Abstract
Circadian clocks control the timing of animal behavioral and physiological rhythms. Fruit flies anticipate daily environmental changes and exhibit two peaks of locomotor activity around dawn and dusk. microRNAs are small non-coding RNAs that play important roles in post-transcriptional regulation. Here we identify Drosophila miR-210 as a critical regulator of circadian rhythms. Under light-dark conditions, flies lacking miR-210 (miR-210KO) exhibit a dramatic 2 hrs phase advance of evening anticipatory behavior. However, circadian rhythms and molecular pacemaker function are intact in miR-210KO flies under constant darkness. Furthermore, we identify that miR-210 determines the evening phase of activity through repression of the cell adhesion molecule Fasciclin 2 (Fas2). Ablation of the miR-210 binding site within the 3’ UTR of Fas2 (Fas2ΔmiR-210) by CRISPR-Cas9 advances the evening phase as in miR-210KO. Indeed, miR-210 genetically interacts with Fas2. Moreover, Fas2 abundance is significantly increased in the optic lobe of miR-210KO. In addition, overexpression of Fas2 in the miR-210 expressing cells recapitulates the phase advance behavior phenotype of miR-210KO. Together, these results reveal a novel mechanism by which miR-210 regulates circadian locomotor behavior.
Author summary
Circadian clocks control the timing of animal physiology. Drosophila has been a powerful model in understanding the mechanisms of circadian regulation. Fruit flies anticipate daily environmental changes and exhibit two peaks of locomotor activity around dawn and dusk. Here we identify miR-210 as a critical regulator of evening anticipatory behavior. Depletion of miR-210 in flies advances evening anticipation. Furthermore, we identify the cell adhesion molecule Fas2 as miR-210’s target in circadian regulation. Fas2 abundance is increased in fly brain lacking of miR-210. Using CRISPR-Cas9 genome editing method, we deleted the miR-210 binding site on the 3’ untranslated region of Fas2 and observed similar phenotype as miR-210 mutants. Altogether, our results indicate a novel mechanism of miR-210 in regulation of circadian anticipatory behavior through inhibition of Fas2.
Introduction
The circadian locomotor rhythms of flies are generated by a neuronal network, which consists of ~150 brain circadian neurons expressing core pacemaker genes [1–4]. These neurons can be further divided into 7 clusters based on their cell localization and neurotransmitters they express [4]. There are 3 groups of dorsal neurons (DN1, DN2, and DN3), 2 groups of ventral-lateral neurons (large and small LNv), dorsal lateral neurons (LNd), and lateral posterior neurons (LPN) [4]. The large LNvs (lLNvs) and 4 small LNvs (sLNvs) express the neuropeptide Pigment Dispersing Factor (PDF), while the 5th sLNv is PDF negative. Under regular light-dark (LD) conditions, flies exhibit a bimodal pattern of locomotor rhythms, peaking around dawn and dusk, which are termed morning peak and evening peak, respectively. According to the dual-oscillator model, separate morning and evening oscillators track these behavior peaks separately [5]. Indeed, studies have shown that the PDF-positive sLNvs are responsible for promoting the morning peak, while the LNds, as well as the fifth sLNv, are mainly responsible for generating the evening activity [6, 7]. In addition, the DN1s are important to integrate environmental inputs such as light and temperature, and regulate circadian rhythms and sleep behavior [8, 9]. A recent study indicated that DN1s sense acute temperature fluctuations to modulate fly sleep [10].
The PDF positive sLNvs are the master pacemaker neurons in fly brain: they synchronize other circadian neurons to maintain robust circadian rhythms under constant darkness [11]. These sLNvs send axonal projections toward the dorsal brain region, where the DN1s and DN2s are located [12, 13]. The dorsal projections of sLNvs exhibit circadian arborization rhythms with higher complexity of axon terminals found in the early day and lower complexity at the night [14]. The physiological relevance and molecular mechanisms underlying this structural plasticity of sLNvs remain unclear. The Rho1 GTPase was identified to modulate the sLNv plasticity and affect seasonal adaptation by phosphorylating Myosion [15]. The cell adhesion molecule Fasciclin 2 (Fas2) has been found to regulate the arborization rhythms of sLNvs [16]. In addition, two matrix metalloproteinases, MMP1 and MMP2 as well as the pacemaker protein VRILLE were shown to be required for the structural remodeling control of sLNv projections [17, 18].
Circadian rhythms are generated by an intracellular molecular clock, which is conserved across the animal kingdom [19]. The core of this molecular pacemaker is a negative transcriptional-translational feedback loop [20–22]. In Drosophila, CLOCK (CLK) dimerizes with CYCLE (CYC) to activate rhythmic transcription of hundreds of genes through the E-box region [23, 24]. Among these clock-controlled genes, PERIOD (PER) and TIMELESS (TIM) are the key transcription repressors: they form heterodimers in the cytoplasm, and then enter into the nucleus to block their own transcription. The abundance of PER and TIM is tightly regulated by a series of post-translational modifications such as phosphorylation, glycosylation and ubiquitination [25–28]. Recent research has revealed an abundance of post-transcriptional regulation of circadian rhythms by both RNA binding proteins and miRNAs [29–31].
miRNAs are small non-coding RNAs, which repress target gene expression through mRNA degradation and/or translation inhibition, thus playing crucial roles in post-transcriptional regulation [32]. Recent studies have uncovered functions of the miRNA biogenesis pathway and specific miRNAs in regulation of different aspects of animal circadian rhythms [31, 33–35]. For instance, mouse miR-132/212 modulates the seasonal adaptation and circadian entrainment to day length [36]. miRNAs also target the molecular clock to control period length and rhythmicity of circadian locomotor activity [37]. In Drosophila, the miRNA bantam regulates circadian locomotor period by repressing Clk, while miR-276a and let-7 inhibit the clock genes timeless and clockwork orange to modulate circadian rhythms respectively [33, 38, 39]. Moreover, various circadian output pathways are controlled by miRNAs. The miR959-964 cluster miRNAs regulate the circadian timing of feeding and immune response, while miR-279 modulates circadian locomotor behavior output [40, 41]. Recently, studies have demonstrated that miR-124 specifically controls the phase of circadian locomotor rhythms under constant darkness [42, 43].
Previously we identified that depletion of GW182, the key protein for miRNA function, affects PDF-receptor signaling and disrupts circadian rhythms [35]. To further understand the roles of miRNA, we performed a genome-wide screen for miRNAs controlling circadian rhythm phenotypes. Here we show that a conserved miRNA in animals, miR-210, regulates circadian rhythms in Drosophila. miR-210 determines the phase of evening anticipatory behavior through inhibition of Fas2.
Results
A genetic screen of miRNA mutants identifies miR-210 as a regulator of circadian behavior
To identify miRNAs that regulate circadian rhythms, we screened the circadian locomotor rhythms of available miRNA mutants from the Bloomington stock center. Circadian behavior of 46 lines in total was observed both under constant darkness (DD) and light dark (LD) cycles. Most of the miRNA mutants we tested exhibited normal circadian rhythms under DD; though, a few miRNAs had a slightly altered period or rhythmicity (S1 Table). Interestingly, we found that the miR-210 mutant (miR-210KO) exhibits a ~1.5 hour advance of the subjective evening peak in DD (S1 Fig). We then closely examined for the locomotor behavior under LD. Indeed, we found that the miR-210 mutant (miR-210KO) clearly advances the phase of the evening anticipatory peak about 2 hours (Fig 1A and 1B). The miR-210KO mutant was generated by knocking-in a GAL4 cDNA in replacement of the endogenous miR-210 sequence [44]. To rule out the possibilities of off-target or genetic background effects, we utilized the miR-210 knock-in mutant to perform a rescue. By restoring the expression of miR-210, we successfully corrected the evening anticipation in the miR-210KO (Fig 1A and 1B) under LD, which confirms that the phase advance is due to lack of miR-210. We also observed a partial but significant rescue of the phase in DD (S1 Fig).
Fig 1. Loss of miR-210 advances evening peak activity under LD and temperature cycles (TC).
(A) Upper panel: representative eduction profiles of fly locomotor activity under 12:12 LD cycle. Black represents the dark phase, while white represents the light phase. Eduction is analyzed based on average of 3 days LD. Lower panel: representative double plotted actograms of flies under LD and DD conditions. Grey shadow represents the dark phase, while white represents the light phase. Here the knocking-in miR-210 GAL4 (miR-210KO) was used to express UAS-miR210 for rescue. (B) Quantification of evening phase of flies under LD. Phase point is determined by the time differences between the peak of evening activity and light off time. Number of flies tested is listed in each bar. Error bars indicate Standard Error. **** = p<0.0001, determined by Student’s t test. (C) Representative eduction profiles of flies under 29°C: 21°C temperature cycles (TC) in DD. Blue represents 21°C for 12 hours, while red represents 29°C. (D) Quantification of evening phase of flies under TC. Error bars represent Standard Error. **** = p<0.0001 was determined by Student’s t test.
To examine whether miR-210 plays a role on evening anticipatory behavior under other entrainment conditions, we entrained the flies under 29°C: 21°C cycles (TC) in constant darkness. Under TC, the evening anticipation of wild-type flies exhibited an advance about 2.5 hours (Fig 1C and 1D) [45]. In miR-210KO, we still observed an additional 2 hrs phase advance compared to the controls (Fig 1C and 1D). Furthermore, we were able to rescue this behavior defect. After released into constant 21°C or 29°C in DD, the miR-210KO flies exhibited normal period and rhythmicity as wild-type controls (S2 Table). These data confirmed that miR-210 is a clear regulator of evening phase during different entrainment conditions.
The phase advance of evening anticipation in miR-210KO is reminiscent of the pdf mutant phenotype [11]. To test the genetic interaction of miR-210 and the PDF pathway, we generated miR-210KO; pdf01 double mutants. Under 12:12 LD conditions, the phase advance of the evening peak in miR-210KO was indistinguishable from the pdf01 mutants (S2 Fig). No additive effect on the phase advance was observed in the miR-210KO; pdf01 double mutants comparing with miR-210KO or pdf01 (S2A and S2B Fig). To observe the phenotype even more clearly, we tested these flies under long photoperiods with 16:8 LD cycle so that we avoid acute effects of the light-off transition on the shape of the evening peak. As observed in pdf01 mutant, miR-210KO advanced the phase of evening anticipation by about 2 hrs (S2C Fig). Again, no additive phase advance was observed in the miR-210KO; pdf01 double mutants (S2D Fig). These data suggest that miR-210 functions in the same pathway as PDF in regulation of evening phase under entrainment.
To further test the role of miR-210, we first overexpressed it in all circadian tissues using tim-GAL4 [46]. However, most of the flies with overexpression died rapidly after the LD cycles, which indicates that overexpression leads to severe health issues (Table 1). Thus, we then used the pdf-GAL4 to specifically drive miR-210 expression in PDF positive pacemaker neurons. The majority of flies (~63%) with miR-210 overexpression in PDF neurons became arrhythmic under DD. However, for the 37% rhythmic flies, the circadian period was lengthened about 2 hours. Thus, while loss of miR-210 has no effect on the period and amplitude of circadian rhythms in DD, overexpression is detrimental to the proper function of the circadian oscillator in PDF neurons.
Table 1. Locomotor activity of flies with altered miR-210 and Fas2 in DD.
Genotype | N | % Rhythmic | Period (hr) ± S.E.M. | Power# ± S.E.M |
---|---|---|---|---|
tim-GAL4/+; Pdf-GAL80/+ M tim-GAL4/+; Pdf-GAL80/ UAS-miR-210 M tim-GAL4/+ M tim-GAL4/UAS-miR-210 M Pdf-GAL4/+ M Pdf-Gal4/UAS-miR-210 M yw M yw F miR-210KO M miR-210KO F miR-210KO/+ F miR-210KO; UAS-miR-210 M Fas2ΔmiR-210 M Fas2ΔmiR-210 F Fas2ΔmiR-210/+ F miR-210KO/Fas2ΔmiR-210 F |
42 35 40 33 41 44 45 42 52 49 31 43 43 39 43 35 |
100.0±0.0 N/A* 96±2.3 N/A* 96.4±1.4 37.1±3.5 92.3±2.3 91.6±3.6 88.0±2.4 87.5±3.1 90.2±1.9 90.9±2.1 93.2±1.8 94.4±0.8 95.3±1.7 88.6±1.7 |
24.5±0.4 N/A* 24.1±0.3 N/A* 24.6±0.2 26.1±0.6 24.7±0.2 24.1±0.4 24.2±0.4 24.5±0.3 24.3±0.1 24.6±0.3 24.1±0.2 24.1±0.3 24.3±0.1 23.9±0.4 |
94.4±2.6 N/A* 97.2±2.5 N/A* 98.4±1.1 65.0±1.5 91.3±1.8 88.7±2.1 87.9±3.2 89.6±1.6 91.4±2.8 86.4±3.1 92.9±2.4 89.8±3.1 93.8±4.2 87.8±2.1 |
#Power is a measure of rhythm amplitude and corresponds to the height of the periodogram peak above the significance line.
*N/A, flies were all dead after entering the constant darkness.
The molecular pacemaker is intact in the miR-210KO flies
Since the period and rhythmicity of circadian rhythms are unaffected in miR-210KO flies under DD, it is likely that the molecular pacemaker of miR-210KO flies is still functional. To confirm this, we examined the oscillation of the key pacemaker protein PER in circadian neurons under DD. We focused on the PDF positive sLNvs, which are the master pacemaker neurons under constant conditions. As expected, we found no obvious changes in PER oscillation or abundance in these sLNvs (S3A and S3B Fig). We further examined PER levels in another two important groups of circadian neurons: LNds, and DN1s. Similar as in sLNvs, PER oscillation in these neurons were not affected either (S3C and S3D Fig). Since we observed the dramatic phase advance phenotype under LD, next we examined the PER oscillation at different times of day. Consistent with the DD results, there was no significant change of PER in the PDF positive sLNvs in miR-210KO flies (Fig 2A and 2B). Oscillation of PER was unaffected in LNds and DN1s either (S4 Fig). Because PDF is an important circadian output molecule, we also quantified the PDF abundance in sLNvs and found no significant differences in miR-210KO flies in sLNvs (Fig 2C). Since lLNvs have been identified in regulation of evening activity onset [47], we further examined the PDF abundance of lLNvs across different time of the day. No obvious changes of PDF abundance in lLNv were observed either (S5 Fig). Taken together, these data suggest that loss of miR-210 has no effects on the molecular clock. The phase advance phenotype is unlikely mediated through changes of PDF abundance.
Fig 2. The molecular pacemaker is intact in the miR-210KO mutants.
(A) Representative images of sLNvs in wild-type control and miR-210KO mutants. Fly brains were dissected at six time points (zeitgeber time, ZT) during the fourth day of LD and stained with anti-PDF (green) and anti-PER (red) antibodies. Scale bar is 10 μm. (B) Quantification of PER staining in sLNv. No significant changes in PER level or cycling were found in miR-210KO. Error bars indicate SEM. (C) Quantification of PDF levels in sLNv. At least twelve brains were quantified. Error bars indicate SEM.
Loss of miR-210 disrupts the circadian arborization rhythms of sLNv dorsal projections
Although genetic interaction between miR-210 and the PDF pathway was identified (S1 Fig), we observed no significant changes in PDF abundance in the flies missing miR-210 (Fig 2C and S5C Fig). Thus, we decided to examine the PDF projections of the sLNvs. Circadian arborization rhythms of the dorsal projections of sLNvs have been previously observed [14, 15]. To determine whether miR-210 affects the arborization rhythms of sLNv projections, we used a PDF-specific antibody to examine the termini of sLNv dorsal projections in miR-210KO flies at early day (Zeitgeber time 2 (ZT2), ZT0 is light on and ZT12 is light off) and early night (ZT14). We found that the wild-type flies had more PDF positive branches of axon terminals at ZT2 than at ZT14 (Fig 3A), as previously observed [15]. Remarkably, this arborization rhythm was abolished in the miR-210KO flies (Fig 3A). We quantified the dorsal axon arborization using the method as previously described (see Material and Methods) [16] and confirmed that the lack of aborization rhythm in miR-210KO is mainly due to the significant decrease of axonal crosses at ZT2 compared to control flies (Fig 3B). Furthermore, restoration of miR-210 expression rescued the arborization rhythm in miR-210KO mutants (Fig 3A and 3B). Since we found there were no significant changes of PDF abundance in the sLNv soma, these data indicate that the decrease of axonal branches was not due to the decrease of PDF staining (Fig 2 and Fig 3). Together, these results indicate that miR-210 is required for the circadian arborization rhythms in the sLNv dorsal projections.
Fig 3. Loss of miR-210 disrupts the circadian arborization rhythms of sLNv dorsal projections.
(A) Representative confocal images of sLNv dorsal axonal projections. The brains were stained with anti-PDF antibody (green) at ZT2 and ZT14 at the 3rd day of LD. Scale bar is 10 μm. (B) Quantification of axonal morphology (fasciculation) of sLNv dorsal termini. Axonal termini defasciculation of sLNv neurons were quantified based on a modified Sholl's analysis. The plot represents number of crosses between axonal branches and concentric rings. Plots show mean values, error bars indicate Standard error. *** represents p-value < 0.001, **** represents < 0.0001 by Student’s t test. ns represents not significant.
miR-210 controls the phase of evening peak by targeting Fas2
miRNAs play negative posttranscriptional functions through binding to the 3’ untranslated regions (UTRs) of target mRNAs [31]. After searching putative miR-210 targets by using an in silico prediction algorithm (http://www.targetscan.org/fly_12/), we identified Fas2 as one of the potential targets (Fig 4A). The putative miR-210 binding sites within the 3’UTR of Fas2 are highly conserved across most Drosophila species (Fig 4A). Interestingly, Sivachenko et al. have reported that overexpression of Fas2 in the PDF neurons caused fasciculation of sLNv dorsal projections and disrupted arborization rhythms [15]. Since miRNAs are normally negative regulators of target genes, and overexpression of Fas2 recapitulated the anatomical phenotype of miR-210KO flies, we decided to use the CRISPR-Cas9 system to delete the miR-210 binding site within the Fas2 3’UTR. As the seed region of miRNAs (positions 2–7) is critical for miRNA function [48], to minimize potential off-target effects, we managed to delete only 7 bps of the matching sequence on the 3’UTR (Fig 4B). We recovered several lines, which were homozygous viable, and named the mutant as Fas2ΔmiR-210.
Fig 4. Depletion of putative miR-210 binding sites within 3’UTR of Fas2 phenocopies miR-210KO.
(A) Predicted miR-210 binding site in the 3’UTR of Fas2 is highly conserved across Drosophila species. Blue letters indicate conserved sequences matching the 2–7 (seed) sequence of miR-210. The Drosophila species used for comparison were Dme, D. melanogaster, Dsi, D. simulans, Dse, D. secellia, Dya, D. yakuba, Dki, D. kikkawai, Dpe, D. persimilis, Dps, D. pseudoobscura, Dwi, D. willistoni, Dvi, D. virilis, Dmo, D. mojavensis, and Dal, D. albomicans. (B) Confirmation of CRISPR/Cas9 mediated deletion of the 7bp from Fas2 3’UTR through Sanger sequencing. Blue arrow indicates the place that deletion started. (C) Representative eduction profiles of locomotor activity under 12:12 LD conditions. Since both miR-210 and Fas2 are located on the X chromosome, females were used in the upper panel for genetic interactions in transheterozygous. Lower panel shows male controls and miR-210KO, Fas2ΔmiR-210 double mutant flies. (D) Quantification of phase of evening peak. Error bars indicate Standard Error. **** = p<0.0001, determined by Student’s t test. ns represents not significant.
Next we tested the circadian locomotor behavior of the Fas2ΔmiR-210. There was no change in period or rhythmicity under DD (Table 1). However, the Fas2ΔmiR-210 flies clearly advanced the phase of evening activity, similar to miR-210KO flies (Fig 4C and 4D). To determine whether Fas2 and miR-210 function in the same pathway, we tested the potential genetic interactions using two methods. First, we tested the miR-210KO/ Fas2ΔmiR-210 transheterzygous flies. While both miR-210KO and Fas2ΔmiR-210 are recessive mutations, the transheterzygous flies had a strikingly similar phase advance phenotype as single mutants (Fig 4C and 4D). Second, we examined the double mutant of miR-210KO, Fas2ΔmiR-210 flies. Under LD, the miR-210KO, Fas2ΔmiR-210 flies exhibited a similar phase advance phenotype, which is insignificant from either miR-210KO or Fas2ΔmiR-210 (Fig 4C and 4D). This data indicated that miR-210 and Fas2 function in the same pathway regulating circadian phase of activity. Taken together, Fas2 genetically interacts with miR-210, and ablation of the miR-210 binding sites within the 3’UTR of Fas2 recapitulated the behavior phenotypes of miR-210KO mutants. These results indicate that Fas2 is a functional target of miR-210.
miR-210 regulates circadian rhythms through inhibition of Fas2 in the optic lobe
To identify the cellular mechanism of miR-210 functions, we first characterized the miR-210 expression pattern in the fly brain by using the miR-210 knock-in Gal4 to drive GFP as a reporter. We observed GFP signals in the optic lobe, Hofbauer-Buchner eyelet (H-B eyelet), as well as several other brain regions, including the mushroom bodies and antennal lobe (Fig 5A). To our surprise, no GFP signal was detected in LNvs as labeled by anti-PDF antibody staining. Then we examined Fas2 expression using the commercial antibody (1D4) from DSHB. As previously reported, in wild type flies Fas2 was strongly expressed in the mushroom bodies as well as the ellipsoid bodies (Fig 5B) [49]. Interestingly, we detected an intensive Fas2 signal in the optic lobe of miR-210KO mutant flies, which disappeared when miR-210 expression was rescued (Fig 5B). We quantified Fas2 abundance in the optic lobe and observed significant increase of Fas2 in miR-210KO mutants compared to the wild-type and rescue (Fig 5C and 5D). Lastly, we wondered whether the increase of Fas2 abundance occurs at the same sites where miR-210 is expressed. While female heterozygous miR-210KO flies exhibited no detectable Fas2 in the optic lobe, dramatic increase of Fas2 signal clearly overlapped with miR-210 expression in the optic lobe (Fig 4E).
Fig 5. Fas2 abundance is elevated in the optic lobe of miR-210KO flies.
(A) Representative image showing miR-210 expression profile in fly brain. Green signal represents miR-210 expression (driven by miR-210KO Gal4), while red indicates PDF. OL, AL, H-B eyelet, and MB represents optic lobe, antennal lobe, Hofbauer-Buchner eyelet, and mushroom bodies, respectively. White arrows indicates the MB and H-B eyelet. (B) Representative confocal images for Fas2 staining in fly brains. Note that Fas2 abundance was elevated in the optic lobes of miR-210KO and normal in rescue flies. Scale bar is 100 μm in A-B. (C) Schematic representing area luminance analysis for quantification of relative Fas2 level in the optic lobe. Quantification is based on measure of the Fas2 signal in the optic lobe (same size, dash lines) and subtraction of brain region next to it (small dash line circle). (D) Quantification of Fas2 in the optic lobe per square μm. Error bars indicate Standard Error. **** = p<0.0001, determined by Student’s t test. (E) Loss of miR-210 increases Fas2 levels in the cells where miR-210 was expressed. Fly brains stained with anti-GFP (green) and Fas2 (red). Upper panel is female heterozygous flies expressing CD8-GFP. Lower panel shows the Fas2 expression increased in the optic lobes of male mutant flies. Scale bar is 100 μm.
Although we did not detect miR-210 expression in circadian neurons with the miR-210 knock-in Gal4, the single cell RT-PCR data from Chen and Rosbash indicated that miR-210 has an oscillating expression in the sLNvs [50]. Thus, we first tested the requirement of miR-210 in the sLNvs for normal circadian behavioral rhythms under LD, combining miR-210KO GAL4 and Pdf-GAL80. GAL80 is a repressor of GAL4 function, and Pdf-GAL80 has been efficiently used to inhibit gene expression in the PDF neurons [7, 51]. Surprisingly, we observed a clear rescue of evening phase when we excluded miR-210 expression in the sLNvs, which suggests that miR-210 is not necessary in PDF neurons for circadian behavior (Fig 6A and 6B). Next, we tested whether overexpression of Fas2 in the miR-210-expression cells would mimic the behavior phenotype of miR-210KO mutants using the miR-210KO GAL4. While heterozygous miR-210KO mutant has no phase advance, we observed a weaker (~1.5 hr) but significant advance of evening peak in Fas2 overexpression (Fig 6C and 6D). Consistent with the miR-210 data, Fas2 is not required in the PDF positive neurons (Fig 6C and 6D). Since increase of Fas2 in the optic lobe was observed in the miR-210KO mutants, we tested whether up-regulation of Fas2 is responsible for the phase advance phenotype. When we used GMR-GAL80 to block Fas2 expression in the photoreceptors, the advance of evening phase was rescued (Fig 6C and 6D). Together these data suggest that inhibition of Fas2 by miR-210 in the optic lobe is critical for the timing of evening activity.
Fig 6. miR-210 is required in the optic lobe for controlling the phase of evening behavior.
(A) Representative eduction profiles of flies under 12:12 LD cycle. miR-210 expression in PDF negative cells is sufficient to rescue the phase advance in evening peaks. (B) Quantification of evening phase in A. (C) Overexpression of Fas2 in miR-210 expressing non-photoreceptor cells did not advance the phase of evening peaks. Upper panel shows overexpression of Fas2 in miR-210 cells advanced the evening phase. Middle panel shows blocking Fas2 expression in the PDF cells still advanced the phase. Female flies were used in this figure C. (D) Quantification of evening phase in C. Error bars indicate Standard Error. ns represents not significant. *** = p<0.001, **** = p<0.0001 was determined by Student’s t test.
Discussion
Emerging roles of miRNA in the control of different aspects of circadian rhythms have been recently uncovered [33]. Here, we screen Drosophila miRNA mutants and demonstrate that miR-210 is critical for circadian locomotor rhythms. miR-210 determines the proper phase of evening activity peak under entrainment. miR-210 plays its role in circadian rhythms and axonal arborization via repression of Fas2.
Drosophila gradually increases its locomotor behavior and reaches its peak of evening activity at light off. The molecular mechanism underlying the phase control of evening peak is still largely unknown. Loss of miR-210 advanced the evening phase to the same extent as pdf01 mutants. Beside PDF, other neuropeptides such as ITP and NPF also play roles in regulation of evening peak. Downregulation of ITP in circadian neurons has weak effects on evening phase and also prolongs circadian period under constant darkness [52]. While ablation of NPF positive circadian neurons advances the phasing of evening activity, it also affects period during free running [53]. These phenotypes are inconsistent with what we observed in miR-210KO mutants (Table 1). In fact, our genetic interaction data suggests that miR-210 functions in the same signaling pathway as PDF. So we decided to focus on PDF pathway. However, unlike the pdf01 mutants [11], loss of miR-210 has little effect on period and circadian rhythmicity. These results indicate that miR-210 may specifically regulate one aspect of PDF signaling functions.
Circadian structural plasticity of sLNv dorsal projections has been recently identified [54, 55]. The biological function and molecular mechanisms underlying the structural plasticity however remain elusive. Here we identified that miR-210KO mutants disrupted the axonal arborization rhythms of sLNv, which is likely through inhibition of the neural cell adhesion molecule Fas2. Deletion of the 7-bp seed region of miR-210 binding sites within the 3’UTR of Fas2 mimics the effect of miR-210KO mutants on the sLNv arborization rhythm. However it seems unlikely that the phase advanced phenotype of miR-210KO mutants is because of the defects in sLNv arborization rhythms. First, as far as we know, previous genetic manipulations that cause severe defects on sLNv structural plasticity have no effect on evening phase [54, 55]. Second, although overexpression or down regulation of Fas2 in the sLNv abolished the arborization rhythms, it does not affect the evening phase either [16]. So we conclude that these effects of miR-210 on evening phase control and axonal structural plasticity may not be functionally related.
Our evidence that Fas2 is a key target for miR-210 in regulation of circadian rhythms is particularly strong. First, miR-210KO mutants elevated the Fas2 abundance in the optic lobe, where miR-210 is highly expressed. This is consistent with the general role of miRNAs as negative regulators of target proteins. Second, Fas2ΔmiR-210 recapitulates the arborization and circadian behavior phenotypes of loss of miR-210. Furthermore, our genetic interaction data also indicates that Fas2 and miR-210 function in the same pathway.
In which cells are miR-210 and Fas2 required for the evening phase of activity? Transcriptome profiling from the Rosbash lab show that expressions of both miR-210 and Fas2 are enriched and oscillating in the PDF positive neurons [50]. Overexpressing miR-210 in the PDF neurons causes flies to become arrhythmic or rhythmic with a prolonged circadian period (Table 1). However, using miR-210 knock-in GAL4 or Fas2 antibodies, we were not able to detect obvious signals for miR-210 or Fas2 in the PDF neurons. We cannot exclude the possibility that there is weak amount of miR-210 or Fas2 protein expression, which is not detectable due to sensitivity of the techniques we used. We sought to answer this question by utilizing the well-used Pdf-GAL80 repressor. Indeed, restoring miR-210 in its endogenous expressing cells except PDF neurons rescued the circadian behavior completely. This data indicates that expression of miR-210 in the PDF neurons is not necessary for its circadian function. Consistent with this notion, overexpression of Fas2 in PDF negative but miR-210 expressing cells causes a phase advance of evening peak. Since the miR-210 knock-in driver has no detectable expression in the PDF neurons, leaky expression due to potential weak suppression of Pdf-GAL80 should not be an alternative explanation. The H-B eyelets interact with lLNvs and control the phase of evening peak activity [47, 56]. Interestingly, miR-210 exhibits strong signals of expression in the H-B eyelets (Fig 5A). We labeled H-B eyelets in miR-210KO or Fas2ΔmiR-210 by expressing GFP in the Rh6-Gal4 (S6 Fig). In wild-type flies, H-B eyelet axons projected close to the LNvs as previously described [47]. We did not observe obvious defects of H-B eyelet in these two mutants (S6 Fig). However, we cannot exclude the possibility that miR-210KO or Fas2ΔmiR-210 mutants disrupt the communication between H-B eyelets and lLNv, thus affect the evening activity.
Our data suggest that inhibition of Fas2 by miR-210 in the optic lobe is critical for the proper evening phase. How does miR-210-Fas2 expression in the optic lobe control the phase? One possibility is that Fas2 expression in the optic lobe may affect the phase through PDF signaling in the lLNv. If that’s the case, Fas2 abundance in the optic lobe may show differences at different time points. Thus we examined the Fas2 abundance across different time of the day in the optic lobe (S7A Fig). High amount of Fas2 was observed in the miR-210KO compared to the wild-type, however, no oscillation was identified in either genotype (S7B Fig). This result is consistent with the fact that we did not observe changes of PDF in lLNv (S6 Fig). So it is unlikely that miR-210-Fas2 affect the evening phase through changes of PDF level in the ILNv. However, we cannot exclude the possibility that it may modulate PDF-receptor signaling or other pathways. It is worth to mention that during the preparation of this paper, another independent study also characterizes the role of miR-210 in phase control of circadian behavior and reached similar conclusion with us on the circadian behavior and dorsal aborization phenotype [57]. Even though no specific target was functionally validated, it is possible that some of the pathways identified in that paper may also contribute to the phase control phenotypes in the miR-210KO.
Here we identify that miR-210 regulates circadian locomotor rhythms and axonal structural plasticity of pacemaker neurons in Drosophila. A similar mechanism may exist in mammals. Interestingly, the glutamatergic synapses on the VIP neurons of mammalian master circadian pacemaker suprachiasmatic nucleus (SCN) also show circadian structural plasticity, which maybe important for light entrainment in mice. miR-210 is a highly conserved miRNA from worms, flies, to humans. In silico miRNA target prediction with targetscan identified a highly conserved binding site of human miR-210 in the 3’UTR of vertebrates brain-derived neurotrophic factor (BDNF). BDNF has well-established functions in axonal branching and synaptic plasticity [58, 59]. Thus, it is worthwhile to test that whether miR-210 plays conserved functions in structural plasticity in mammals.
Material and methods
(A) Fly stocks
All the flies were raised on standard cornmeal/agar medium at 25°C under 12:12 hour LD cycle. The following strains were used in this study: w1118, yw, pdf01, y w; tim-GAL4/CyO [46], PDF-Gal80, y w; Pdf-GAL4/CyO [7], UAS-miR-210, UAS-Fas2, miR-210KO [44], UAS-CD8-GFP (BL5137), GMR-Gal80 [60], Rh6-GAL4 (BL7464), Fas2ΔmiR-210 (generated by CRISPR-Cas9 in our lab).
Behavioral experiments and analysis
Most of the times, adult male flies (2–5 days old) were used to test locomotor activity rhythms. Since both miR-210 and Fas2 are both on the x chromosome, adult female flies were also used for locomotor rhythms, which were mentioned in the relevant figures. Flies were entrained for 4 days LD cycle at 25°C and 60% humidity, and released into constant darkness (DD) at 25°C for at least 5 days. Temperature cycles were performed with 12h:12h 29C:21C cycling for 6d in complete darkness. Trikinetics Drosophila activity monitors were used to record locomotor activity in I36-LL Percival incubators. Activity rhythms were analyzed with Faasx software protocol [61]. Eduction profiles were generated with 3d of LD activity. FAAS-X software was used to analyze behavioral data [60]. Actograms were generated with a signal-processing toolbox for MATLAB. The evening anticipation amplitude was determined by assaying for the locomotor activity as described.
Immunohistochemistry and quantification
Immunohistochemistry was performed with whole Drosophila brains. For staining involving ZT timepoints, Flies were entrained to LD for 3 d and dissected at Zeitgeber time (ZT) 0, 2, or 14. For CT staining, flies were entrained to LD, released to DD, and dissected on the second day of DD at 6 CT intervals. Mouse anti-Fas2 (1:100), mouse anti-PDF (1:400), Rabbit anti-GFP 1:200, Rabbit anti-PER (1:1500) was used. All brains were imaged with a leica confocal microscope. Microscope laser settings were held constant for each experiment. ImageJ was used for quantification of PER, PDF and FAS 2 luminance. At least 5 brains were used for quantification. ImageJ was used in the analysis of axonal morphology (fasciculation) of sLNv dorsal termini by a modified Sholl's analysis [56].
Design of CRISPR mediated deletion and screening of Fas2 3’UTR deletions
Fas2ΔmiR-210 flies were generated by CRISPR mediated deletion by Rainbow Transgenic Flies. The guide RNA target sequence for CRISPR was GCAATGTGCACAAAACGATGAGG. The primers used for genomic miR-210 f3: GCCAACAGGCAGCATCAAAC, and miR-210 r3: CCAACTTAGTGTGCCAATCGATC. PCR amplification of the Fas2 3’ UTR region containing the miR-210 motif was performed by using miR-210 f3 and miR-210 r3 primers. Sequencing of the PCR products was performed by using the miR-210 f3 primer. Identification of homozygous Fas2ΔmiR-210 flies was confirmed by observing a 7bp deletion at the miR-210 binding motif in the sequence chromatograph.
Supporting information
(A) Locomoter behavior profile in DD. Time of circadian peak activity is shown on the graph. The number 0 and 12 shows CT (circadian time). Gray indicates the subjective night. (B) Quantification of the time of peak activity in DD. * = p<0.05, **** = p<0.0001, determined by Student’s t test.
(PDF)
(A) Representative eduction profiles of fly locomotor activity under 12:12 LD cycle. Black represents the dark phase, while white represents the light phase. Eduction is analyzed based on average of 3 days LD. (B) Quantification of evening phase of flies under LD. Number of flies tested is listed in each bar. (C) Representative eduction profiles under 16:8 LD cycle. (D) Quantification of evening phase of flies under 16:8 LD. Number of flies tested is listed in each bar. Error bars indicate Standard Error. **** = p<0.0001, determined by Student’s t test.
(PDF)
(A) Representative images of sLNvs in wild-type control and miR-210KO mutants. Fly brains were dissected at six time points (circadian time, CT) during the second day of DD and stained with anti-PDF (green) and anti-PER (red) antibodies. Scale bar is 10 μm. (B) Quantification of PER staining in sLNv. No significant changes in PER level or cycling. Error bars indicate SEM. (C) Quantification of PER levels in DN1. (D) Quantification of PER levels in LNd. Error bars indicate SEM.
(PDF)
(A-B) Representative images of DN1 (A) and LNd (B). Fly brains were dissected and stained same as Fig 2. Scale bar is 10 μm. (C-D) Quantification of PER staining in DN1 (C) and LNd (D). Error bars indicate SEM. ns = no significance, determined by Student’s t test.
(PDF)
(A) Representative images of lLNv in wild-type and miR-210KO mutant fly brain. Flies were dissected at six time points on the 4th day of LD and brains were stained same as Fig 2. Scale bar is 20 μm. (B) Quantification of PER staining in ILNv. (C) Quantification of PDF staining in ILNv. At least 12 brains were quantified.
(PDF)
Upper panel shows the whole brain staining of PDF (red) and GFP (green) in wild-type, miR-210KO, and Fas2ΔmiR-210 mutants. Lower panel shows the enlarged image of the optic lobe and LNv region. Rh6-Gal4 is used here as a marker for the H-B eyelet. Six pointed white stars indicate the H-B eyelet terminal in fly brain.
(PDF)
(A) Representative images of fly brains at different time points under LD. Flies were entrained under LD cycles and brains were dissected at the 4th day in LD. Red, Fas2 staining, green, GFP. Rh6-Gal4 was used to label R8 positive photoreceptors and H-B eyelet. Note the increase of Fas2 is found in the optic lobe of miR-210KO at all six time points. Scale bar is 10 μm. (B) Quantification of Fas2 in the optic lobe of wild-type and miR-210KO. Fas2 is constantly higher in the miR-210KO mutant but does not show an oscillation. Fas2 abundance is quantified as Fig 5C.
(PDF)
The flybase number of the lines used here are: 58880 (mir-10), 58885 (mir-1007), 58888 (mir-1014), 58889 (mir-1017), 58890 (mir-11), 58892 (mir-133), 58894 (mir-13b-2), 58896 (mir-184), 58898 (mir-193), 58899 (mir-210), 58900 (mir-219), 58904 (mir-274), 58908 (mir-277-34), 58909 (mir-278), 58910 (mir-281-1-281-2), 58911 (mir-282), 58912 (mir-283), 58913 (mir-284), 58914 (mir-285), 58915 (mir-2b-1), 58916 (mir-2c-13a-1), 58917 (mir-303), 58924 (mir-314), 58926 (mir-317), 58928 (mir-31a), 58929 (mir-31b), 58930 (mir-33), 58892 (mir-133), 58935 (mir-927), 58937 (mir-92a), 58939 (mir-932), 58940 (mir-955), 58942 (mir-957), 58943 (mir-958), 58948 (mir-967), 58949 (mir-968-1002), 58952 (mir-971), 58953 (mir-971-972-973), 58954 (mir-975-976-977), 58959 (mir-986), 58960 (mir-987), 58961 (mir-988), 58962 (mir-989), 58963 (mir-990), 58966 (mir-999), 58960 (mir-987), 58967 (mir-9c).
(DOCX)
(DOCX)
Acknowledgments
We thank members of the Zhang lab for technical supports and discussions. We thank Dr. Patrick Emery and Dr. Junhai Han for carefully reading the manuscript and suggestions. We thank Dr. Michael Rosbash and Dr. Travis Thomson for the UAS-Fas2 fly strains. Pdf-Gal80, GMR-Gal80 and pdf01 flies are generous gifts from Dr. Patrick Emery. We also thank Dr. Ralf Stanewsky for the anti-PER antibodies. We thank the Bloomington stock Center for various fly stocks, including miR-210KO, UAS-miR-210, Rh1-Gal4, MB-Gal4. We also thank the Developmental Studies Hybridoma Bank for PDF antibodies. We thank the Cellular and Molecular Imaging Core facility.
Data Availability
The numerical data and summary statistics are available for download at GitHub (https://github.com/yongzhangclock/miR-210). All other data are within the manuscript and its Supporting Information files.
Funding Statement
YZ's work is supported by National Institutes of Health COBRE Grant P20 GM103650. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Beckwith EJ, Ceriani MF. Experimental Assessment of the Network Properties of the Drosophila Circadian Clock. J Comp Neurol. 2015;523(6):982–96. WOS:000350002000008. 10.1002/cne.23728 [DOI] [PubMed] [Google Scholar]
- 2.Dubowy C, Sehgal A. Circadian Rhythms and Sleep in Drosophila melanogaster. Genetics. 2017;205(4):1373–97. WOS:000401126600003. 10.1534/genetics.115.185157 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Johard HAD, Yoishii T, Dircksen H, Cusumano P, Rouyer F, Helfrich-Forster C, et al. Peptidergic Clock Neurons in Drosophila: Ion Transport Peptide and Short Neuropeptide F in Subsets of Dorsal and Ventral Lateral Neurons. J Comp Neurol. 2009;516(1):59–73. WOS:000268120300005. 10.1002/cne.22099 [DOI] [PubMed] [Google Scholar]
- 4.Nitabach MN, Taghert PH. Organization of the Drosophila circadian control circuit. Curr Biol. 2008;18(2):R84–R93. WOS:000252693900023. 10.1016/j.cub.2007.11.061 [DOI] [PubMed] [Google Scholar]
- 5.Pittendrigh CS, Daan S. A functional analysis of circadian pacemakers in nocturnal rodents. Journal of comparative physiology. 1976;106(3):333–55. 10.1007/bf01417860 [DOI] [Google Scholar]
- 6.Grima B, Chelot E, Xia R, Rouyer F. Morning and evening peaks of activity rely on different clock neurons of the Drosophila brain. Nature. 2004;431(7010):869–73. 10.1038/nature02935 . [DOI] [PubMed] [Google Scholar]
- 7.Stoleru D, Peng Y, Agosto J, Rosbash M. Coupled oscillators control morning and evening locomotor behaviour of Drosophila. Nature. 2004;431(7010):862–8. 10.1038/nature02926 . [DOI] [PubMed] [Google Scholar]
- 8.Guo F, Yu JW, Jung HJ, Abruzzi KC, Luo WF, Riffith LCG, et al. Circadian neuron feedback controls the Drosophila sleep-activity profile. Nature. 2016;536(7616):292–+. WOS:000381804900027. 10.1038/nature19097 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhang Y, Liu YX, Bilodeau-Wentworth D, Hardin PE, Emery P. Light and Temperature Control the Contribution of Specific DN1 Neurons to Drosophila Circadian Behavior. Curr Biol. 2010;20(7):600–5. WOS:000276753100022. 10.1016/j.cub.2010.02.044 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Yadlapalli S, Jiang C, Bahle A, Reddy P, Eyhofer EM, Shafer OT. Circadian clock neurons constantly monitor environmental temperature to set sleep timing. Nature. 2018;555(7694):98–+. WOS:000426247600039. 10.1038/nature25740 [DOI] [PubMed] [Google Scholar]
- 11.Renn SCP, Park JH, Rosbash M, Hall JC, Taghert PH. A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila. Cell. 1999;99(7):791–802. WOS:000084488200012. 10.1016/s0092-8674(00)81676-1 [DOI] [PubMed] [Google Scholar]
- 12.Helfrichforster C. The Period Clock Gene Is Expressed in Central-Nervous-System Neurons Which Also Produce a Neuropeptide That Reveals the Projections of Circadian Pacemaker Cells within the Brain of Drosophila-Melanogaster. P Natl Acad Sci USA. 1995;92(2):612–6. WOS:A1995QC87400058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Helfrichforster C, Homberg U. Pigment-Dispersing Hormone-Immunoreactive Neurons in the Nervous-System of Wild-Type Drosophila-Melanogaster and of Several Mutants with Altered Circadian Rhythmicity. J Comp Neurol. 1993;337(2):177–90. WOS:A1993ME05200001. 10.1002/cne.903370202 [DOI] [PubMed] [Google Scholar]
- 14.Fernandez MP, Berni J, Ceriani MF. Circadian remodeling of neuronal circuits involved in rhythmic behavior. Plos Biol. 2008;6(3):518–24. WOS:000254928600014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Petsakou A, Sapsis TP, Blau J. Circadian rhythms in Rho1 activity regulate neuronal plastivity and network hierarchy. Cell. 2015;162(4):823–35. 10.1016/j.cell.2015.07.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Sivachenko A, Li Y, Abruzzi KC, Rosbash M. The Transcription Factor Mef2 Links the Drosophila Core Clock to Fas2, Neuronal Morphology, and Circadian Behavior. Neuron. 2013;79(2):281–92. WOS:000322426200008. 10.1016/j.neuron.2013.05.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Depetris-Chauvin A, Fernandez-Gamba A, Gorostiza EA, Herrero A, Castano EM, Ceriani MF. Mmp1 Processing of the PDF Neuropeptide Regulates Circadian Structural Plasticity of Pacemaker Neurons. Plos Genet. 2014;10(10). WOS:000344650700063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gunawardhana KL, Hardin PE. VRILLE Controls PDF Neuropeptide Accumulation and Arborization Rhythms in Small Ventrolateral Neurons to Drive Rhythmic Behavior in Drosophila. Curr Biol. 2017;27(22):3442–+. WOS:000415815800022. 10.1016/j.cub.2017.10.010 [DOI] [PubMed] [Google Scholar]
- 19.Zhang EE, Kay SA. Clocks not winding down: unravelling circadian networks. Nature Reviews Molecular Cell Biology. 2010;11:764 10.1038/nrm2995 [DOI] [PubMed] [Google Scholar]
- 20.Crane BR, Young MW. Interactive Features of Proteins Composing Eukaryotic Circadian Clocks. Annu Rev Biochem. 2014;83:191–219. WOS:000348432500009. 10.1146/annurev-biochem-060713-035644 [DOI] [PubMed] [Google Scholar]
- 21.Hardin PE, Panda S. Circadian timekeeping and output mechanisms in animals. Curr Opin Neurobiol. 2013;23(5):724–31. WOS:000330326700002. 10.1016/j.conb.2013.02.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Tataroglu O, Emery P. The molecular ticks of the Drosophila circadian clock. Curr Opin Insect Sci. 2015;7:51–7. WOS:000369016700010. 10.1016/j.cois.2015.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Allada R, White NE, So WV, Hall JC, Rosbash M. A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless. Cell. 1998;93(5):791–804. WOS:000073956700015. 10.1016/s0092-8674(00)81440-3 [DOI] [PubMed] [Google Scholar]
- 24.Rutila JE, Suri V, Le M, So WV, Rosbash M, Hall JC. CYCLE is a second bHLH-PAS clock protein essential for circadian rhythmicity and transcription of Drosophila period and timeless. Cell. 1998;93(5):805–14. 10.1016/s0092-8674(00)81441-5 . [DOI] [PubMed] [Google Scholar]
- 25.Chiu JC, Ko HW, Edery I. NEMO/NLK Phosphorylates PERIOD to Initiate a Time-Delay Phosphorylation Circuit that Sets Circadian Clock Speed. Cell. 2011;145(3):357–70. WOS:000290022900006. 10.1016/j.cell.2011.04.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Grima B, Dognon A, Lamouroux A, Chelot E, Rouyer F. CULLIN-3 Controls TIMELESS Oscillations in the Drosophila Circadian Clock. Plos Biol. 2012;10(8). WOS:000308501400001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim EY, Jeong EH, Park S, Jeong HJ, Edery I, Cho JW. A role for O-GlcNAcylation in setting circadian clock speed. Gene Dev. 2012;26(5):490–502. WOS:000301196100008. 10.1101/gad.182378.111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ko HW, Jiang J, Edery I. Role for Slimb in the degradation of Drosophila Period protein phosphorylated by Doubletime. Nature. 2002;420(6916):673–8. WOS:000179751800047. 10.1038/nature01272 [DOI] [PubMed] [Google Scholar]
- 29.Kojima S, Shingle DL, Green CB. Post-transcriptional control of circadian rhythms. J Cell Sci. 2011;124(Pt 3):311–20. 10.1242/jcs.065771 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Lim C, Allada R. Emerging roles for post-transcriptional regulation in circadian clocks. Nat Neurosci. 2013;16(11):1544–50. 10.1038/nn.3543 . [DOI] [PubMed] [Google Scholar]
- 31.Mendoza-Viveros L, Bouchard-Cannon P, Hegazi S, Cheng AH, Pastore S, Cheng HM. Molecular modulators of the circadian clock: lessons from flies and mice. Cell Mol Life Sci. 2017;74(6):1035–59. 10.1007/s00018-016-2378-8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–97. WOS:000188541700017. 10.1016/s0092-8674(04)00045-5 [DOI] [PubMed] [Google Scholar]
- 33.Kadener S, Menet JS, Sugino K, Horwich MD, Weissbein U, Nawathean P, et al. A role for microRNAs in the Drosophila circadian clock. Gene Dev. 2009;23(18):2179–91. WOS:000269832600007. 10.1101/gad.1819509 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Xue YB, Zhang Y. Emerging roles for microRNA in the regulation of Drosophila circadian clock. Bmc Neurosci. 2018;19. WOS:000423118700001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zhang Y, Emery P. GW182 Controls Drosophila Circadian Behavior and PDF-Receptor Signaling. Neuron. 2013;78(1):152–65. WOS:000317556000014. 10.1016/j.neuron.2013.01.035 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mendoza-Viveros L, Chiang CK, Ong JLK, Hegazi S, Cheng AH, Bouchard-Cannon P, et al. miR-132/212 Modulates Seasonal Adaptation and Dendritic Morphology of the Central Circadian Clock. Cell Rep. 2017;19(3):505–20. WOS:000401133100008. 10.1016/j.celrep.2017.03.057 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Yoo SH, Kojima S, Shimomura K, Koike N, Buhr ED, Furukawa T, et al. Period2 3 '-UTR and microRNA-24 regulate circadian rhythms by repressing PERIOD2 protein accumulation. P Natl Acad Sci USA. 2017;114(42):E8855–E64. WOS:000413237900012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Chen WF, Liu ZX, Li TJ, Zhang RF, Xue YB, Zhong Y, et al. Regulation of Drosophila circadian rhythms by miRNA let-7 is mediated by a regulatory cycle. Nat Commun. 2014;5. WOS:000345913600013. [DOI] [PubMed] [Google Scholar]
- 39.Chen X, Rosbash M. mir-276a strengthens Drosophila circadian rhythms by regulating timeless expression. P Natl Acad Sci USA. 2016;113(21):E2965–E72. WOS:000376779900014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Luo WY, Sehgal A. Regulation of Circadian Behavioral Output via a MicroRNA-JAK/STAT Circuit. Cell. 2012;148(4):765–79. WOS:000300622400017. 10.1016/j.cell.2011.12.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Vodala S, Pescatore S, Rodriguez J, Buescher M, Chen YW, Weng RF, et al. The Oscillating miRNA 959–964 Cluster Impacts Drosophila Feeding Time and Other Circadian Outputs. Cell Metab. 2012;16(5):601–12. WOS:000311765700009. 10.1016/j.cmet.2012.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Garaulet DL, Sun KL, Li WH, Wen JY, Panzarino AM, O'Neil JL, et al. miR-124 Regulates Diverse Aspects of Rhythmic Behavior in Drosophila. J Neurosci. 2016;36(12):3414–21. WOS:000372747100004. 10.1523/JNEUROSCI.3287-15.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Zhang Y, Lamba P, Guo PY, Emery P. miR-124 Regulates the Phase of Drosophila Circadian Locomotor Behavior. J Neurosci. 2016;36(6):2007–13. WOS:000369964500020. 10.1523/JNEUROSCI.3286-15.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Chen YW, Song S, Weng R, Verma P, Kugler JM, Buescher M, et al. Systematic study of Drosophila microRNA functions using a collection of targeted knockout mutations. Dev Cell. 2014;31(6):784–800. 10.1016/j.devcel.2014.11.029 . [DOI] [PubMed] [Google Scholar]
- 45.Glaser FT, Stanewsky R. Synchronization of the Drosophila circadian clock by temperature cycles. Cold Spring Harb Symp Quant Biol. 2007;72:233–42. 10.1101/sqb.2007.72.046 . [DOI] [PubMed] [Google Scholar]
- 46.Kaneko M, Park JH, Cheng Y, Hardin PE, Hall JC. Disruption of synaptic transmission or clock-gene-product oscillations in circadian pacemaker cells of Drosophila cause abnormal behavioral rhythms. J Neurobiol. 2000;43(3):207–33. . [DOI] [PubMed] [Google Scholar]
- 47.Schlichting M, Menegazzi P, Lelito KR, Yao Z, Buhl E, Dalla Benetta E, et al. A Neural Network Underlying Circadian Entrainment and Photoperiodic Adjustment of Sleep and Activity in Drosophila. J Neurosci. 2016;36(35):9084–96. 10.1523/JNEUROSCI.0992-16.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Brennecke J, Stark A, Russell RB, Cohen SM. Principles of MicroRNA-target recognition. Plos Biol. 2005;3(3):404–18. WOS:000227984000010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Fushima K, Tsujimura H. Precise control of fasciclin II expression is required for adult mushroom body development in Drosophila. Dev Growth Differ. 2007;49(3):215–27. 10.1111/j.1440-169X.2007.00922.x . [DOI] [PubMed] [Google Scholar]
- 50.Chen X, Rosbash M. MicroRNA-92a is a circadian modulator of neuronal excitability in Drosophila. Nat Commun. 2017;8:14707 10.1038/ncomms14707 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Murad A, Emery-Le M, Emery P. A subset of dorsal neurons modulates circadian behavior and light responses in Drosophila. Neuron. 2007;53(5):689–701. 10.1016/j.neuron.2007.01.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Hermann-Luibl C, Yoshii T, Senthilan PR, Dircksen H, Helfrich-Forster C. The ion transporter peptide is a new functional clock neuropeptide in the fruit fly Drosophila melanogaster. J Neurosci. 2014;34(29):9522–36. 10.1523/JNEUROSCI.0111-14.2014 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Hermann C, Yoshii T, Dusik V, Helfrich-Forster C. Neuropeptide F immunoreactive clock neurons modify evening locomotor activity and free running period in Drosophila melanogaster. J Comp Neurol. 2012;520(5):970–87. 10.1002/cne.22742 . [DOI] [PubMed] [Google Scholar]
- 54.Depetris-Chauvin A, Berni J, Aranovich EJ, Muraro NI, Beckwith EJ, Ceriani MF. Adult-Specific Electrical Silencing of Pacemaker Neurons Uncouples Molecular Clock from Circadian Outputs. Curr Biol. 2011;21(21):1783–93. WOS:000297139600015. 10.1016/j.cub.2011.09.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Muraro NI, Pirez N, Ceriani MF. The Circadian System: Plasticity at Many Levels. Neuroscience. 2013;247:280–93. WOS:000330335100027. 10.1016/j.neuroscience.2013.05.036 [DOI] [PubMed] [Google Scholar]
- 56.Saint-Charles A, Michard-Vanhee C, Alejevski F, Chelot E, Boivin A, Rouyer F. Four of the six Drosophila rhodopsin-expressing photoreceptors can mediate circadian entrainment in low light. J Comp Neurol. 2016;524(14):2828–44. 10.1002/cne.23994 . [DOI] [PubMed] [Google Scholar]
- 57.Cusumano P, Biscontin A, Sandrelli F, Mazzotta GM, Tregnago C, De Pitta C, Costa R. Modulation of miR-210 alters phasing of circadian locomotor activity and impairs projections of PDF clock neurons in Drosophila melanogaster. PLoS Genet. 2018;14(7):e1007500 10.1371/journal.pgen.1007500 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Aarse J, Herlitze S, Manahan-Vaughan D. The requirement of BDNF for hippocampal synaptic plasticity is experience-dependent. Hippocampus. 2016;26(6):739–51. 10.1002/hipo.22555 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Granseth B, Fukushima Y, Sugo N, Lagnado L, Yamamoto N. Regulation of thalamocortical axon branching by BDNF and synaptic vesicle cycling. Front Neural Circuits. 2013;7:202 10.3389/fncir.2013.00202 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Wernet M, Labhart T, Baumann F, Mazzoni E, Pichaud F, Desplan C. Homothorax switches function of Drosophila photoreceptors from color to polarized light sensors. Cell. 2003;115:267–79. 10.1016/s0092-8674(03)00848-1 . [DOI] [PubMed] [Google Scholar]
- 61.Grima B, Lamouroux A, Chelot E, Papin C, Limbourg-Bouchon B, Rouyer F. The F-box protein Slimb controls the levels of clock proteins Period and Timeless. Nature. 2002;420(6912):178–82. WOS:000179200900046. 10.1038/nature01122 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(A) Locomoter behavior profile in DD. Time of circadian peak activity is shown on the graph. The number 0 and 12 shows CT (circadian time). Gray indicates the subjective night. (B) Quantification of the time of peak activity in DD. * = p<0.05, **** = p<0.0001, determined by Student’s t test.
(PDF)
(A) Representative eduction profiles of fly locomotor activity under 12:12 LD cycle. Black represents the dark phase, while white represents the light phase. Eduction is analyzed based on average of 3 days LD. (B) Quantification of evening phase of flies under LD. Number of flies tested is listed in each bar. (C) Representative eduction profiles under 16:8 LD cycle. (D) Quantification of evening phase of flies under 16:8 LD. Number of flies tested is listed in each bar. Error bars indicate Standard Error. **** = p<0.0001, determined by Student’s t test.
(PDF)
(A) Representative images of sLNvs in wild-type control and miR-210KO mutants. Fly brains were dissected at six time points (circadian time, CT) during the second day of DD and stained with anti-PDF (green) and anti-PER (red) antibodies. Scale bar is 10 μm. (B) Quantification of PER staining in sLNv. No significant changes in PER level or cycling. Error bars indicate SEM. (C) Quantification of PER levels in DN1. (D) Quantification of PER levels in LNd. Error bars indicate SEM.
(PDF)
(A-B) Representative images of DN1 (A) and LNd (B). Fly brains were dissected and stained same as Fig 2. Scale bar is 10 μm. (C-D) Quantification of PER staining in DN1 (C) and LNd (D). Error bars indicate SEM. ns = no significance, determined by Student’s t test.
(PDF)
(A) Representative images of lLNv in wild-type and miR-210KO mutant fly brain. Flies were dissected at six time points on the 4th day of LD and brains were stained same as Fig 2. Scale bar is 20 μm. (B) Quantification of PER staining in ILNv. (C) Quantification of PDF staining in ILNv. At least 12 brains were quantified.
(PDF)
Upper panel shows the whole brain staining of PDF (red) and GFP (green) in wild-type, miR-210KO, and Fas2ΔmiR-210 mutants. Lower panel shows the enlarged image of the optic lobe and LNv region. Rh6-Gal4 is used here as a marker for the H-B eyelet. Six pointed white stars indicate the H-B eyelet terminal in fly brain.
(PDF)
(A) Representative images of fly brains at different time points under LD. Flies were entrained under LD cycles and brains were dissected at the 4th day in LD. Red, Fas2 staining, green, GFP. Rh6-Gal4 was used to label R8 positive photoreceptors and H-B eyelet. Note the increase of Fas2 is found in the optic lobe of miR-210KO at all six time points. Scale bar is 10 μm. (B) Quantification of Fas2 in the optic lobe of wild-type and miR-210KO. Fas2 is constantly higher in the miR-210KO mutant but does not show an oscillation. Fas2 abundance is quantified as Fig 5C.
(PDF)
The flybase number of the lines used here are: 58880 (mir-10), 58885 (mir-1007), 58888 (mir-1014), 58889 (mir-1017), 58890 (mir-11), 58892 (mir-133), 58894 (mir-13b-2), 58896 (mir-184), 58898 (mir-193), 58899 (mir-210), 58900 (mir-219), 58904 (mir-274), 58908 (mir-277-34), 58909 (mir-278), 58910 (mir-281-1-281-2), 58911 (mir-282), 58912 (mir-283), 58913 (mir-284), 58914 (mir-285), 58915 (mir-2b-1), 58916 (mir-2c-13a-1), 58917 (mir-303), 58924 (mir-314), 58926 (mir-317), 58928 (mir-31a), 58929 (mir-31b), 58930 (mir-33), 58892 (mir-133), 58935 (mir-927), 58937 (mir-92a), 58939 (mir-932), 58940 (mir-955), 58942 (mir-957), 58943 (mir-958), 58948 (mir-967), 58949 (mir-968-1002), 58952 (mir-971), 58953 (mir-971-972-973), 58954 (mir-975-976-977), 58959 (mir-986), 58960 (mir-987), 58961 (mir-988), 58962 (mir-989), 58963 (mir-990), 58966 (mir-999), 58960 (mir-987), 58967 (mir-9c).
(DOCX)
(DOCX)
Data Availability Statement
The numerical data and summary statistics are available for download at GitHub (https://github.com/yongzhangclock/miR-210). All other data are within the manuscript and its Supporting Information files.