KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
| Antibodies | ||
| APC/Cyanine7 anti-mouse CD11c Antibody (N418) | BioLegend | Cat# 117324, RRID:AB_830649 |
| PE anti-mouse CD169 (Siglec-1) Antibody (SER-4) | eBioscience | Cat# 12-5755-82, RRID:AB_2572625 |
| Alexa Fluor® 647 anti-mouse/rat XCR1 Antibody (ZET) | BioLegend | Cat# 148214, RRID:AB_2564369 |
| PE/Cy7 anti-mouse/human CD45R/B220 Antibody (RA3–6B2) | BioLegend | Cat# 103222, RRID:AB_313005 |
| PE/Cy7 anti-mouse Ly-6G Antibody (1A8) | BioLegend | Cat# 127618, RRID:AB_1877261 |
| PE/Cy7 anti-mouse TCR β chain Antibody (H57–597) | BioLegend | Cat# 109222, RRID:AB_893625 |
| PE/Cy7 anti-mouse CD49b (pan-NK cells) Antibody (DX5) | BioLegend | Cat# 108922, RRID:AB_2561460 |
| PE anti-mouse/human CD11b Antibody (M1/70) | BioLegend | Cat# 101208, RRID:AB_312791 |
| APC anti-mouse CD8a Antibody (53–6.7) | BioLegend | Cat# 100712, RRID:AB_312751 |
| Biotin anti-mouse CD210 (IL-10 R) antibody (1B1.3a) | BioLegend | Cat# 112704, RRID:AB_313517 |
| Anti-chicken egg albumin (OVA antibody) | Sigma | Cat# C6534, RRID:AB_258953 |
| Purified rat anti-mouse CD16/CD32 (mouse Fc block) (2.4G2) | BD Biosciences | Cat# 553142, RRID:AB_394657 |
| Anti-mouse CD107a (LAMP-1) antibody (1D4B) | BioLegend | Cat# 121603, RRID:AB_572002 |
| PE Donkey anti-rabbit IgG (minimal x-reactivity) Antibody (Poly4064) | BioLegend | Cat# 406421, RRID:AB_2563484 |
| Alexa Fluor® 647 Donkey anti-rabbit IgG (minimal x-reactivity) Antibody(Poly4064) | BioLegend | Cat# 406414, RRID:AB_2563202 |
| Alexa Fluor® 647 anti-mouse TCR β chain Antibody (H57–597) | BioLegend | Cat# 109218, RRID:AB_493346 |
| Alexa Fluor® 488 anti-mouse TCR β chain Antibody (H57–597) | BioLegend | Cat# 109215, RRID:AB_493344 |
| APC anti-mouse CD11c Antibody (N418) | BioLegend | Cat# 117310, RRID:AB_313779 |
| FITC anti-mouse CD169 (Siglec-1) Antibody (3D6.112) | BioLegend | Cat# 142406, RRID:AB_2563107 |
| eFluor 570 F4/80 Monoclonal Antibody (BM8) | Invitrogen | Cat# 41-4801-80, RRID:AB_2573610 |
| Fibroblast Marker Antibody (ER-TR7) Alexa Fluor® 647 | Santa Cruz Biotechnology | Cat# sc-73355 AF647 |
| Alexa Fluor® 647 anti-mouse/human CD45R/B220 Antibody | BioLegend | Cat# 103229, RRID:AB_492875 |
| Brilliant Violet 510™ anti-mouse I-A/I-E Antibody | BioLegend | Cat# 107636, RRID:AB_2734168 |
| Biotin anti-mouse DC Marker (33D1) Antibody | BioLegend | Cat# 124904, RRID:AB_1186159 |
| Pacific Blue™ anti-mouse TCR Vα2 Antibody (B20.1) | BioLegend | Cat# 127816, RRID:AB_10613647 |
| PE anti-mouse CD4 Antibody (GK1.5) | BioLegend | Cat# 100408, RRID:AB_312693 |
| APC/Cyanine7 anti-mouse CD19 Antibody (6D5) | BioLegend | Cat# 115530, RRID:AB_830707 |
| PE anti-mouse CD23 Antibody (B3B4) | BioLegend | Cat# 101608, RRID:AB_312833 |
| APC anti-mouse CD21/CD35 (CR2/CR1) Antibody (7E9) | BioLegend | Cat# 123412 |
| Pacific Blue™ anti-mouse F4/80 Antibody (CI:A3–1) | BioLegend | Cat# 123124, RRID:AB_893475 |
| PerCP/Cy5.5 anti-mouse CD45.1 Antibody | BioLegend | Cat# 110728, RRID:AB_893346 |
| Brilliant Violet 510™ anti-mouse CD45.2 Antibody | BioLegend | Cat# 109838, RRID:AB_2650900 |
| PE Rat Anti-Mouse CD41 (MWReg30) | BD Bioscience | Cat# 558040, RRID:AB_397004 |
| APC anti-mouse IFN-γ Antibody (XMG1.2) | BioLegend | Cat# 505810, RRID:AB_315404 |
| Bacterial and Virus Strains | ||
| Listeria monocytogenes strain 10403s expressing OVA | Dr. Lauren A. Zenewicz | The University of Oklahoma Health Sciences Center |
| Listeria monocytogenes strain 10403S expressing GFP | Dr. Herve Agaisse | University of Virginia School of Medicine |
| Listeria monocytogenes strain 10403S expressing RFP | Dr. Eric G. Pamer | Sloan Kettering Institute |
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| Albumin from chicken egg white (OVA) | Sigma | Cat# A5503 |
| OVA257–264 peptides (SIINFEKL) | InvivoGen | Cat# vac-sin |
| CpG ODN1668) | InvivoGen | Cat# tlrl-1668–1 |
| Recombinant mouse IL-10 (carrier-free) | BioLegend | Cat# 575802 |
| BV421 streptavidin | BD BioSciences | Cat# 563259 |
| PE Streptavidin | BioLegend | Cat# 405204 |
| RPMI1640 | Corning | Cat# 10040CV |
| 0.5M EDTA, pH 8.0 | Invitrogen | Cat# 15-575-020 |
| 2-Mercaptoethanol | Sigma-Aldrich | Cat# M6250 |
| Penicillin-Streptomycin | Gibco | Cat# 15140122 |
| Deoxyribonuclease I | Sigma-Aldrich | Cat# D5025 |
| Collagenase type IV | Sigma-Aldrich | Cat# C5138 |
| Fetal Bovine Serum | ATLANTA biologicals | Cat# S11150 |
| Sodium Pyruvate (100 mM) | Gibco | Cat# 11360070 |
| RBC Lysis Buffer (10X) | BioLegend | Cat# 420301 |
| HEPES, 1M buffer solution | AmericanBIO | Cat# AB06021–00100 |
| L-Glutamine (200 mM) | Gibco | Cat# 25030081 |
| GolgiStop™ Protein Transport Inhibitor (containing Monensin) | BD Bioscience | Cat# 554724 |
| Fixation/Permeabilization Solution Kit | BD Bioscience | Cat# 54714 |
| CellTrace™ CFSE Cell Proliferation Kit | Invitrogen | Cat# C34554 |
| LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit | Invitrogen | Cat# L34957 |
| TRITON X-100 | AmericanBIO | Cat# AB02025 |
| BBL™ Brain Heart Infusion | BD Bioscience | Cat# 211059 |
| Bacto™ Dehydrated Agar | BD Bioscience | Cat# 214010 |
| Amine-modified polystyrene microspheres, 3 μm diamer | Polysciences | Cat# 17145–5 |
| CO2-independent medium | Gibco | Cat# 18045–088 |
| Iscove’s modified Dulbecco’s medium (IMDM) | Gibco | Cat# 12440053 |
| Bovine serum albumin (BSA) | AmericanBio | Cat# AB01088 |
| Glycine | Sigma | Cat# G7126 |
| Imidazole | Sigma | Cat# I-0250 |
| Sucrose | AmericanBio | Cat# AB01900 |
| Phenylmethanesulfonyl fluoride (PMSF) | Sigma | Cat# P7626 |
| cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail | Roche | Cat# 11836170001 |
| Dithiothreitol (DTT) | Sigma | Cat# 646563 |
| Trypan blue solution, 0.4% | Gibco | Cat# 15250061 |
| Recombinant Murine GM-CSF | PEPROTECH | Cat# 315–03 |
| Lipopolysaccharides from Escherichia coli O111:B4 | Sigma | Cat# L3012 |
| DQ Ovalbumin | Molecular Probes | Cat# D-12053 |
| Glutaraldehyde, EM grade, 50% | Polysciences | Cat# 18428 |
| TRIzol™ Reagent | Invitrogen | Cat# 15596018 |
| SMART® MMLV Reverse Transcriptase | Clontech | Cat# 639524 |
| Chloroform | JT Baker | Cat# 9180–01 |
| 2-Propanol (Isopropyl Alcohol) | JT Baker | Cat# 9084–01 |
| dNTPs | Lamda BIOTECH | Cat# D107 |
| KAPA SYBR® FAST qPCR Kits | Kapa Biosystems | Cat# KK4605 |
| Gentamycin | Sigma | Cat# G1264 |
| Critical Commercial Assays | ||
| EasySep™ Mouse CD4+ T Cell Isolation Kit | StemCell Technologies | Cat# 19852 |
| EasySep™ Mouse CD8+ T Cell Isolation Kit | StemCell Technologies | Cat # 19853 |
| EasySep™ Mouse Pan-DC Enrichment Kit | StemCell Technologies | Cat # 19763 |
| EasySep™ Mouse Pan-B Cell Isolation Kit | StemCell Technologies | Cat # 19844 |
| Deposited Data | ||
| Splenic cDC1s RNA-Seq | This paper | GEO: GSE124771 |
| Experimental Models: Cell Lines | ||
| B16 Flt3L mouse melanoma cells | Dr. Richard A. Flavell | RRID:CVCL_IJ12 |
| L929 cells | ATCC | Cat# CCL-1, RRID:CVCL_0462 |
| Experimental Models: Organisms/Strains | ||
| Mouse: WT: C57BL/6NCrl | Charles River Laboratories | Cat# CRL:27, RRID:IMSR_CRL:27 |
| Mouse:WT:C57BL/6-Ly5.1[B6.SJL-PtprcaPepcb/BoyCrl] | Charles River Laboratories | Cat# CRL:494, RRID:IMSR_CRL:494) |
| Mouse: CD11ccre (Itgax-Cre) [B6.Cg-Tg(Itgax-Cre)1–1Reiz/J] | The Jackson Laboratory | Cat# JAX:008068, RRID:IMSR_JAX:008068 |
| Mouse: Mb1cre [B6.C(Cg)-Cd79atm1(Cre)Reth/EhobJ] | The Jackson Laboratory | Cat# JAX:020505, RRID:IMSR_JAX:020505 |
| Mouse: CD19−/-(CD19cre/cre) [B6.129P2(C)-Cd19tm1(cre)Cgn/J] | The Jackson Laboratory | Cat# JAX:006785, RRID:IMSR_JAX:006785 |
| Mouse: Batf3−/- [B6.129S(C)-Batf3tm1Kmm/J] | The Jackson Laboratory | Cat# JAX:013755, RRID:IMSR_JAX:013755 |
| Mouse: MHC Class I−/- [B6.129P2-B2mtm1Unc/J] | The Jackson Laboratory | Cat# JAX:002087, RRID:IMSR_JAX:002087 |
| Mouse: Irf4fl [B6.129S1-Irf4tm1Rdf/J] | The Jackson Laboratory | Cat# JAX:009380, RRID:IMSR_JAX:009380 |
| Mouse: Myd88fl [B6.129P2(SJL)-Myd88tm1Defr/J] | The Jackson Laboratory | Cat# JAX:008888, RRID:IMSR_JAX:008888 |
| Mouse: IL-10Rαfl [B6(SJL)-Il10ratm1.1Tlg/J] | The Jackson Laboratory | Cat# JAX:028146, RRID:IMSR_JAX:028146 |
| Mouse: C3−/- [B6.129S4-C3tm1Crr/J] | The Jackson Laboratory | Cat# JAX:029661, RRID:IMSR_JAX:029661 |
| Mouse: Il10−/- [B6.129P2-Il10tm1Cgn/J] | The Jackson Laboratory | Cat# JAX:002251, RRID:IMSR_JAX:002251 |
| Mouse: OT-1 [C57BL/6-Tg(TcraTcrb)1100Mjb/J] | The Jackson Laboratory | Cat# JAX:003831, RRID:IMSR_JAX:003831 |
| Mouse: OT-2 [B6.Cg-Tg(TcraTcrb)425Cbn/J] |
The Jackson Laboratory | Cat# JAX:004194, RRID:IMSR_JAX:004194 |
| Mouse: Dock8−/- | Krishnaswamy et al., 2015 | N/A |
| Mouse: Dock8fl/fl | Krishnaswamy et al., 2017 | N/A |
| Oligonucleotides | ||
| hypoxanthine guanine phosphoribosyl transferase (Hprt) forward 5’-CTGGTGAAAAGGACCTCTCG |
Sigma | N/A |
| Hprt reverse 5’-TGAAGTACTCATTATAGTCAAGGGCA | Sigma | N/A |
| Interleukin 10 (IL-10) forward 5’-GGTTGCCAAGCCTTATCGGA | Sigma | N/A |
| IL-10 reverse 5’- ACCTGCTCCACTGCCTTGCT | Sigma | N/A |
| NADPH oxidase (Nox2) forward 5’-TTCACCCAGTTGTGCATCGACCTA | Sigma | N/A |
| Nox2 reverse 5’- TCCATGGTCACCTCCAACACAAGA | Sigma | N/A |
| Recombinant DNA | ||
| Software and Algorithms | ||
| GraphPad Prism 7 | Graphpad Inc | RRID: SCR_002798 |
| Flowjo v10 | Treestar Inc | RRID: SCR_008520 |
| Adobe Photoshop | https://www.adobe.com/products/photoshop.html | RRID:SCR_014199 |
| Adobe Illustrator | https://www.adobe.com/products/illustrator.html | RRID:SCR_010279) |
| IPA | QIAGEN Bioinformatics | RRID:SCR_008653 |
| Trim Galore version 0.4.0 | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | RRID:SCR_011847 |
| FastQC version 0.11.5 | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | RRID:SCR_014583 |
| Salmon version 0.7.2 | https://combine-lab.github.io/salmon/ | RRID: SCR_017036 |
| R version 3.3.1 libraries “tximport”, “DESeq2”, “pheatmap”, “RColorBrewer”, “ggplot2” | https://www.r-project.org/ | RRID:SCR_001905 |
| Other | ||