently of other glycolytic enzymes (Fig 1A). The fact that gpmI is in a locus with many other glycolytic enzymes, while gpmA is in a separate location, suggests that GpmI is the primary phosphoglycerate mutase and that GpmA is the secondary enzyme. One possibility is that GpmI and GpmA have directional preferences, with GpmI being essential for glycolysis and GpmA being essential for gluconeogenesis, as has been suggested for the two isozymes of glyceraldehyde-3-phosphate dehydrogenase encoded by S. aureus [58]. However, it is also possible that the metal-independent variant promotes retention of glycolytic flux when metal-starved by the host. As an initial step in evaluating this latter idea, expression of gpmA and gpmI in wild type bacteria exposed to CP was assessed. While expression of gpmI did not change, gpmA levels increased ~40-fold in response to CP (Fig 1B). Expression of gpmA was also induced in a S. aureus mutant lacking the Mn transporters MntABC and MntH (ΔmntCΔmntH) to a level comparable to that caused by CP (Fig 1C). In contrast, expression of gpmI did not change in the ΔmntCΔmntH mutant (Fig 1D). Cumulatively, these observations suggest that GpmI is the primary phosphoglycerate mutase used by S. aureus and that GpmA may be important when the bacteria experience Mn limitation.
Fig 1. S. aureus induces a metal-independent phosphoglycerate mutase in response to calprotectin.
(A) The chromosomal location of gpmI and gpmA is depicted. gpmI is part of the glycolytic operon, while gpmA is not part of an operon and is in a separate location. Not to scale. (B) Wild type S. aureus was grown in rich medium in the presence and absence of 240 μg/ml of CP and transcript levels of gpmA and gpmI were assessed by qRT-PCR. Expression was compared to wild type bacteria grown in the absence of CP. * = p≤0.05 relative to media alone by two-way ANOVA on log-transformed values with Tukey’s multiple comparisons test. (C-D) Wild type S. aureus and ΔmntCΔmntH were grown in rich medium in the presence and absence of 240 μg/ml of CP and transcript levels of gpmA (C) and gpmI (D) were assessed by qRT-PCR. Expression was compared to wild type bacteria grown in the absence of CP. * = p≤0.05 relative to media alone by one-way ANOVA on log-transformed values with Tukey’s multiple comparisons test. Error bars indicate SEM. n≥3.
Expression of a metal-independent phosphoglycerate mutase promotes staphylococcal resistance to manganese starvation
To elucidate the respective contributions of the two staphylococcal phosphoglycerate mutases to resisting metal starvation, wild type as well as ΔgpmA and ΔgpmI mutants were evaluated for their ability to grow in the presence of CP. Loss of the metal-dependent isozyme, GpmI, in S. aureus Newman did not alter the sensitivity of S. aureus to CP. Conversely, loss of the metal-independent isozyme profoundly sensitized S. aureus to CP (Fig 2A, S1A Fig). Expression of GpmA from a plasmid reversed the increased sensitivity of ΔgpmA to CP (Fig 2B, S1B Fig). Increased sensitivity to CP was also observed upon loss of GpmA in the community-acquired MRSA strain USA300 JE2 (Fig 2C, S1C Fig), which was also reversed by expression of GpmA from a plasmid (Fig 2D, S1D Fig). Together, these results demonstrate that loss of GpmA makes S. aureus more sensitive to CP-imposed metal starvation.
Fig 2. Expression of a metal-independent phosphoglycerate mutase promotes resistance to manganese starvation.
(A) Wild type S. aureus Newman, ΔgpmA and ΔgpmI and (B) wild type S. aureus Newman and ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt:gpmA (plgt:gpmA) were grown in rich medium in the presence of increasing concentrations of CP (t = 7). (C) Wild type USA300 JE2, ΔgpmA and ΔgpmI and (D) wild type USA300 JE2 and ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt:gpmA (plgt:gpmA) were grown in rich medium in the presence of increasing concentrations of CP (t = 7). (E) Growth of wild type S. aureus Newman, ΔgpmA and ΔgpmI in the presence of 240 μg/ml of wild type CP as well as the ΔS1 and ΔS2 site mutants (t = 7). (F) Growth of wild type S. aureus Newman, ΔgpmA and ΔgpmI derivatives in NRPMI in the presence and absence of 1 μM MnCl2 or 1 μM ZnSO4 (t = 8). * = p≤0.05 relative to wild type and ΔgpmI by two-way ANOVA with Tukey’s multiple comparisons test. n≥3. Error bars indicate SEM. Also see S1 Fig.
To determine if Mn or Zn restriction was responsible for the increased sensitivity of ΔgpmA to CP, we leveraged CP binding site mutants with altered metal-binding properties [27, 32]. Similar to WT CP, when ΔgpmA was grown in the presence of the ΔS2 mutant, which can bind either Mn or Zn, it was more sensitive to CP treatment than wild type bacteria or ΔgpmI (Fig 2E). However, in the presence of the ΔS1 mutant, which cannot bind Mn, the increased sensitivity of ΔgpmA was abrogated. These observations suggest that loss of GpmA impairs the ability of the bacteria to cope with CP-induced Mn limitation. To further test this idea, wild type S. aureus, ΔgpmA and ΔgpmI were grown in medium depleted of Mn and Zn (NRPMI). Similar to what was observed in the presence of CP, the ΔgpmA mutant had a severe growth defect compared to wild type bacteria and the ΔgpmI mutant (Fig 2F, S1E Fig). The growth defect of the ΔgpmA mutant in this medium was reversed by the addition of Mn but not Zn. Collectively, these results demonstrate that GpmA is crucial for growth when S. aureus is Mn-starved.
Expression of a metal-independent isozyme facilitates retention of glycolysis when Mn-starved
The majority of enzymes in the glycolytic pathway, including phosphoglycerate mutase, can be used for flux in both directions [59, 60]. To determine if the GpmA-dependent growth defect is associated with decreased glycolytic or gluconeogenic activity, wild type S. aureus, ΔgpmA and ΔgpmI were grown in the presence of CP in a defined medium supplemented with either glucose or Casamino acids as the sole energy source. In the presence of glucose, the ΔgpmA mutant was more sensitive to CP than wild type bacteria or ΔgpmI (Fig 3A, S2A Fig). In contrast, there was no difference between any of the strains when Casamino acids were provided (Fig 3B, S2B Fig). Supplementation of the glucose-containing medium with sodium pyruvate, which bypasses the phosphoglycerate mutase step, also enabled the ΔgpmA mutant to grow as well as wild type S. aureus or the ΔgpmI mutant (Fig 3C, S2C Fig). Together, these observations indicate that loss of GpmA reduces the ability of S. aureus to consume glucose when Mn-starved. To evaluate if this apparent defect in glycolysis extended to other substrates dependent on glycolysis for consumption, growth of the ΔgpmA and ΔgpmI mutants in defined medium supplemented with glycerol was assessed. In the presence of glycerol, which enters glycolysis upstream of phosphoglycerate mutase, as the sole carbon source the ΔgpmA mutant was more sensitive to CP than wild type bacteria or ΔgpmI (Fig 3D, S2D Fig). Combined, these results reveal that GpmA plays an important role in retaining the ability to consume glycolytic substrates when Mn-starved.
Fig 3. Expression of a metal-independent isozyme facilitates retention of glycolysis when manganese-starved.

(A-D) S. aureus wild type, ΔgpmA and ΔgpmI were grown in defined medium supplemented with (A) glucose (DM + glucose), (B) Casamino acids (DM + AA), (C) glucose and sodium pyruvate (DM + glucose + pyruvate) or (D) glycerol (DM + glycerol) as a carbon source in the presence of increasing concentrations of CP (t = 7). * = p≤0.05 relative to wild type and ΔgpmI by two-way ANOVA with Tukey’s multiple comparisons test. n≥3. Error bars indicate SEM. Also see S2 Fig.
Loss of GpmA does not affect manganese transporter function
The expression of Mn transporters is critical for the ability of S. aureus to resist host-imposed Mn starvation [29]. To confirm that the enhanced sensitivity of the ΔgpmA mutant was not due to an unanticipated impact on Mn transporter activity, ΔmntCΔmntHΔgpmA and ΔmntCΔmntHΔgpmI strains were assessed for CP sensitivity. Loss of GpmA, but not GpmI, in the ΔmntCΔmntH background further increased the sensitivity of the transporter double mutant, suggesting that GpmA and the Mn transporters function independently to promote resistance to Mn starvation (Fig 4A and 4B, S4A–S4C Fig). Expression of GpmA from a plasmid reverted the CP sensitivity of ΔmntCΔmntHΔgpmA back to that of the ΔmntCΔmntH mutant (Fig 4C). Cumulatively, these results suggest that loss of GpmA does not sensitize the bacteria to Mn starvation by reducing Mn transport but rather by a Mn transporter-independent mechanism.
Fig 4. Loss of GpmA sensitizes S. aureus to manganese limitation in the absence of manganese transporters.
The growth of (A) wild type, ΔgpmA, ΔmntC ΔmntH and ΔmntC ΔmntH ΔgpmA and (B) wild type, ΔgpmI, ΔmntC ΔmntH and ΔmntC ΔmntH ΔgpmI were assessed in rich medium supplemented with 1 μM MnCl2 and 1 μM ZnSO4 in the presence of increasing concentrations of CP (t = 8). For these assays, the bacteria were precultured overnight in TSB. * = p≤0.05 by two-way ANOVA with Tukey’s multiple comparisons test. n≥3. Error bars indicate SEM. Strains are normalized to growth of parental strains, i.e., ΔgpmA and ΔgpmI are normalized to wild type and ΔmntC ΔmntH ΔgpmA and ΔmntC ΔmntH ΔgpmI are normalized to ΔmntC ΔmntH. C) Wild type S. aureus, ΔgpmA, ΔmntC ΔmntH, ΔmntC ΔmntH ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt: gpmA (plgt: gpmA) were grown in rich medium supplemented with 1 μM MnCl2 and 1 μM ZnSO4 in the presence of increasing concentrations of CP (t = 8). For these assays, the bacteria were precultured overnight in TSB. * = p≤0.05 by two-way ANOVA with Tukey’s multiple comparisons test. NS = not significant. n≥3. Error bars indicate SEM. Also see S3 Fig.
GpmA is necessary for invasive S. aureus disease and resisting manganese starvation during infection
Culture-based experiments suggest that the Mn-independent activity of GpmA enhances the ability of S. aureus to maintain glycolytic flux when Mn-limited. To evaluate the contribution of the two phosphoglycerate mutases to S. aureus pathogenesis, wild type (C57BL/6) mice were retro-orbitally infected with wild type S. aureus, ΔgpmA, or ΔgpmI and the infection was allowed to proceed for 4 days. During the course of the infection mice infected with ΔgpmA lost significantly less weight than mice infected with wild type S. aureus or ΔgpmI (Fig 5A). Interestingly, mice infected with ΔgpmI lost slightly, but significantly, less weight than mice infected with wild type bacteria. Consistent with the weight loss, the ΔgpmA mutant had significantly decreased bacterial burdens in the liver, heart, and kidneys when compared to wild type bacteria (Fig 5B and 5C) indicating that GpmA plays an important role in establishing systemic disease. While mice infected with ΔgpmI did not show a statistically significant decrease in bacterial burdens in any of the organs, bacterial burdens in the kidneys were slightly lower than in mice infected with wild type bacteria (Fig 5C). To evaluate if the importance of GpmA during infection is driven by host restriction of Mn availability, CP-deficient (C57BL/6 S100A9-/-) mice, which do not remove Mn from liver abscesses [25, 29], were infected with wild type bacteria, ΔgpmA or ΔgpmI. Relative to wild type mice, the CP-deficient mice infected with ΔgpmA had increased bacterial burdens, indicating that the importance of GpmA during infection is driven by host-imposed Mn limitation. Moreover, in CP-deficient mice there was no difference in bacterial burdens between wild type bacteria, ΔgpmA or ΔgpmI (Fig 5B), suggesting either phosphoglycerate mutase isozyme is sufficient when Mn is available. Cumulatively, these results indicate that GpmA contributes to staphylococcal infection by promoting retention of glycolytic activity when Mn-starved by the host.
Fig 5. GpmA is necessary for invasive S. aureus disease and resisting manganese starvation.
Wild type C57BL/6 (C57) and CP-deficient C57BL/6 S100A9-/- (CP-/-) mice were infected with either S. aureus wild type, ΔgpmA or ΔgpmI and (A) mean weight loss and (B-C) bacterial burdens in the (B) liver and (C) heart and kidneys were assessed after four days of infection. (A) *,# = p≤0.05 as determined by two-way ANOVA with Tukey’s multiple comparisons test, with * compared to wild type bacteria and # compared to ΔgpmI. (B-C) * = p≤0.05 as determined by Mann-Whitney test for bacterial burdens. The lines indicate the mean. The data are the results from two independent experiments.
A metal-independent phosphoglycerate mutase enables glycolysis when Salmonella is manganese-starved
The expression of metal-dependent and -independent variants of phosphoglycerate mutase is not unique to S. aureus, and many pathogenic bacteria including E. coli, Shigella flexneri, S. enterica, Pseudomonas aeruginosa, Listeria monocytogenes and others possess both forms [57]. However, the molecular rationale for retaining two phosphoglycerate mutase isozymes in these organisms remains unknown [57]. In light of our observation with S. aureus, we wondered if metal-independent variants of phosphoglycerate mutase broadly promote retention of glycolytic potential when experiencing Mn starvation. To test this idea, the ability of wild type S. enterica serovar Typhimurium and a ΔgpmA mutant to grow in rich medium in the presence of CP was assessed. Similar to S. aureus, the Salmonella ΔgpmA mutant was more sensitive to CP treatment than wild type bacteria (Fig 6A, S4A Fig). Use of the CP variants with altered metal-binding properties revealed that loss of GpmA impaired the ability of Salmonella to cope with CP-induced Mn limitation (Fig 6B). Cumulatively, these observations establish that expression of a Mn-independent variant of phosphoglycerate mutase promotes the growth of Salmonella when metal-starved.
Fig 6. A metal-independent phosphoglycerate mutase enables glycolysis when S. enterica serovar Typhimurium is manganese-starved.
(A & B) Wild type Salmonella and ΔgpmA were grown in rich medium in the presence of (A) increasing concentrations of CP or (B) 240 μg/ml of WT CP or the ΔS1 and ΔS2 CP mutants (t = 8). (C-F) Wild type Salmonella and ΔgpmA were grown in defined medium (DM) supplemented with (C) glucose (DM + glucose), (D) Casamino acids (DM + AA), (E) glycerol (DM + glycerol) or (F) sodium pyruvate (DM + pyruvate) as a carbon source in the presence of increasing concentrations of CP (t = 8). * = p≤0.05 relative to wild type by two-way ANOVA with Sidak’s multiple comparisons test. n≥3. Error bars indicate SEM. Also see S4 Fig.
To test if the importance of GpmA to Salmonella growth when metal-starved is attributable to its ability to promote consumption of glycolytic substrates, bacteria were grown in the presence of CP and provided with either glucose or Casamino acids as a carbon source (Fig 6C and 6D, S4B and S4C Fig). As in rich medium, loss of GpmA increased the sensitivity of Salmonella to CP when glucose was provided as the sole carbon source. However, the enhanced sensitivity of the Salmonella ΔgpmA mutant was ablated in the presence of Casamino acids, which do not require the glycolytic pathway for consumption. Additionally, providing sodium pyruvate as a carbon source reversed the increased sensitivity to CP, whereas glycerol did not (Fig 6E and 6F, S4D and S4E Fig). Combined, these results suggest that the expression of metal-independent versions of phosphoglycerate mutase are a common mechanism employed by pathogenic bacteria to resist Mn limitation.
Discussion
The consumption of sugars via glycolysis and metals are important for pathogens during infection [4, 5, 7–10, 24, 61–66]. Sugars are the preferred carbon source for S. aureus and other pathogens and increased availability of glucose renders individuals more sensitive to infection [14–17]. At the same time, the host restricts the availability of metals, inactivating Mn-dependent bacterial processes, including glycolysis [18, 55]. While expression of high-affinity metal transporters enhances the ability of S. aureus and other pathogens to maintain glycolytic flux and are critical for infection, they are insufficient to ensure that the pathogen obtains sufficient Mn to activate Mn-dependent superoxide dismutases [27, 53]. The current work provides yet another example of a critical Mn-dependent enzyme, GpmI, which is inactivated by nutritional immunity. At the same time, host defenses force S. aureus to ferment sugars via the glycolytic pathway, increasing the cellular demand for this metal [5, 7, 8]. The current work identified a critical role for a priori redundant metal-independent variants of phosphoglycerate mutases in both S. aureus and Salmonella in enabling glucose consumption and resisting nutritional immunity. The Mn-independent variant of phosphoglycerate mutase in S. aureus, which is encoded outside of the canonical glycolytic operon, is the primary isozyme used by the bacteria when Mn-starved and is critical for infection due to the host metal-withholding response. The conserved function of the metal-independent variant of phosphoglycerate mutase in both S. aureus and Salmonella suggests that this approach is likely a common strategy for preserving the ability to consume glucose while minimizing the cellular demand for Mn.
S. aureus and Salmonella are not the only pathogens that experience metal limitation during infection nor are they the only pathogens to require glucose consumption for disease [1, 5–10, 28, 65, 66]. It therefore seems likely that other successful pathogens have adaptations that allow them to consume glucose when metal-limited. Notably, in addition to S. aureus and Salmonella, many other bacterial pathogens, including S. flexneri, P. aeruginosa, and L. monocytogenes possess metal-dependent and -independent variants of phosphoglycerate mutase [57]. As CP is one of the most abundant proteins at sites of infection [38, 39], it seems likely that all of these pathogens experience Mn limitation during infection. Combined with the current observations, this suggest that using metal-independent variants of phosphoglycerate mutase to preserve glycolytic function in the host when Mn-starved may be a conserved strategy.
Intriguingly, a number of bacterial pathogens, including S. pneumoniae, Enterococcus faecalis, Haemophilus influenzae, Neisseria meningiditis, and M. tuberculosis possess only a metal-independent version of phosphoglycerate mutase [56, 57]. Similar to other pathogens, all of these organisms would be expected to encounter Mn-limited environments within the host. This raises the possibility that possessing only the metal-independent variant of phosphoglycerate mutase represents further adaptation to life in a Mn-poor environment. At the same time, the majority of bacteria, archaea, protozoa and fungi, including pathogens, possesses both metal-dependent and -independent versions of phosphoglycerate mutase. However, others, such as Helicobacter pylori, possesses only the metal-dependent variant but also encounter CP during infection [67]. The biochemical differences between the metal-dependent and independent-variants of phosphoglycerate mutase extend beyond their cofactor [47, 56, 68–70]. Notably, in S. aureus the metal-dependent variant is in the primary glycolytic operon. Together, these observations suggest that the metal-dependent variants of phosphoglycerate mutase provide some biological advantage.
Phosphoglycerate mutase is not the only enzyme in the glycolytic pathway that contains both metal-dependent and -independent versions. Both metal-dependent and -independent variants of fructose bisphosphate aldolase exist, and many pathogenic bacteria, including S. aureus, Salmonella, Borrelia burgdorferi, S. pneumoniae, and K. pneumoniae contain both enzymes. The metal-dependent variant is classically thought to utilize Zn as a cofactor [71–73]. Similar to GpmA, which is upregulated in response to CP treatment, the metal-independent staphylococcal aldolase is also upregulated in the presence of CP [74]. As aldolase is the only staphylococcal enzyme in glycolysis predicted to use Zn, this could explain why CP-imposed Mn limitation but not Zn limitation inactivates glycolysis in S. aureus [18, 55]. More broadly, it suggests that the metal-independent fructose bisphosphate aldolase may contribute to retaining glycolytic function when metal-starved by the host. In both Salmonella and B. burgdorferi, the Zn-independent aldolase has been suggested to provide a mechanism for the bacteria to consume glucose when experiencing nitrosative stress [19]. In the case of B. burgdorferi, nitrosative stress was suggested to damage the Zn-dependent isozyme [19]. At the same time, in S. aureus nitrosative stress has been observed to lead to a transcriptional response similar to that seen when Zn-starved [74]. Regardless of the stress that the metal-independent aldolase responds to, these observations suggest that metal-independent isozymes are likely to be generally important to the ability of bacteria to maintain glycolytic flux during infection.
The presence of two isozymes with differing metal utilization is not limited to glycolysis or S. aureus and Salmonella. In Bacillus subtilis, Fe limitation leads to induction of the Fe-sparing response, which includes increased expression of flavodoxin that can replace the iron-containing electron transfer protein ferredoxin [75]. Similarly, E. coli contains two ribonucleotide reductases, a primary Fe-dependent enzyme, and a Mn-dependent enzyme that is crucial for survival when bacteria experience superoxide stress or Fe limitation [76, 77]. Similarly, in response to Zn limitation, B. subtilis will induce expression of an alternative Zn-independent folate biosynthesis enzyme, GTP cyclohydrolase-IB (GCYH-IB). Induction of GCYH-IB prevents Zn starvation from inducing a folate auxotrophy [78]. B. subtilis also possesses L31* and L33*, Zn-independent ribosomal proteins, which promote survival when Zn-starved [79, 80]. Combined with the current observations, this suggests that replacing metal-dependent enzymes with metal-independent variants is a common strategy for surviving Fe, Zn and Mn limitation. Notably, the switch between utilizing the metal-dependent and -independent isozyme is frequently driven by a metal-sensing regulator [75, 76, 78–80]. In S. aureus, loss of the Fe-sensing regulator represses the expression of gpmA, but it is not predicted to be regulated by the Mn-sensing regulator MntR [81]. While the mechanisms that control expression of GpmA are unknown, this suggests that metal-independent regulatory circuits also play an important role in coordinating a response to metal starvation. This idea is supported by the observation that ArlRS, which contributes to staphylococcal growth in Mn-poor environments, appears not to sense Mn directly but rather the impact that Mn starvation has on glycolytic flux (Parraga et. al. In Press).
The current investigations add metal-dependent and -independent phosphoglycerate mutases to the growing list of enzymes that carry out apparently redundant biochemical reactions, but whose distinct reaction mechanisms enable microbes to cause infection or survive in other stressful environments [5, 6, 19, 75, 76, 78–80]. Many of these false redundancies have been identified by studying how microbes respond to metal limitation [75–80]. However, the importance of other pseudo-redundant enzymes has been revealed by investigating how pathogens cope with other stresses experienced during infection, such as the contribution of a second staphylococcal lactic acid dehydrogenase to growth in the presence of nitric oxide and infection [5, 6, 19]. While diverse stresses have been examined, a common denominator in all of these studies is that they have pushed the microbes outside of their ideal environments. As the importance of physiology to pathogenesis continues to be revealed, the current and prior studies reveal the importance of considering the environment encountered within the host when evaluating the contribution of enzymes to metabolism and infection.
Materials and methods
Ethics statement
All experiments involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the University of Illinois Urbana-Champaign (IACUC license number 15059) and performed according to NIH guidelines, the Animal Welfare Act, and US Federal law.
Bacterial strains
Bacteria were routinely grown on tryptic soy agar (TSA) plates. For routine overnight cultures, bacteria were grown in 5 ml of tryptic soy broth (TSB) or in Chelex-treated RPMI plus 1% Casamino acids (NRPMI) supplemented with 1 mM MgCl2, 100 μM CaCl2 and 1 μM FeCl2 [29] in 15 ml conical tubes at 37°C on a roller drum. As needed, 10 μg/ml of chloramaphenicol was added for plasmid maintenance. S. aureus strain Newman and its derivatives were used for all of the experiments, unless otherwise indicated. For experiments using USA300 JE2 and derivatives (USA300 JE2 gpmA:erm and USA300 JE2 gpmI:erm), strains were obtained from the Nebraska library [82]. gpmA:erm, gpmI:erm, ΔmntCΔmntH gpmA:erm and ΔmntCΔmntH gpmI:erm were generated by transducing the gpmA:erm and gpmI:erm alleles via Φ85 phage from USA300 JE2 gpmA:erm and USA300 JE2 gpmI:erm. As needed 500 μM MnCl2 was added to agar plates to facilitate recovery of mutants. All constructs were confirmed to be hemolytic by growth on TSA blood agar plates. To generate constructs for complementation studies, the gpmA coding sequence was amplified with the indicated primers (Table 1) and cloned into the pOS1 vector under the control of the Plgt promoter [83].
Table 1. PCR primers used in this study.
| Name | Sequence |
|---|---|
| GpmA 5’ Comp | AGTCCATATGCCAAAATTAATTTTATGTCGTC |
| GpmA 3' Comp | AGTCGGATCCTTATAAGTAGTATTTATC |
| 16S rRNA-F | GCTGCAGCTAACGCATTAAGCACT |
| 16S rRNA-R | TTAAACCACATGCTCCACCGCTTG |
| GpmA F | GCGTTTAAATGAACGCCACT |
| GpmA R | CACGTTGTTCTTCGGTTTCA |
| GpmI F | AGAGCAGCGCAATTATCGGA |
| GpmI R | TCGAAGACGATAGCCGCATC |
| K.O. gpmA F | ATGATTTATAGGAGTGAGAGTTGTAGGCTGGAGCTG |
| K.O. gpmA R | TATACCGCCATCCGGCAAAGGTGACATATGAATATCCTC |
S. enterica serovar Typhimurium strain 14028 was used for all Salmonella experiments. The deletion of gpmA by inserting a chloramphenicol cassette was carried out using lambda red-mediated recombination as described previously using the indicated primers (Table 1) [84, 85]. The insertion of the cassette was checked by PCR analysis and the construct was moved into a clean background by P22 transduction.
CP growth assays
CP growth assays were performed as described previously [27, 32]. Briefly, overnight cultures (grown 16–18 h at 37°C on a roller drum) were used directly and diluted 1:100 into 96-well round-bottom plates containing 100 μl of growth medium (38% TSB and 62% calprotectin buffer (20 mM Tris pH 7.5, 100 mM NaCl, 3 mM CaCl2, 10 mM β-mercaptoethanol)) in presence of varying concentrations of CP. Unless otherwise indicated, the bacteria were grown overnight in NRPMI supplemented with 1 mM MgCl2, 100 μM CaCl2 and 1 μM FeCl2 and directly inoculated 1:100 into the assay medium. For all assays, the bacteria were incubated with orbital shaking (180 RPM) at 37°C and growth was measured by assessing optical density (OD600) every 2 hours. Prior to measuring optical density, the 96-well plates were vortexed. For experiments utilizing defined medium, the bacteria were precultured overnight in TSB. The defined medium consisted of 1.3 g/L NaCl, 2.6 g/L NH4Cl, 5.2 g/L KH2PO4, 18.2 g/L Na2HPO4, 0.593 μg/L biotin, 0.593 mg/L nicotinic acid, 0.593 mg/L pyridoxine-HCl, 0.593 mg/L thiamine-HCl, 0.296 mg/L riboflavin, 1.778 g/L calcium pantothenate, 0.104 g/L phenylalanine, 0.078 g/l isoleucine, 0.13 g/l tyrosine, 0.053 g/L cysteine, 0.26 g/L glutamic acid 0.026 g/L lysine, 0.182 g/L methionine, 0.078 g/L histidine, 0.026 g/L tryptophan, 0.234 g/L leucine, 0.234 g/L aspartic acid, 0.182 g/L arginine, 0.078 g/L serine, 0.15 g/L alanine, 0.078 g/L threonine, 0.130 g/L glycine, 0.208 g/L valine and 0.026 g/L proline. The defined medium was supplemented with 6 mM MgSO4, 1 μM FeCl2, 1 μM MnCl2 and 1 μM ZnSO4. Casamino acids (6.5%), glucose (1.3%), glycerol (1.3%), glucose (1.3%) + sodium pyruvate (0.22%) or sodium pyruvate (1.3%) only were provided as carbon sources as indicated. Calprotectin was purified as previously described [27, 32]. For growth assays in NRPMI, bacteria were grown overnight in NRPMI supplemented with 1 mM MgCl2, 100 μM CaCl2 and 1 μM FeCl2 and directly inoculated 1:100 into the assay medium. The assay medium consisted of NRPMI and the bacteria were grown in the presence and absence of 1 μM MnCl2 or 1 μM ZnSO4. For CP growth assays with Salmonella, 5 mM β-mercaptoethanol was used.
Expression analysis
To assess the expression of gpmA and gpmI, S. aureus was grown as for CP growth assays in complex medium in the presence and absence of 240 μg/ml of CP, with the exception that they were precultured overnight in TSB. Bacteria were harvested during log phase growth (OD600 = ~0.1), when the samples were collected, an equal volume of ice-cold 1:1 acetone-ethanol was then added to the cultures, and they were frozen at -80°C until RNA extraction. RNA was extracted and cDNA was generated, as previously described [86–88]. Gene expression was assessed by quantitative reverse transcription-PCR (qRT-PCR) using the indicated primers (Table 1, [29]) and 16S was used as a normalizing control.
Animal infections
Mouse infections were performed as described previously [25, 27]. Briefly, 9-week old wild type or CP-deficient (S100A9-/-) mice were infected retro-orbitally with approximately 5 x 106 CFU in 100 μl of sterile phosphate-buffered saline. Following injection, the infection was allowed to proceed for 96 h before the mice were sacrificed. Livers, hearts and kidneys were removed, the organs were homogenized, and bacterial burden was determined by plating serial dilutions.
Supporting information
Growth curves for the data presented in Fig 2. (A) Wild type S. aureus Newman, ΔgpmA and ΔgpmI and (B) wild type S. aureus Newman and ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt:gpmA (plgt:gpmA) were grown in rich medium in the presence of increasing concentrations of CP. (C) Wild type USA300, ΔgpmA and ΔgpmI and (D) wild type USA300 and ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt:gpmA (plgt:gpmA) were grown in rich medium in the presence of increasing concentrations of CP. (E) Growth of wild type S. aureus Newman, ΔgpmA and ΔgpmI derivatives, in NRPMI in the presence and absence of 1 μM MnCl2 or 1 μM ZnSO4.
(TIF)
Growth curves for the data presented in Fig 3. (A-D) S. aureus wild type, ΔgpmA and ΔgpmI were grown in defined medium supplemented with (A) glucose (DM + glucose), (B) Casamino acids (DM + AA), (C) glucose and sodium pyruvate (DM + glucose + pyruvate) or (D) glycerol (DM + glycerol) as a carbon source in the presence of increasing concentrations of CP.
(TIF)
Growth curves for the data presented in Fig 4. (A & B) The growth of wild type, ΔgpmA, ΔmntC ΔmntH and ΔmntC ΔmntH ΔgpmA, ΔgpmI, ΔmntC ΔmntH and ΔmntC ΔmntH ΔgpmI were assessed in rich medium supplemented with 1 μM MnCl2 and 1 μM ZnSO4 in the presence of increasing concentrations of CP. Panel A shows the optical density of wild type mutant strains at t = 8 before normalization to either wild type or the ΔmntC ΔmntH background.
(TIF)
Growth curves for the data presented in Fig 6. (A) Wild type Salmonella and ΔgpmA were grown in rich medium in the presence of increasing concentrations of CP. (B-E) Wild type Salmonella and ΔgpmA were grown in defined medium (DM) supplemented with (B) glucose (DM + glucose), (C) Casamino acids (DM + AA), (D) glycerol (DM + glycerol) or (E) sodium pyruvate (DM + pyruvate) as a carbon source in the presence of increasing concentrations of CP.
(TIF)
Acknowledgments
We would like to thank the members of the Kehl-Fie lab for critical reading of the manuscript.
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
This work was supported by grants from the National Institutes of Health (R01 AI 118880) and a Vallee Scholar Award from the Vallee Foundation to TEKF. Work in the laboratory of JMS is supported by the National Institutes of Health (R01 AI 123381). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH or the Vallee Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Gotz A, Goebel W. Glucose and glucose 6-phosphate as carbon sources in extra- and intracellular growth of enteroinvasive Escherichia coli and Salmonella enterica. Microbiology. 2010;156(Pt 4):1176–87. 10.1099/mic.0.034744-0 . [DOI] [PubMed] [Google Scholar]
- 2.Henkin TM, Grundy FJ, Nicholson WL, Chambliss GH. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacl and galR repressors. Mol Microbiol. 1991;5(3):575–84. . [DOI] [PubMed] [Google Scholar]
- 3.Inada T, Kimata K, Aiba H. Mechanism responsible for glucose-lactose diauxie in Escherichia coli: challenge to the cAMP model. Genes Cells. 1996;1(3):293–301. . [DOI] [PubMed] [Google Scholar]
- 4.Li C, Sun F, Cho H, Yelavarthi V, Sohn C, He C, et al. CcpA mediates proline auxotrophy and is required for Staphylococcus aureus pathogenesis. J Bacteriol. 2010;192(15):3883–92. 10.1128/JB.00237-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Richardson AR, Dunman PM, Fang FC. The nitrosative stress response of Staphylococcus aureus is required for resistance to innate immunity. Mol Microbiol. 2006;61(4):927–39. 10.1111/j.1365-2958.2006.05290.x . [DOI] [PubMed] [Google Scholar]
- 6.Richardson AR, Libby SJ, Fang FC. A nitric oxide-inducible lactate dehydrogenase enables Staphylococcus aureus to resist innate immunity. Science. 2008;319(5870):1672–6. 10.1126/science.1155207 . [DOI] [PubMed] [Google Scholar]
- 7.Vitko NP, Grosser MR, Khatri D, Lance TR, Richardson AR. Expanded Glucose Import Capability Affords Staphylococcus aureus Optimized Glycolytic Flux during Infection. MBio. 2016;7(3). 10.1128/mBio.00296-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Vitko NP, Spahich NA, Richardson AR. Glycolytic dependency of high-level nitric oxide resistance and virulence in Staphylococcus aureus. MBio. 2015;6(2). 10.1128/mBio.00045-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Bowden SD, Rowley G, Hinton JC, Thompson A. Glucose and glycolysis are required for the successful infection of macrophages and mice by Salmonella enterica serovar typhimurium. Infect Immun. 2009;77(7):3117–26. 10.1128/IAI.00093-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Tchawa Yimga M, Leatham MP, Allen JH, Laux DC, Conway T, Cohen PS. Role of gluconeogenesis and the tricarboxylic acid cycle in the virulence of Salmonella enterica serovar Typhimurium in BALB/c mice. Infect Immun. 2006;74(2):1130–40. 10.1128/IAI.74.2.1130-1140.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Deutscher J, Francke C, Postma PW. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev. 2006;70(4):939–1031. 10.1128/MMBR.00024-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Deutscher J, Kuster E, Bergstedt U, Charrier V, Hillen W. Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Mol Microbiol. 1995;15(6):1049–53. . [DOI] [PubMed] [Google Scholar]
- 13.Liebeke M, Dorries K, Zuhlke D, Bernhardt J, Fuchs S, Pane-Farre J, et al. A metabolomics and proteomics study of the adaptation of Staphylococcus aureus to glucose starvation. Mol Biosyst. 2011;7(4):1241–53. 10.1039/c0mb00315h . [DOI] [PubMed] [Google Scholar]
- 14.Fowler VG Jr., Miro JM, Hoen B, Cabell CH, Abrutyn E, Rubinstein E, et al. Staphylococcus aureus endocarditis: a consequence of medical progress. JAMA. 2005;293(24):3012–21. 10.1001/jama.293.24.3012 . [DOI] [PubMed] [Google Scholar]
- 15.Kourany WM, Miro JM, Moreno A, Corey GR, Pappas PA, Abrutyn E, et al. Influence of diabetes mellitus on the clinical manifestations and prognosis of infective endocarditis: a report from the International Collaboration on Endocarditis-Merged Database. Scand J Infect Dis. 2006;38(8):613–9. 10.1080/00365540600617017 . [DOI] [PubMed] [Google Scholar]
- 16.Lipsky BA, Tabak YP, Johannes RS, Vo L, Hyde L, Weigelt JA. Skin and soft tissue infections in hospitalised patients with diabetes: culture isolates and risk factors associated with mortality, length of stay and cost. Diabetologia. 2010;53(5):914–23. 10.1007/s00125-010-1672-5 . [DOI] [PubMed] [Google Scholar]
- 17.Casqueiro J, Casqueiro J, Alves C. Infections in patients with diabetes mellitus: A review of pathogenesis. Indian J Endocrinol Metab. 2012;16 Suppl 1:S27–36. 10.4103/2230-8210.94253 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Radin JN, Kelliher JL, Parraga Solorzano PK, Kehl-Fie TE. The Two-Component System ArlRS and Alterations in Metabolism Enable Staphylococcus aureus to Resist Calprotectin-Induced Manganese Starvation. PLoS Pathog. 2016;12(11):e1006040 10.1371/journal.ppat.1006040 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bourret TJ, Boylan JA, Lawrence KA, Gherardini FC. Nitrosative damage to free and zinc-bound cysteine thiols underlies nitric oxide toxicity in wild-type Borrelia burgdorferi. Mol Microbiol. 2011;81(1):259–73. 10.1111/j.1365-2958.2011.07691.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.CDC. Antibiotic Resistance Threats in the United States, 2013: Centers for Disease Control and Prevention; 2013. [cited 2013]. [Google Scholar]
- 21.WHO. Antimicrobial Resistance Global Report on Surveillance: World Health Organization; 2014. [cited 2014]. [Google Scholar]
- 22.Andreini C, Bertini I, Cavallaro G, Holliday GL, Thornton JM. Metal ions in biological catalysis: from enzyme databases to general principles. J Biol Inorg Chem. 2008;13(8):1205–18. 10.1007/s00775-008-0404-5 . [DOI] [PubMed] [Google Scholar]
- 23.Bullen JJ. The significance of iron in infection. Rev Infect Dis. 1981;3(6):1127–38. . [DOI] [PubMed] [Google Scholar]
- 24.Cassat JE, Skaar EP. Iron in infection and immunity. Cell Host Microbe. 2013;13(5):509–19. 10.1016/j.chom.2013.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Corbin BD, Seeley EH, Raab A, Feldmann J, Miller MR, Torres VJ, et al. Metal chelation and inhibition of bacterial growth in tissue abscesses. Science. 2008;319(5865):962–5. 10.1126/science.1152449 . [DOI] [PubMed] [Google Scholar]
- 26.Hood MI, Mortensen BL, Moore JL, Zhang Y, Kehl-Fie TE, Sugitani N, et al. Identification of an Acinetobacter baumannii zinc acquisition system that facilitates resistance to calprotectin-mediated zinc sequestration. PLoS pathog. 2012;8(12):e1003068 Epub 2012/12/14. 10.1371/journal.ppat.1003068 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kehl-Fie TE, Chitayat S, Hood MI, Damo S, Restrepo N, Garcia C, et al. Nutrient metal sequestration by calprotectin inhibits bacterial superoxide defense, enhancing neutrophil killing of Staphylococcus aureus. Cell Host Microbe. 2011;10(2):158–64. Epub 2011/08/17. 10.1016/j.chom.2011.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Weinberg ED. Iron availability and infection. Biochim Biophys Acta. 2009;1790(7):600–5. 10.1016/j.bbagen.2008.07.002 . [DOI] [PubMed] [Google Scholar]
- 29.Kehl-Fie TE, Zhang Y, Moore JL, Farrand AJ, Hood MI, Rathi S, et al. MntABC and MntH contribute to systemic Staphylococcus aureus infection by competing with calprotectin for nutrient manganese. Infect Immun. 2013;81(9):3395–405. Epub 2013/07/03. 10.1128/IAI.00420-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Brophy MB, Hayden JA, Nolan EM. Calcium ion gradients modulate the zinc affinity and antibacterial activity of human calprotectin. J Am Chem Soc. 2012;134(43):18089–100. 10.1021/ja307974e [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Brophy MB, Nakashige TG, Gaillard A, Nolan EM. Contributions of the S100A9 C-terminal tail to high-affinity Mn(II) chelation by the host-defense protein human calprotectin. J Am Chem Soc. 2013;135(47):17804–17. 10.1021/ja407147d [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Damo SM, Kehl-Fie TE, Sugitani N, Holt ME, Rathi S, Murphy WJ, et al. Molecular basis for manganese sequestration by calprotectin and roles in the innate immune response to invading bacterial pathogens. Proc Natl Acad Sci U S A. 2013;110(10):3841–6. 10.1073/pnas.1220341110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Hayden JA, Brophy MB, Cunden LS, Nolan EM. High-affinity manganese coordination by human calprotectin is calcium-dependent and requires the histidine-rich site formed at the dimer interface. J Am Chem Soc. 2013;135(2):775–87. 10.1021/ja3096416 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kehl-Fie TE, Porsch EA, Yagupsky P, Grass EA, Obert C, Benjamin DK Jr., et al. Examination of type IV pilus expression and pilus-associated phenotypes in Kingella kingae clinical isolates. Infection and Immunity. 2010;78(4):1692–9. Epub 2010/02/11. 10.1128/IAI.00908-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Korndorfer IP, Brueckner F, Skerra A. The crystal structure of the human (S100A8/S100A9)2 heterotetramer, calprotectin, illustrates how conformational changes of interacting alpha-helices can determine specific association of two EF-hand proteins. J Mol Biol. 2007;370(5):887–98. 10.1016/j.jmb.2007.04.065 . [DOI] [PubMed] [Google Scholar]
- 36.Nakashige TG, Zhang B, Krebs C, Nolan EM. Human calprotectin is an iron-sequestering host-defense protein. Nat Chem Biol. 2015. 10.1038/nchembio.1891 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Nakashige TG, Zygiel EM, Drennan CL, Nolan EM. Nickel Sequestration by the Host-Defense Protein Human Calprotectin. J Am Chem Soc. 2017;139(26):8828–36. 10.1021/jacs.7b01212 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Clohessy PA, Golden BE. Calprotectin-mediated zinc chelation as a biostatic mechanism in host defence. Scand J Immunol. 1995;42(5):551–6. . [DOI] [PubMed] [Google Scholar]
- 39.Gebhardt C, Nemeth J, Angel P, Hess J. S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 2006;72(11):1622–31. 10.1016/j.bcp.2006.05.017 . [DOI] [PubMed] [Google Scholar]
- 40.Achouiti A, Vogl T, Urban CF, Rohm M, Hommes TJ, van Zoelen MA, et al. Myeloid-related protein-14 contributes to protective immunity in gram-negative pneumonia derived sepsis. PLoS Pathog. 2012;8(10):e1002987 10.1371/journal.ppat.1002987 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bianchi M, Niemiec MJ, Siler U, Urban CF, Reichenbach J. Restoration of anti-Aspergillus defense by neutrophil extracellular traps in human chronic granulomatous disease after gene therapy is calprotectin-dependent. J Allergy Clin Immunol. 2011;127(5):1243–52 e7. 10.1016/j.jaci.2011.01.021 . [DOI] [PubMed] [Google Scholar]
- 42.Garfinkel L, Garfinkel D. Magnesium regulation of the glycolytic pathway and the enzymes involved. Magnesium. 1985;4(2–3):60–72. . [PubMed] [Google Scholar]
- 43.Kehres DG, Maguire ME. Emerging themes in manganese transport, biochemistry and pathogenesis in bacteria. FEMS Microbiol Rev. 2003;27(2–3):263–90. 10.1016/S0168-6445(03)00052-4 . [DOI] [PubMed] [Google Scholar]
- 44.Bond CS, White MF, Hunter WN. High resolution structure of the phosphohistidine-activated form of Escherichia coli cofactor-dependent phosphoglycerate mutase. J Biol Chem. 2001;276(5):3247–53. 10.1074/jbc.M007318200 . [DOI] [PubMed] [Google Scholar]
- 45.Chander M, Setlow B, Setlow P. The enzymatic activity of phosphoglycerate mutase from gram-positive endospore-forming bacteria requires Mn2+ and is pH sensitive. Can J Microbiol. 1998;44(8):759–67. 10.1139/cjm-44-8-759 . [DOI] [PubMed] [Google Scholar]
- 46.Crow VL, Pritchard GG. The effect of monovalent and divalent cations on the activity of Streptococcus lactis C10 pyruvate kinase. Biochim Biophys Acta. 1977;481(1):105–14. 10.1016/0005-2744(77)90142-5 . [DOI] [PubMed] [Google Scholar]
- 47.Fraser HI, Kvaratskhelia M, White MF. The two analogous phosphoglycerate mutases of Escherichia coli. FEBS Lett. 1999;455(3):344–8. 10.1016/s0014-5793(99)00910-2 . [DOI] [PubMed] [Google Scholar]
- 48.Garcia-Olalla C, Barrio JP, Garrido-Pertierra A. Isolation and kinetic properties of pyruvate kinase activated by fructose-1,6-biphosphate from Salmonella typhimurium LT-2.I. Rev Esp Fisiol. 1982;38(4):409–17. . [PubMed] [Google Scholar]
- 49.Peak MJ, Peak JG, Stevens FJ, Blamey J, Mai X, Zhou ZH, et al. The hyperthermophilic glycolytic enzyme enolase in the archaeon, Pyrococcus furiosus: comparison with mesophilic enolases. Arch Biochem Biophys. 1994;313(2):280–6. 10.1006/abbi.1994.1389 . [DOI] [PubMed] [Google Scholar]
- 50.Yamada T, Carlsson J. Glucose-6-phosphate-dependent pyruvate kinase in Streptococcus mutans. J Bacteriol. 1975;124(1):562–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Ogunniyi AD, Mahdi LK, Jennings MP, McEwan AG, McDevitt CA, Van der Hoek MB, et al. Central role of manganese in regulation of stress responses, physiology, and metabolism in Streptococcus pneumoniae. J Bacteriol. 2010;192(17):4489–97. 10.1128/JB.00064-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Anderson ES, Paulley JT, Gaines JM, Valderas MW, Martin DW, Menscher E, et al. The manganese transporter MntH is a critical virulence determinant for Brucella abortus 2308 in experimentally infected mice. Infect Immun. 2009;77(8):3466–74. 10.1128/IAI.00444-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Garcia YM, Barwinska-Sendra A, Tarrant E, Skaar EP, Waldron KJ, Kehl-Fie TE. A Superoxide Dismutase Capable of Functioning with Iron or Manganese Promotes the Resistance of Staphylococcus aureus to Calprotectin and Nutritional Immunity. PLoS Pathog. 2017;13(1):e1006125 10.1371/journal.ppat.1006125 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Horsburgh MJ, Wharton SJ, Cox AG, Ingham E, Peacock S, Foster SJ. MntR modulates expression of the PerR regulon and superoxide resistance in Staphylococcus aureus through control of manganese uptake. Mol Microbiol. 2002;44(5):1269–86. . [DOI] [PubMed] [Google Scholar]
- 55.Radin JN, Zhu J, Brazel EB, McDevitt CA, Kehl-Fie TE. Synergy between nutritional immunity and independent host defenses contributes to the importance of the MntABC manganese transporter during Staphylococcus aureus infection. Infect Immun. 2018. 10.1128/IAI.00642-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Omelchenko MV, Galperin MY, Wolf YI, Koonin EV. Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution. Biol Direct. 2010;5:31 10.1186/1745-6150-5-31 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Foster JM, Davis PJ, Raverdy S, Sibley MH, Raleigh EA, Kumar S, et al. Evolution of bacterial phosphoglycerate mutases: non-homologous isofunctional enzymes undergoing gene losses, gains and lateral transfers. PLoS One. 2010;5(10):e13576 10.1371/journal.pone.0013576 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Purves J, Cockayne A, Moody PC, Morrissey JA. Comparison of the regulation, metabolic functions, and roles in virulence of the glyceraldehyde-3-phosphate dehydrogenase homologues gapA and gapB in Staphylococcus aureus. Infect Immun. 2010;78(12):5223–32. 10.1128/IAI.00762-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Zuniga-Ripa A, Barbier T, Conde-Alvarez R, Martinez-Gomez E, Palacios-Chaves L, Gil-Ramirez Y, et al. Brucella abortus depends on pyruvate phosphate dikinase and malic enzyme but not on Fbp and GlpX fructose-1,6-bisphosphatases for full virulence in laboratory models. J Bacteriol. 2014;196(16):3045–57. 10.1128/JB.01663-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Seidl K, Muller S, Francois P, Kriebitzsch C, Schrenzel J, Engelmann S, et al. Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus. BMC Microbiol. 2009;9:95 10.1186/1471-2180-9-95 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Porcheron G, Garenaux A, Proulx J, Sabri M, Dozois CM. Iron, copper, zinc, and manganese transport and regulation in pathogenic Enterobacteria: correlations between strains, site of infection and the relative importance of the different metal transport systems for virulence. Front Cell Infect Microbiol. 2013;3:90 10.3389/fcimb.2013.00090 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Palmer LD, Skaar EP. Transition Metals and Virulence in Bacteria. Annu Rev Genet. 2016;50:67–91. 10.1146/annurev-genet-120215-035146 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Neumann W, Hadley RC, Nolan EM. Transition metals at the host-pathogen interface: how Neisseria exploit human metalloproteins for acquiring iron and zinc. Essays Biochem. 2017;61(2):211–23. 10.1042/EBC20160084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Weiss G, Carver PL. Role of divalent metals in infectious disease susceptibility and outcome. Clin Microbiol Infect. 2018;24(1):16–23. 10.1016/j.cmi.2017.01.018 . [DOI] [PubMed] [Google Scholar]
- 65.Hood MI, Skaar EP. Nutritional immunity: transition metals at the pathogen-host interface. Nat Rev Microbiol. 2012;10(8):525–37. 10.1038/nrmicro2836 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Kehl-Fie TE, Skaar EP. Nutritional immunity beyond iron: a role for manganese and zinc. Curr Opin Chem Biol. 2010;14(2):218–24. Epub 2009/12/18. 10.1016/j.cbpa.2009.11.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Gaddy JA, Radin JN, Loh JT, Piazuelo MB, Kehl-Fie TE, Delgado AG, et al. The host protein calprotectin modulates the Helicobacter pylori cag type IV secretion system via zinc sequestration. PLoS Pathog. 2014;10(10):e1004450 10.1371/journal.ppat.1004450 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Galperin MY, Koonin EV. Functional genomics and enzyme evolution. Homologous and analogous enzymes encoded in microbial genomes. Genetica. 1999;106(1–2):159–70. . [DOI] [PubMed] [Google Scholar]
- 69.Jedrzejas MJ. Structure, function, and evolution of phosphoglycerate mutases: comparison with fructose-2,6-bisphosphatase, acid phosphatase, and alkaline phosphatase. Prog Biophys Mol Biol. 2000;73(2–4):263–87. . [DOI] [PubMed] [Google Scholar]
- 70.Carreras J, Mezquita J, Pons G. Phylogeny and ontogeny of the phosphoglycerate mutases.—V. Inactivation of phosphoglycerate mutase isozymes by histidine-specific reagents. Comp Biochem Physiol B. 1982;72(3):401–7. . [DOI] [PubMed] [Google Scholar]
- 71.Blom NS, Tetreault S, Coulombe R, Sygusch J. Novel active site in Escherichia coli fructose 1,6-bisphosphate aldolase. Nat Struct Biol. 1996;3(10):856–62. . [DOI] [PubMed] [Google Scholar]
- 72.Hall DR, Leonard GA, Reed CD, Watt CI, Berry A, Hunter WN. The crystal structure of Escherichia coli class II fructose-1, 6-bisphosphate aldolase in complex with phosphoglycolohydroxamate reveals details of mechanism and specificity. J Mol Biol. 1999;287(2):383–94. 10.1006/jmbi.1999.2609 . [DOI] [PubMed] [Google Scholar]
- 73.Cooper SJ, Leonard GA, McSweeney SM, Thompson AW, Naismith JH, Qamar S, et al. The crystal structure of a class II fructose-1,6-bisphosphate aldolase shows a novel binuclear metal-binding active site embedded in a familiar fold. Structure. 1996;4(11):1303–15. . [DOI] [PubMed] [Google Scholar]
- 74.Peng H, Shen J, Edmonds KA, Luebke JL, Hickey AK, Palmer LD, et al. Sulfide Homeostasis and Nitroxyl Intersect via Formation of Reactive Sulfur Species in Staphylococcus aureus. mSphere. 2017;2(3). 10.1128/mSphere.00082-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Yoch DC, Valentine RC. Ferredoxins and flavodoxins of bacteria. Annu Rev Microbiol. 1972;26:139–62. 10.1146/annurev.mi.26.100172.001035 . [DOI] [PubMed] [Google Scholar]
- 76.Andrews SC. Making DNA without iron—induction of a manganese-dependent ribonucleotide reductase in response to iron starvation. Mol Microbiol. 2011;80(2):286–9. 10.1111/j.1365-2958.2011.07594.x . [DOI] [PubMed] [Google Scholar]
- 77.Martin JE, Imlay JA. The alternative aerobic ribonucleotide reductase of Escherichia coli, NrdEF, is a manganese-dependent enzyme that enables cell replication during periods of iron starvation. Mol Microbiol. 2011;80(2):319–34. 10.1111/j.1365-2958.2011.07593.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Sankaran B, Bonnett SA, Shah K, Gabriel S, Reddy R, Schimmel P, et al. Zinc-independent folate biosynthesis: genetic, biochemical, and structural investigations reveal new metal dependence for GTP cyclohydrolase IB. J Bacteriol. 2009;191(22):6936–49. 10.1128/JB.00287-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Akanuma G, Nanamiya H, Natori Y, Nomura N, Kawamura F. Liberation of zinc-containing L31 (RpmE) from ribosomes by its paralogous gene product, YtiA, in Bacillus subtilis. J Bacteriol. 2006;188(7):2715–20. 10.1128/JB.188.7.2715-2720.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Nanamiya H, Akanuma G, Natori Y, Murayama R, Kosono S, Kudo T, et al. Zinc is a key factor in controlling alternation of two types of L31 protein in the Bacillus subtilis ribosome. Mol Microbiol. 2004;52(1):273–83. 10.1111/j.1365-2958.2003.03972.x . [DOI] [PubMed] [Google Scholar]
- 81.Novichkov PS, Kazakov AE, Ravcheev DA, Leyn SA, Kovaleva GY, Sutormin RA, et al. RegPrecise 3.0—a resource for genome-scale exploration of transcriptional regulation in bacteria. BMC Genomics. 2013;14:745 10.1186/1471-2164-14-745 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Fey PD, Endres JL, Yajjala VK, Widhelm TJ, Boissy RJ, Bose JL, et al. A genetic resource for rapid and comprehensive phenotype screening of nonessential Staphylococcus aureus genes. MBio. 2013;4(1):e00537–12. 10.1128/mBio.00537-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Schneewind O, Mihaylova-Petkov D, Model P. Cell wall sorting signals in surface proteins of gram-positive bacteria. EMBO J. 1993;12(12):4803–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000;97(12):6640–5. 10.1073/pnas.120163297 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Ellermeier CD, Janakiraman A, Slauch JM. Construction of targeted single copy lac fusions using lambda Red and FLP-mediated site-specific recombination in bacteria. Gene. 2002;290(1–2):153–61. 10.1016/s0378-1119(02)00551-6 . [DOI] [PubMed] [Google Scholar]
- 86.Collins JA, Irnov I, Baker S, Winkler WC. Mechanism of mRNA destabilization by the glmS ribozyme. Genes Dev. 2007;21(24):3356–68. 10.1101/gad.1605307 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Grossoehme N, Kehl-Fie TE, Ma Z, Adams KW, Cowart DM, Scott RA, et al. Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus. J Biol Chem. 2011;286(15):13522–31. 10.1074/jbc.M111.220012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Kehl-Fie TE, Porsch EA, Miller SE, St Geme JW, 3rd. Expression of Kingella kingae type IV pili is regulated by sigma54, PilS, and PilR. J Bacteriol. 2009;191(15):4976–86. Epub 2009/05/26. JB.00123-09 [pii] 10.1128/JB.00123-09 . [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Growth curves for the data presented in Fig 2. (A) Wild type S. aureus Newman, ΔgpmA and ΔgpmI and (B) wild type S. aureus Newman and ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt:gpmA (plgt:gpmA) were grown in rich medium in the presence of increasing concentrations of CP. (C) Wild type USA300, ΔgpmA and ΔgpmI and (D) wild type USA300 and ΔgpmA containing either pOS1 plgt (plgt) or pOS1 plgt:gpmA (plgt:gpmA) were grown in rich medium in the presence of increasing concentrations of CP. (E) Growth of wild type S. aureus Newman, ΔgpmA and ΔgpmI derivatives, in NRPMI in the presence and absence of 1 μM MnCl2 or 1 μM ZnSO4.
(TIF)
Growth curves for the data presented in Fig 3. (A-D) S. aureus wild type, ΔgpmA and ΔgpmI were grown in defined medium supplemented with (A) glucose (DM + glucose), (B) Casamino acids (DM + AA), (C) glucose and sodium pyruvate (DM + glucose + pyruvate) or (D) glycerol (DM + glycerol) as a carbon source in the presence of increasing concentrations of CP.
(TIF)
Growth curves for the data presented in Fig 4. (A & B) The growth of wild type, ΔgpmA, ΔmntC ΔmntH and ΔmntC ΔmntH ΔgpmA, ΔgpmI, ΔmntC ΔmntH and ΔmntC ΔmntH ΔgpmI were assessed in rich medium supplemented with 1 μM MnCl2 and 1 μM ZnSO4 in the presence of increasing concentrations of CP. Panel A shows the optical density of wild type mutant strains at t = 8 before normalization to either wild type or the ΔmntC ΔmntH background.
(TIF)
Growth curves for the data presented in Fig 6. (A) Wild type Salmonella and ΔgpmA were grown in rich medium in the presence of increasing concentrations of CP. (B-E) Wild type Salmonella and ΔgpmA were grown in defined medium (DM) supplemented with (B) glucose (DM + glucose), (C) Casamino acids (DM + AA), (D) glycerol (DM + glycerol) or (E) sodium pyruvate (DM + pyruvate) as a carbon source in the presence of increasing concentrations of CP.
(TIF)
Data Availability Statement
All relevant data are within the manuscript and its Supporting Information files.





