Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Aug 8.
Published in final edited form as: Oncogene. 2018 Dec 12;38(15):2778–2787. doi: 10.1038/s41388-018-0609-1

NTRK1 is a positive regulator of YAP oncogenic function

Xinyuan Yang 1,2,#, He Shen 2,#, Brian Buckley 3, Yanmin Chen 2, Nuo Yang 4, Ashley L Mussell 2, Mikhail Chernov 3, Lester Kobzik 5, Costa Frangou 5, Suxia Han 1,*, Jianmin Zhang 2,*
PMCID: PMC6686201  NIHMSID: NIHMS1043451  PMID: 30542115

Abstract

Multiple cancer signalling networks take part in regulatory crosstalk with the Hippo tumour suppressor pathway through the transcriptional cofactor Yes-associated protein 1 (YAP). Nevertheless, how YAP is controlled by pathway crosstalk in tumourigenesis remains poorly understood. Here, we performed a targeted kinase inhibitor screen in human cancer cells to identify novel Hippo pathway regulators. Notably, we identified the nerve growth factor (NGF) receptor tyrosine kinase (NTRK1), a molecule not previously associated with Hippo signalling. NTRK1 inhibition decreased YAP-driven transcription, cancer cell proliferation and migration. Furthermore, using a complementary functional genomics approach and mouse xenograft models, we show that NTRK1 regulates YAP oncogenic activity in vivo. Mechanistically, NTRK1 inhibition was found to induce large suppressor kinase 1 (LATS1) phosphorylation and control YAP subcellular localization. Taken together, these results provide compelling evidence of crosstalk between the NGF-NTRK1 and Hippo cancer pathways.

Keywords: NTRK1, YAP, Hippo signalling pathway, cancer, proliferation, cell migration

INTRODUCTION

The Hippo signalling pathway is frequently deregulated in many types of cancer (1, 2). The core kinase cascade of the Hippo pathway consists of large suppressor kinase 1/2 (LATS1/2), STE20-like kinase 1/2 (Mst1/2) and the RASSF family of proteins (3, 4). Transcriptional coactivator Yes-associated protein (YAP) is a key downstream effector of the Hippo pathway and when dephosphorylated translocate into the nucleus and drives gene expression programs that control cell proliferation, cell migration and invasion. Comprehensive pan-cancer analyses of common cancer types have identified frequent and widespread YAP overexpression in colorectal, hepatocellular, lung, ovarian, pancreatic, and prostate carcinomas (5). Consistent with these reports, we have previously showed that YAP is amplified in mouse mammary tumours (6). Furthermore, the expression of constitutively active YAP induces epithelial-to-mesenchymal transition (EMT), apoptosis suppression and anchorage-independent growth (6, 7).

The upstream mechanisms controlling Hippo pathway activation, including post-translational YAP regulation, remain poorly characterized. Hence, a better understanding of the full topology (and identity) of pathways linked to Hippo signalling is required to better understand the oncogenic mechanisms and potential targets in a broad spectrum of cancers. Since YAP signalling depends on its phosphorylation status, we sought to identify novel signalling molecules/effectors that modulate YAP function by performing a target-specific kinase screen. Our experimental design used a cell-based reporter to quantify the effects of a panel of well-characterized kinase inhibitors on YAP activity in real time. Specifically, we used two metrics in this assay: (i) luciferase activity as assessed by using a YAP-regulated reporter (8) and (ii) cell proliferation measured by Resazurin assays. Using this approach, we identified one compound, Ro 08–2750, that robustly inhibited YAP target gene connective tissue growth factor (CTGF)-promoter-driven luciferase activity. Ro 08–2750 is known to inhibit NGF binding to neurotrophic receptor tyrosine kinase 1 (NTRK1) and p75NTR, and this binding regulates synaptic strength and plasticity in the mammalian nervous system (9, 10). NTRK1 mediates the many effects of nerve growth factor (NGF) signalling in nerve cells, e.g. promoting cell proliferation or differentiation (11), through receptor autophosphorylation and induction of MAPK/ERK and AKT/PKB signalling pathways (12). Of particular interest, the overexpression of NGF and NGF receptors in cancers implicate NGF in non-neuronal carcinogenesis (13).

In the current report, we show that inhibition of NTRK1 suppresses cancer cell proliferation and migration. This effect is mediated through the direct regulation of Hippo signalling and YAP phosphorylation. Also, we provide evidence of crosstalk between the Hippo and NGF-NTRK1 cancer pathways in vivo. Collectively, these results provide unique molecular insight into both pathways, with potential implications for identifying new targets for cancer diagnosis or treatment.

RESULTS

Identification of Ro 08–2750 as a potent inhibitor of CTGF promoter-driven luciferase activity

Deregulation of the Hippo signalling pathway promotes tumour development and progression (4, 14). Re-activation of the Hippo pathway activity has been suggested as an anti-cancer therapy (3) (15). To identify key regulatory kinases involved in YAP oncogenic function, we co-transfected 293AD cells with YAP and a luciferase reporter driven by the CTGF-promoter (8). CTGF is a well-known YAP target that mediates the pro-proliferative function of YAP (16, 17). We measured the effect of 80 selective kinase inhibitors on the luciferase reporter activity in transfected 293AD cells. Notably, one compound, Ro 08–2750, which blocks NGF binding to p75NTR and NTRK1 (9), inhibited CTGF promoter activity by ~80% (Figure 1A) and in a dose-dependent manner (Figure 1B); however, this compound had a negligible effect on 293AD cell proliferation (Supplemental Figure 1A). Also, several other kinase inhibitors were identified that could inhibit CTGF promoter activity (Supplemental Figure 1B). However, we decided to focus our efforts on Ro 08–2750 because our results implicated a novel functional interaction between NTRK1 and YAP.

Figure 1. Kinase inhibitor screen identifies Ro 08–2750 as a potent inhibitor for CTGF-promoter driven luciferase activity.

Figure 1

(A) Luciferase activity measurement in duplicate in response to 10μm kinase inhibitors treatment.

(B) Immunoblot analyses were performed with anti-YAP or anti-GAPDH antibodies. The samples are lysates from vector or YAP-WT transfected 293AD cells. GAPDH was used as loading control.

(C) Luciferase activity was measured in response to DMSO, 5μm or 10μm Ro 08–2750 treated CTGF-promoter luciferase, renilar and YAP-WT co-transfected 293AD cells. Error bars represent SD; ** p<0.01; *** p<0.001 by two-tailed student’s t-test.

NTRK1 inhibition suppresses the proliferation and migration of PANC1 and MDA-MB231 cells

Effects of NGF-NTRK1 on tumour cells have been previously reported, but the results are conflicting (18–20). Therefore, we first used a cell enumeration approach to examine the effects of NTRK1 inhibition on two distinct cancer cell lines with well-defined YAP activity, PANC1 (21) (pancreatic) and MDA-MB-231 (breast) cancer cells (22). After 24, 48, and 72 hours of Ro 08–2750 treatment (5 μM and 10 μM), cell proliferation was decreased in a dose and time-dependent manner compared to that in the control and DMSO groups (P < 0.05) (Figure 2A). Next, we determined the effects of NTRK1 inhibition on colony formation in PANC1 and MDA-MB231 cells. As expected, Ro 08–2750 decreased both the size and number of colonies (Figure 2B). Additionally, the effects of Ro 08–2750 treatment on the cell migration potential of PANC1 and MDA-MB-231 cells was investigated using wound healing assays. Ro 08–2750-treated cells failed to migrate after 24 hours, whereas the mock-treated control cells filled the wound gap well (Figure 2C). To corroborate the NTRK1 inhibition effects, we employed two additional NTRK1 small molecule inhibitors GNF 5837 and AG 879, respectively. GNF 5837 and AG 879 treatment inhibited CTGF promoter reporter activity (Supplemental Figure S2). Also, AG 879 treatment decreased MDA-MB-231 cell proliferation and migration (Supplemental Figure S3 B–C).

Figure 2. NTRK1 inhibition suppresses the cell proliferation and migration of PANC1 and MDA-MB231 cells.

Figure 2

(A) Cell numbers were counted in DMSO, 5μm or 10μm Ro 08–2750 treated PANC1 and MDA-MB231 cells every 24 hrs for 72 hrs. Experiment was repeated independently three times. Error bars represent SD; * P<0.05, ** P < 0.01 by two-tailed student’s t-test.

(B) Representative images of colony formation assay for DMSO or 10μm Ro 08–2750 treated PANC1 and MDA-MB231 cells for three weeks (Left panel). Quantifications of colony formation assay from three independent experiments (Right panel). Error bars represent SD; ** P < 0.01 by two-tailed student’s t-test.

(C) Representative images of wound healing assay for DMSO or 10μm Ro 08–2750 treated PANC1 and MDA-MB231 cells for 24 hrs (Left panel). Quantifications of wound closure estimation from three independent experiments (Right panel). Error bars represent SD; *P < 0.05, ** P < 0.01 by two-tailed student’s t-test.

Effects of NTRK1 inhibition on the Hippo pathway

To test whether Ro 08–2750 activates the Hippo pathway, we measured the active forms of p-MST1/2 and p-LATS1, and the inactive form of p-YAP (S127). As shown in Figure 3A, we found that although Ro 08–2750 treatment induced LATS1 and YAP1 phosphorylation, there were no notable effects on MST1/2 phosphorylation. Interestingly, Ro 08–2750 treatment decreased the relative nuclear YAP protein level and increased the cytoplasmic YAP level (Figure 3B). In addition, the expression of several YAP target genes (e.g., ADMTS1, ANKRD1 and CYR61) was suppressed by Ro 08–2750 treatment in MDA-MB-231 and PANC1 cells (Figure 3C). Furthemore, AG 879 treatment of MDA-MB-231 cells exhibited comparable effects (Supplemental Figure S3A). Taken together, these results suggest that NTRK1 inhibition activates LATS1 and suppresses YAP transcriptional co-activator function(s).

Figure 3. NTRK1 inhibition suppresses the YAP activity in PANC1 and MDA-MB231 cells.

Figure 3

(A) Immunoblot analyses were performed with anti-pLATS1 (S909), anti-LATSI, anti-pYAP (S127), anti-YAP, anti-MST1 (Thr183), anti-MST1 or anti-GAPDH antibodies. The samples are lysates from no treatment, DMSO, 5μm or 10μm Ro 08–2750 treated PANC1 and MDA-MB231 cells for 24 hrs. GAPDH was used as loading control.

(B) Representative images of YAP immunofluorescence staining in DMSO or 10μm Ro 08–2750 treated PANC1 cells for 24 hrs. Three independent experiments were performed. Scale bar=20μm

(C) mRNA expression (qRT-PCR) of YAP target genes CYR61, ADMTS1 and ANKRD1 in PANC1 cells; CYR61 and ANKRD1 in MDA-MB231 cells that treated with DMSO or 10μm Ro 08–2750. GAPDH was used as an internal control. Three independent experiments were performed. Error bars represent SD; * p<0.05; ** p<0.01 by two-tailed student’s t-test.

YAP-S127A eliminates the effect of NTRK1 inhibition

Because LATS1-mediated Serine 127 phosphorylation led to YAP exclusion from nucleus, we generated a YAP (S127A) mutant resistant to LATS1 phosphorylation (7). Subsequently, to determine whether NTRK1 inhibition affects constitutively active YAP, we transduced MDA-MB-231 with a vector control or YAP (S127A) (Figure 4A). We found that treatment to the MDA-MB-231 cells with Ro 08–2750 decreased proliferation in the control cells but not in the cells expressing the active form of YAP (Figure 4B; Supplemental Figure 4A). Similarly, wound healing assays revealed that cell migration was suppressed by Ro 08–2750 treatment in the control cells, but this effect was eliminated by YAP-S127A expression (Figure 4C; Supplemental Figure 4B).

Figure 4. Effect of NTRK1 inhibition is eliminated by YAP-S127A.

Figure 4

(A) Immunoblot of YAP expression in MDA-MB231 cells transduced with the empty vector control (pBabe-puro) or the pBabe-YAP-S127A construct. GAPDH was used as the loading control.

(B) Cell numbers were counted in DMSO or 10μm Ro 08–2750 treated MDA-MB231 cells for 24 hrs or 48 hrs. Three independent experiments were performed. Error bars represent SD; * P<0.05 by two-tailed student’s t-test.

(C) Representative images of wound healing assay for DMSO or 10μm Ro 08–2750 treated MDA-MB231 cells for 24 hrs (Left panel). Quantifications of wound closure estimation from three independent experiments (Right panel). Error bars represent SD; *P < 0.05 by two-tailed student’s t-test.

NTRK1 stimulation by NGF promotes cancer cell growth and migration

The results presented thus far indicate that NTRK1 inhibition activates LATS1 and inactivates YAP function. To test the converse hypothesis, i.e., whether NGF stimulation inactivates LATS1 and activates YAP, we first treated PANC1 and MDA-MB-231 cells with NGF to activate NTRK1 (23). NGF treatment decreased the p-YAP and p-LATS1 levels in a time-dependent manner (Figure 5A). The expression of YAP target genes (CTGF, CYR61 and ANKRD1) was up-regulated after NGF treatment (Figure 5B). In addition, proliferation was significantly higher in NGF-treated cells than in control cells, and this effect was completely reversed by the YAP small molecule inhibitor Verteporfin or siYAP (Figure 5C-D). Interestingly, using immunostaining, we found that YAP translocated into the nucleus following NGF treatment (Supplemental Figure S5). In accordance with this result, colony formation and wound healing assays also showed that NGF treatment potentiated cancer cell growth and migration (Figure 5 E).

Figure 5. b-NGF treatment promotes cell growth and migration.

Figure 5

(A) Immunoblot analyses were performed with anti-pLATS1 (S909), anti-LATS1, anti-pYAP (S127), anti-YAP, anti-MST1 (Thr183), anti-MST1 or anti-GAPDH antibodies. The samples are lysates from PANC1 or MDA-MB231 cells in serum-free medium for 24 hours without or with 200 ng/mL b-NGF treatment for 5, 15 or 30 minutes. GAPDH was used as loading control.

(B) mRNA expression (qRT-PCR) of YAP target genes CTGF and CYR61 in PANC1 cells; CTGF, CYR61 and ANKRD1 in MDA-MB231 cells that treated without or with 200 ng/mL b-NGF treatment for 30 minutes. Three independent experiments were performed. GAPDH was used as an internal control. Error bars represent SD; ** p<0.01 by two-tailed student’s t-test.

(C) Cell numbers were counted in PANC1 or MDA-MB231 cells under the condition of control, 200 ng/mL b-NGF or 200 ng/mL b-NGF together with 1μm verteporfin treatment every 24hrs for 72 hrs. Three independent experiments were performed. Error bars represent SD; ** p<0.01 by two-tailed student’s t-test.

(D) Cell numbers were counted in PANC1 or MDA-MB-231 cells under the condition of siControl or siYAP together with 200 ng/mL b-NGF every 24hrs for 72 hrs. Insert: Immunoblot analyses were performed with anti-YAP or anti-GAPDH antibodies. The samples are lysates from siControl or siYAP transfected PANC1 or MDA-MB231 cells. GAPDH was used as loading control. Three independent experiments were performed. Error bars represent SD; * p<0.05, ** p<0.01, *** p<0.001 by two-tailed student’s t-test.

(E) Representative images of wound healing assay for DMSO or 200 ng/mL b-NGF treated PANC1 or MDA-MB231 cells in serum-free medium for 24 hours (Left panel). Quantifications of wound closure estimation from three independent experiments (Right panel). Error bars represent SD; ** P < 0.01 by two-tailed student’s t-test.

NTRK1 knockdown inhibits cell proliferation and migration

To investigate the functional consequences of NTRK1 gene expression, we knocked down NTRK1 using siRNA (siNTRK1) in PANC1 and MDA-MB-231 cancer cells. Knocking down NTRK1 dramatically reduced cell proliferation as measured by cell proliferation and colony formation assays (Figure 6A-D). Furthermore, the perturbation of NTRK1 inhibited cell migration (Figure 6E) and increased the levels of the active form of p-LATS1 and the inactive form of YAP (pYAP-S127) (Figure 6A). Consistent with these findings, reduction of NTRK1 diminished its effects in YAP-S127A transformed MDA-MB-231 cells (Supplemental Figure S6).

Figure 6. Knockdown of NTRK1 inhibits cell proliferation and migration.

Figure 6

(A) Immunoblot analyses were performed with anti-NTRKI, anti-pLATSI (S909), anti-LATSI, anti-pYAP (S127), anti-YAP, anti-MST1 (Thr183), anti-MST1 or anti-GAPDH antibodies. The samples are lysates from siCon or siNTRK1 transfected PANC1 or MDA-MB231 cells. GAPDH was used as loading control.

(B) Cell numbers were counted in siCon or siNTRK1 transfected PANC1 or MDA-MB231 cells every 24hrs for 72 hrs. Three independent experiments were performed. Error bars represent SD; * p<0.05 by two-tailed student’s t-test.

(C) Quantifications of colony formation assay for siCon or siNTRK1 transfected PANC1 or MDA-MB231 cells for three weeks. Three independent experiments were performed. Error bars represent SD; ** p<0.01 by two-tailed student’s t-test.

(D) Representative images of 24 hrs wound healing assay for siCon or siNTRK1 transfected PANC1 or MDA-MB231 cells (Left panel). Quantifications of wound closure estimation from three independent experiments (Right panel). Error bars represent SD; ** P < 0.01 by two-tailed student’s t-test.

NTRK1 knockdown inhibits tumour growth in mouse xenograft model

Next, to determine whether NTRK1 suppression affects xenograft tumour growth, we first transduced PANC1 and MDA-MB231 cells with lentiviral shCon or shNTRK1 constructs. As expected, we observed increase of p-LATS1 and p-YAP in the NTRK1 knockdown cells (Figure 7A). Likewise, when these cells were treated with NGF, the previously observed decrease in p-YAP and p-LATS1 protein levels was eliminated, further corroborating the critical role of NTRK1 in mediating the effects of NGF via the Hippo pathway (Figure 7B). Finally, we subcutaneously injected PANC1 and MDA-MB231 cells that had been transduced with either shCon or shNTRK1s into SCID mice and monitored tumour growth. As shown in Figure 7C, tumour growth was inhibited in mice transplanted with NTRK1 knockdown cells compared to that in mice transplanted with control cells (Figure 7C). Immunoblots using the shCon-or shNTRK1-derived samples confirmed a marked reduction in YAP protein levels in the NTRK1 knockdown tumours (Figure 7D).

Figure 7. Knockdown of NTRK1 suppresses tumour growth in vivo.

Figure 7

(A) Immunoblot analyses were performed with anti-NTRK1, anti-pLATS1 (S909), anti-LATS1, anti-pYAP (S127), anti-YAP or anti-GAPDH antibodies. The samples are lysates from PANC1 or MDA-MB231 cells transduced with shCon or shNTRK1 hairpins. GAPDH was used as loading control.

(B) Immunoblot analyses were performed with anti-NTRK1, anti-pLATS1 (S909), anti-LATS1, anti-pYAP (S127), anti-YAP or anti-GAPDH antibodies. The samples are lysates from PANC1 or MDA-MB231 cells transduced with shCon or shNTRK1 hairpins under the condition of 24 hr serum deprivation with or without 200 ng/mL b-NGF treatment for 30 minutes. GAPDH was used as loading control.

(C) Representative primary tumour images of shCon-or shNTRK1-transduced PANC1 or MDA-MB-231 cells subcutaneously injected into SCID mice (upper panel). Quantifications of primary tumour weight were measured after 6 weeks subcutaneous injection of shCon or shNTRK1-transduced PANC1 or MDA-MB-231 cells in SCID mice. n=5 mice per group; error bars represent SD; *** p<0.001 by two-tailed student’s t-test.

(D) Immunoblot analyses were performed with anti-NTRK1, anti-YAP or anti-GAPDH antibodies. The samples are lysates from primary tumours that injected shCon or shNTRK1-transduced PANC1 or MDA-MB-231 cells in SCID mice. GAPDH was used as loading control.

(E) Schematic model of the NTRK1 regulation on YAP function.

DISCUSSION

The core kinase cascade of the Hippo pathway consists of the LATS1/2, the adaptor protein MOB1, and Ste20-like protein kinase Mst1/2, the WW domain-containing protein WW45, (1). Hippo signalling is controlled by a complex network of upstream components and mechanisms, many of which are involved in the regulation of cell adhesion and cell polarity (15). For example, signalling from G-protein coupled receptors and their ligands has been recently established to regulate YAP activity (24).

The control of YAP nuclear localization represents an exciting area in the design of new modalities for therapeutic intervention. For example, Liu-Chittenden et al. identified verteporfin as a potent inhibitor of YAP1/TEAD interactions, and this compound inhibited YAP-induced liver growth in YAP-overexpressing or neurofibromin 2 (NF2)/merlin-inactivated mice (25). Likewise, Song et al. identified a small molecule (CA3) that dramatically inhibited YAP1/TEAD transcriptional activity and oesophageal adenocarcinoma cell growth (26). Additionally, porphyrin-and dipyrrin-related derivatives have been reported to directly target TAZ or YAP proteins and inhibit TEAD transcriptional activity (27).

In this study, we performed a targeted kinase inhibitor screen in human cancer cells to identify novel non-canonical Hippo pathway kinases that control cell proliferation and survival. Our investigations began with the unexpected observation that pharmacological inhibition of NTRK1 suppressed the reporter activity of a YAP canonical target gene (CTGF). This finding suggested novel crosstalk between NTRK1 and YAP. A subsequent analysis of the subcellular localization of YAP further revealed that NTRK1 inhibition augmented YAP cytoplasmic localization and that pharmacological or genetic inhibition of NTRK1 suppressed the transcriptional expression of YAP target genes. Notably, although the total LATS1, MST and YAP protein levels were not affected, LATS1 and YAP phosphorylation was induced by NTRK1 inhibition. Consistent with these results, the direct stimulation of NTRK1 by NGF led to decreased p-YAP and p-LATS protein levels and YAP target gene expression, as well as cell proliferation and migration. Future molecular studies are needed to understand how NTRK1 activation alters the downstream signalling events in the Hippo pathway. Nonetheless, functionally associating NTRK1 with the Hippo signalling pathway reveals an important new aspect of NGF growth factor signalling that regulates cancer cell growth in vitro and promotes tumour growth in mice.

In summary, our data recognizes the importance of NTRK1 mediated post-transcriptional control of YAP that promotes cancer cell proliferation and tumourigenesis (Figure 7E). When NGF drives NTRK1 activation, YAP co-activates transcriptional expression of survival genes implicated in cell proliferation. On the other hand, inhibiting NTRK1 modulates LATS1/2 phosphorylation and YAP cytoplasmic sequestration. Collectively, our data expand our knowledge of how Hippo signalling interacts with other oncogenic pathways. Moreover, our findings support the previously ill-defined capacity of NGF signalling to contribute to the acquisition of tumourigenic potential, thus indicating that further exploration and investigation of therapeutics targeting this pathway is warranted.

MATERIALS & METHODS

Cell Culture, siRNA Transfection and Viral Transductions

293AD, MDA-MB-231 and PANC1 cells were cultured in DMEM supplemented with 10% FBS. MDA-MB-231 and PANC1 cells were obtained from the American Type Culture Collection (ATCC, VA). 293AD cells were kindly provided by Daniel Haber (MGH, Boston). All cell cultures were authenticated by short tandem repeat profiling and routinely tested for mycoplasma.

ON-TARGETplus Non-targeting siRNAs (D-001810–0X) and SMARTPOOL ON-TARGETplus NTRK1 siRNAs (L-003159–00-0005) or YAP1 siRNA (L-012200–00-0005) targeting human NTRK1 or YAP1 were acquired from Dharmacon (Lafayette, CO). DharmaFECT 1 Transfection Reagent (T2001–02) has been used to transfect the siRNAs at final concentration of 20 nmol/L. Cell lysates or functional assays were performed at ~72 hrs after siRNA transfection.

The human YAP wild type and YAP-S127A expression constructs were previously described (6, 7). Lentivirus and retrovirus packaging, cell transduction and puromycin cell selection were performed as previously described (28).

RNAi gene target sequences are summarized below (5’−3’ direction):

shNon-target-Con: CAACAAGATGAAGAGCACCAA;

shNTRK1-A: AGTCAGCCACGGTGATGAAAT;

shNTRK1-B:TATCTACAGCACCGACTATTA;

Quantitative real-time PCR (qRT-PCR)

Total RNA was prepared using Trizol Reagent (Life Technologies; MA) and quantitative real-time PCR performed using standard protocols. GAPDH expression was used as the internal normalization control. QRT-PCR primer sequences are as follows:

CTGF-F: 5’-GGAAATGCTGCGAGGAGTGG-3’;

CTGF-R: 5’-GAACAGGCGCTCCACTCTGTG-3’;

CYR61 -F: 5’-CACAC CAAG GGGCTG G AATG-3’;

CYR61 -R: 5’-CCCGTTTTGGTAGATTCTGG-3’;

ANKRD1-F: 5’-GCCAAAGACAGAGAAGGAGATAC-3’;

ANKRD1-R: 5’-GAGATCCGCGCCATACATAAT-3’;

ADMTS1-F: 5’-TCACCACAGCCCATGAATTAG-3’;

ADMTS1-R: 5’-GGAATCCTGGTTCACACCATTA-3’;

GAPDH-F: 5’-GTGAAGGTCGGAGTCAACGG-3’

GAPDH-R: 5’-GAGGTCAATGAAGGGGTCATTG-3’

Immunoblot and Antibodies

RIPA lysis buffer (Boston Bio-Products, MA) was used for protein extraction from cell lines. The Halt™ Protease Inhibitor Cocktail, EDTA-free (100X) (Life Technology; MA) was added before harvesting protein lysates. 40 μg protein lysates were separated by SDS-PAGE electrophoresis, transferred to PVDF membranes (EMD Millipore; MA) and blocked with non-fat milk for 1 hr. Primary antibodies were prepared in 5% BSA or non-fat milk and incubated with PVDF membrane at 4 °C overnight. The HRP-conjugated goat anti-mouse (Bio-Rad # 1706516) or goat anti-rabbit (Bio-Rad # 1706515) secondary antibodies were incubated with membrane for 2 hours. ECL Plus Western Blotting Detection Reagents (GE Healthcare; PA) were used for protein detection. Anti-NTRK1 (# 2505), anti-YAP (#14074), anti-phospho-YAP (Ser127) (# 13008), anti-LATS1 (# 9153), anti-phospho-LATS 1 (Ser909) (# 9157), anti-MST1 (# 14946) and anti-phospho-MST1/2 (T183/T180) (#3681) antibodies from Cell Signalling Technologies (Beverly, MA); anti-GAPDH (#Y1041) antibody from Ubiquitin-Proteasome Biotechnologies (Aurora; CO); anti-Flag M2 antibody was purchased from Sigma-Aldrich (#F1804–1MG);

Immunofluorescence Assay

Immunofluorescence staining was performed as previously described (29).

Luciferase Reporter Assay

CTGF-promoter reporter luciferase reporter construct was kindly provided by Dr. Camargo. Briefly, luciferase reporter, Renilla and YAP1 wild type constructs were co-transfected to 293AD cells with X-tremeGENE 9 DNA Transfection Reagent following the manufacturer’s protocol (Roche). Firefly and Renilla luciferase activities were detected by Dual-Luciferase Reporter Assay (Promega; WI). Each sample was performed in triplicate and a minimum three independent experiments were performed.

Cell Proliferation and Colony Formation Assay

MDA-MB231 and PANC1 cells were seeded in 35-mm dishes at a concentration of 2×104 cells/ml. Cells were treated with DMSO, Ro 08–2750 (5 and 10μm), or 200ng/ml bNGF for 24, 48 and 72 hours. Post treatment, cell numbers were counted using a hemocytometer. For colony formation assays, ~200 cells/well were plated into 6 wells plate, images were taken and colonies were counted after three weeks. The NTRK1 inhibitor was added every day. Each accumulation of more than 50 cells was counted as a positive colony. Each sample was performed in triplicate and three independent experiments were performed.

Wound Healing Assay

MDA-MB-231or PANC1 cells grown to confluency were scratched and grown for 24 hours in medium containing +/−10% FBS (for b-NGF treatment experiments). Images were taken 24 hours later. Each sample was performed in triplicate and three independent experiments were performed.

In vivo tumour xenograft assay

In vivo tumour growth assays were performed as previously described (30). Female NOD/SCID mice of 6–8 weeks old were obtained from RPCI. Animal experiments were performed under the rules provided by Declaration of Helsinki and approved by the Institutional Animal Care and Use Committee of the RPCI (Buffalo, NY).

Kinase inhibitor library screen

The Kinase inhibitor screen was performed by the Small Molecule Screen Shared Resource at RPCI. YAP-wild type plasmid and CTGF-promoter-luciferase reporter were co-transfected into HEK293AD cells. Transfected cells were treated with 10 μM Tocriscreen Kinase Inhibitor Toolbox (Tocris Bioscience 3514) in 384 well plate for 24 hrs in duplicate. Luciferase activity and cell survival were measured by luciferase assay (Promega; WI) and Resazurin cell enumeration assay (Thermo Fisher Scientific; MA). Luciferase activities and cell survival were compared for each drug with DMSO-treated controls, repectively.

Statistical Analysis

Statistical tests were performed using the SPSS statistics software package (SPSS, IL). All results are expressed as mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.

Supplementary Material

1

ACKNOWLEDGEMENTS

We would like to thank Dr. Haber who kindly proved us 293AD cells and Dr. Camargo kindly provided us the CTGF-promoter Luciferase reporter construct. Also, we thank the Small Molecule Screen, Flow and Image Cytometry, Laboratory Animal and Experimental Tumour Models Shared Resources/Facilities of RPCI. This work was supported by the National Natural Science Foundation of China 81672921(to S.H.). This work was supported by the Roswell Park Cancer Institute and National Cancer Institute (NCI) Grant #P30 CA016056, Roswell Park Alliance Foundation, National Cancer Institute (NCI) R01 CA207504 and the American Cancer Society Research Scholar Grant RSG-14–214-01-TBE (to J.Z.).

Footnotes

CONFLICT OF INTEREST

The authors declare that there are no conflicts of interest.

REFERENCES

  • 1.Pan D The hippo signaling pathway in development and cancer. Developmental cell. 2010;19(4):491–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Harvey K, Tapon N. The Salvador-Warts-Hippo pathway -an emerging tumour-suppressor network. Nature reviews Cancer. 2007;7(3):182–91. [DOI] [PubMed] [Google Scholar]
  • 3.Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell. 2015;163(4):811–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the Roots of Cancer. Cancer cell. 2016;29(6):783–803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC, et al. Oncogenic Signaling Pathways in The Cancer Genome Atlas. Cell. 2018;173(2):321–37 e10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, Sgroi DC, et al. Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(33):12405–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang J, Ji JY, Yu M, Overholtzer M, Smolen GA, Wang R, et al. YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway. Nature cell biology. 2009;11(12):1444–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Mohseni M, Sun J, Lau A, Curtis S, Goldsmith J, Fox VL, et al. A genetic screen identifies an LKB1-MARK signalling axis controlling the Hippo-YAP pathway. Nature cell biology. 2014;16(1):108–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Niederhauser O, Mangold M, Schubenel R, Kusznir EA, Schmidt D, Hertel C. NGF ligand alters NGF signaling via p75(NTR) and trkA. J Neurosci Res. 2000;61(3):263–72. [DOI] [PubMed] [Google Scholar]
  • 10.Arkin MR, Wells JA. Small-molecule inhibitors of protein-protein interactions: progressing towards the dream. Nature reviews Drug discovery. 2004;3(4):301–17. [DOI] [PubMed] [Google Scholar]
  • 11.Fiore M, Chaldakov GN, Aloe L. Nerve growth factor as a signaling molecule for nerve cells and also for the neuroendocrine-immune systems. Rev Neurosci. 2009;20(2):133–45. [DOI] [PubMed] [Google Scholar]
  • 12.Lange AM, Lo HW. Inhibiting TRK Proteins in Clinical Cancer Therapy. Cancers. 2018;10(4). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nakagawara A Trk receptor tyrosine kinases: a bridge between cancer and neural development. Cancer letters. 2001;169(2):107–14. [DOI] [PubMed] [Google Scholar]
  • 14.Harvey KF, Zhang X, Thomas DM. The Hippo pathway and human cancer. Nature reviews Cancer. 2013;13(4):246–57. [DOI] [PubMed] [Google Scholar]
  • 15.Johnson R, Halder G. The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nature reviews Drug discovery. 2014;13(1):63–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhang J, Smolen GA, Haber DA. Negative regulation of YAP by LATS1 underscores evolutionary conservation of the Drosophila Hippo pathway. Cancer research. 2008;68(8):2789–94. [DOI] [PubMed] [Google Scholar]
  • 17.Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes & development. 2007;21(21):2747–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Aloe L, Rocco ML, Balzamino BO, Micera A. Nerve growth factor: role in growth, differentiation and controlling cancer cell development. J Exp Clin Cancer Res. 2016;35(1):116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Descamps S, Pawlowski V, Revillion F, Hornez L, Hebbar M, Boilly B, et al. Expression of nerve growth factor receptors and their prognostic value in human breast cancer. Cancer research. 2001;61(11):4337–40. [PubMed] [Google Scholar]
  • 20.Descamps S, Toillon RA, Adriaenssens E, Pawlowski V, Cool SM, Nurcombe V, et al. Nerve growth factor stimulates proliferation and survival of human breast cancer cells through two distinct signaling pathways. The Journal of biological chemistry. 2001;276(21):17864–70. [DOI] [PubMed] [Google Scholar]
  • 21.Mello SS, Valente LJ, Raj N, Seoane JA, Flowers BM, McClendon J, et al. A p53 Super-tumor Suppressor Reveals a Tumor Suppressive p53-Ptpn14-Yap Axis in Pancreatic Cancer. Cancer cell. 2017;32(4):460–73 e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Heidary Arash E, Shiban A, Song S, Attisano L. MARK4 inhibits Hippo signaling to promote proliferation and migration of breast cancer cells. EMBO Rep. 2017;18(3):420–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Benito-Gutierrez E, Garcia-Fernandez J, Comella JX. Origin and evolution of the Trk family of neurotrophic receptors. Mol Cell Neurosci. 2006;31(2):179–92. [DOI] [PubMed] [Google Scholar]
  • 24.Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell. 2012;150(4):780–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liu-Chittenden Y, Huang B, Shim JS, Chen Q, Lee SJ, Anders RA, et al. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes & development. 2012;26(12):1300–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Song S, Xie M, Scott AW, Jin J, Ma L, Dong X, et al. A Novel YAP1 Inhibitor Targets CSC-Enriched Radiation-Resistant Cells and Exerts Strong Antitumor Activity in Esophageal Adenocarcinoma. Mol Cancer Ther. 2018;17(2):443–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gibault F, Bailly F, Corvaisier M, Coevoet M, Huet G, Melnyk P, et al. Molecular Features of the YAP Inhibitor Verteporfin: Synthesis of Hexasubstituted Dipyrrins as Potential Inhibitors of YAP/TAZ, the Downstream Effectors of the Hippo Pathway. ChemMedChem. 2017;12(12):954–61. [DOI] [PubMed] [Google Scholar]
  • 28.Li YW, Guo J, Shen H, Li J, Yang N, Frangou C, et al. Phosphorylation of Tyr188 in the WW domain of YAP1 plays an essential role in YAP 1-induced cellular transformation. Cell cycle. 2016;15(18):2497–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wilson KE, Li YW, Yang N, Shen H, Orillion AR, Zhang J. PTPN14 forms a complex with Kibra and LATS1 proteins and negatively regulates the YAP oncogenic function. The Journal of biological chemistry. 2014;289(34):23693–700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhang Y, Shen H, Withers HG, Yang N, Denson KE, Mussell AL, et al. VGLL4 Selectively Represses YAP-Dependent Gene Induction and Tumorigenic Phenotypes in Breast Cancer. Scientific reports. 2017;7(1):6190. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES