Skip to main content
3 Biotech logoLink to 3 Biotech
. 2019 Aug 10;9(9):328. doi: 10.1007/s13205-019-1858-6

Molecular cloning and functional analysis of a Δ12-fatty acid desaturase from the Antarctic microalga Chlamydomonas sp. ICE-L

Yingying He 1,#, Zhou Zheng 1,2,3,#, Meiling An 1, Hao Chen 1, Changfeng Qu 2, Fangming Liu 2, Yibin Wang 2, Jinlai Miao 1,2,3,✉, Xuguang Hou 4,✉
PMCID: PMC6689313  PMID: 31406650

Abstract

Chlamydomonas sp. ICE-L, which can thrive in extreme environments of the Antarctic, could represent a promising alternative for polyunsaturated fatty acid (PUFA) production. A new Δ12-fatty acid desaturase (FAD)-encoding gene (Δ12CiFAD), 1269 bp in size, was cloned from Chlamydomonas sp. ICE-L. Bioinformatics analysis showed that Δ12CiFAD-encoded protein was homologous to known FADs with conserved histidine motifs, and localized to the chloroplast. Functional analysis of Δ12CiFAD indicated that recombinant Synechococcus 6803 expressing Δ12CiFAD could accumulate C18:2, whereas recombinant Saccharomyces cerevisiae expressing this enzyme could not accumulate C18:2 or any other new fatty acids. These results indicate that Δ12CiFAD is a functional enzyme in the chloroplast that can adjust Chlamydomonas sp. ICE-L cell membrane fluidity to adapt to Antarctic extreme low-temperature environments, which give us insights into the frigostable and cold-resistant mechanisms of hypothermic organisms.

Keywords: Chlamydomonas sp. ICE-L, Fatty acid desaturase, Polyunsaturated fatty acid, Temperature stress, Salt stress

Introduction

The South Pole is one of the most extreme regions on Earth and is characterized by its cold polar climate. Here, large numbers of salt pockets and channels exist in the frozen seawater. These dramatic changes in temperature and salinity can cause great harm to biological systems. Antarctic ice algae comprise a large class of microalgae that live in the Antarctic sea ice, sea ice edges, or extreme environments (An et al. 2013). They are an important energy and nutritional source for invertebrates such as juvenile krill, accounting for up to more than 20% of total annual primary production in ice-covered waters (He et al. 2017). Antarctic ice algae, which can survive in such distinct habitats, have developed unique physiological and biochemical mechanisms to adapt to the extreme Antarctic environment (Spijkerman et al. 2012). The Antarctic ice alga Chlamydomonas sp. ICE-L is a unicellular microorganism that can directly sense and respond to signals in its surrounding environment at the cellular level. Because of its specialized physiological characteristics, it has been used in studies to test extreme polar environments.

For Antarctic ice algae, the adaptation mechanism to extreme environments is very complex, involving the structure and function of their cell membrane and a variety of molecular modifications (Mou et al. 2013). One of the most important adaptation mechanisms of Antarctic ice algae to maintain optimum membrane fluidity is to increase unsaturated fatty acids (UFA) of monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA). However, compared with MUFA, PUFA are more vital lipid components of the cell membrane in the membrane fluidity mechanism (Romero et al. 2018; Santomartino et al. 2017; Wang et al. 2017; Zhang et al. 2018). With the development of molecular biological research, fatty acid dehydrogenase- or elongase-encoding genes have been cloned from microalgae. Further, increasing attention has been paid to the regulation of fatty acid dehydrogenase gene expression in microalgae (Cheng et al. 2017; de Jaeger et al. 2017; Lin et al. 2018; Shi et al. 2018; Thiyagarajan et al. 2018; Zorin et al. 2017). Δ12-fatty acid desaturase (Δ12FAD) is a key enzyme required for the synthesis of linoleic acid (LA, C18:2n – 6) and is the rate-limiting enzyme for the conversion of MUFA to PUFA. Therefore, research on Δ12-fatty acid desaturase-encoding gene (Δ12CiFAD) from Antarctic microalgae would help to elucidate the influence of extreme environment on the membrane fluidity of Antarctic ice algae and the molecular mechanism of unsaturated fatty acid regulation.

Chlamydomonas sp. ICE-L could thus represent a promising alternative for PUFA production. In this study, the key Δ12-FAD-encoding gene, from the Antarctic microalga Chlamydomonas sp. ICE-L, was cloned and analyzed. Expression of Δ12CiFAD in Synechococcus 6803 and Saccharomyces cerevisiae were then, respectively, performed to analyze its bioactivities. The results provide new insights into the functional analysis of Δ12FAD in extreme Antarctic environments.

Materials and methods

Strains and culture

The Antarctic ice alga, Chlamydomonas sp. ICE-L, was isolated from floating ice near the Zhongshan Research Station of Antarctica (69°S, 77°E). Cultures were routinely grown in autoclaved Provasoli seawater medium (Provasoli 1958) at a light density of 40 μmol photons m−2 s−1 under a 12:12 h light/dark cycle at 5 °C.

RNA extraction and cloning

Total RNA was extracted from liquid nitrogen-ground algae powder using Trizol reagent (Invitrogen) as described by Green and Sambrook (2018). After thawing and centrifugation (4 °C, 5 min, 12,000 × g), 200 μL of chloroform was added and mixed thoroughly by inverting the tubes several times. Samples were centrifuged for 15 min at 12,000 × g, and 450 μL of the uppermost aqueous layer was transferred to a new fresh 1.5 mL Eppendorf tube. RNA was precipitated for 10 min by adding 450 μL of isopropanol to the aqueous solution; this was centrifuged at 12,000 × g for 10 min, washed with 1 mL ethanol (75%), and finally stored in 50 μL diethyl pyrocarbonate (DEPC)-treated distilled water at – 80 °C. Prior to PCR amplification, the cDNA was synthesized using oligo d(T) 18 (TaKaRa Biotech Co., Dalian, China) and M-MLV reverse transcriptase (Promega Biotech Co., Madison, WI, USA).

Specific primers, shown in Table 1, were designed based on the potential full-length Δ12CiFAD cDNA obtained from the transcriptome of Chlamydomonas sp. ICE-L. Δ12CiFAD was synthesized following the specification of PrimeSTAR® Max DNA Polymerase (TaKaRa Biotech Co., Dalian, China). The PCR products were then detected by electrophoresis on a 1% agarose gel, after which the fragment of interest was excised and purified using an agarose gel DNA fragment recovery kit (Tiangen Biotech Co., China). PCR fragments were subcloned into the pMD18-T vector to produce the recombinant plasmid pMD18-T-12, which was then transformed into Escherichia coli DH5α cells. Subsequently, the nucleotide sequence, designated Δ12CiFAD, was determined.

Table 1.

Primers used in this experiment

Oligonucleotide sequence 5ʹ−3ʹ Enzyme cleavage site
pSyn-1 construction
 C12-F (Blue Alga) TAGAATTCGAAGGAGCATCATGGCAAT EcoRI
 C12-R (Blue Alga) ATGGATCCTCATACAGCGTTAGGGT BamHI
 pYES-2 construction
 S12-F (S. cerevisiae) TAGGATCCATGGCAATTTCAAT BamHI
 S12-R (S. cerevisiae) CCGAATTCTCATACAGCGTTAG EcoRI

Bioinformatic analysis

The obtained sequence was then examined for homology with other sequences in the NCBI (http://www.ncbi.nlm.nih.gov/blast) using BLASTX. The nucleotide sequence of Δ12CiFAD was translated to its protein sequence (http://searchlauncher.bcm.tmc.edu/seq-util/Options/sixframe.html) and matched with the protein database in NCBI. Multiple sequence alignments were performed with the ClustalX program and analyzed using the BioEdit program (Chenna et al. 2003). The theoretical isoelectric point (pI) and molecular weight (Mw) were calculated with the Compute pI/Mw tool on the ExPASy Web site.

Quantitative real-time PCR

Chlamydomonas sp. ICE-L cDNA templates from different temperature and salinity stress were prepared for qRT-PCR similarly to that in He et al. (2017). Table 1 exhibits the paired Δ12CiFAD gene-specific primers, which were designed using Primer Premier 5.0. A housekeeping gene, ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit (rbcL), was used as an internal control (Zhang et al. 2011). Real-time PCR was performed using an ABI StepOne Plus Real-Time PCR System (Applied Biosysytems, USA) with SYBR Premix Ex Taq™ II (TaKaRa Biotech Co., Dalian, China) for 40 cycles (95 °C for 5 s, 58 °C for 10 s, and 72 °C for 40 s). The data were further analyzed using the comparative Ct (2−ΔΔCT) method (Livak and Schmittgen 2001). The mean ± SD was calculated for each experiment and analyzed using SPSS 17.0 data processing system software. The experiment was replicated three times.

Plasmid construction

The Δ12CiFAD ORF was digested from pMD18-T-12 with EcoRI and BamHI and then subcloned into the S. cerevisiae expression vector pYES-2 and the Synechococcus expression vector pSyn-1. Each positive pYES-2 transformant and pSyn-1 was screened from the LB solid medium only with single antibiotics of ampicillin or spectinomycin. The resultant positive plasmids were validated again by PCR and restriction enzyme digestion. Finally, the correct Δ12CiFAD subcloned into pYES-2 and pSyn-1 vectors was used to produce the recombinant plasmids pYES-2-12 and pSyn-1-12, respectively.

Cloning and expression of Δ12CiFAD in S. cerevisiae

For functional characterization, the Δ12CiFAD sequence was cloned into the yeast expression vector pYES2 (Invitrogen). The Δ12CiFAD ORF was modified by PCR to create BamHI and EcoRI restriction sites adjacent to the start and stop codons, respectively (primers in Table 1). The PCR program was performed as follows: 4 min at 94 °C, followed by 30 s at 94 °C, 30 s at 45 °C, and 1 min at 72 °C for 10 cycles, 30 s at 94 °C, 30 s at 57 °C, and 1 min at 72 °C for 20 cycles, and a final extension at 72 °C for 10 min. The PCR product was cloned into the pMD-18 T vector, and the ORF was released by BamHI/EcoRI digestion. Cloning of the Δ12CiFAD ORF in pYES2 using the same digestion sites yielded a plasmid designated pYES-2-12.

The recombinant plasmid pYES-2-12 was transformed into S. cerevisiae K601 using the lithium acetate method (He et al. 2009). After selection on minimal medium agar plates without uracil, cells harboring the vector were cultivated in minimal medium lacking uracil (SC-Ura) but containing 2% (w/v) glucose. RNA was extracted and recombinant S. cerevisiae was affirmed by PCR. The resulting positive clone was designated SC12. Expression was induced by supplementation with galactose to a final concentration of 2% (w/v) when the cultures had reached an A600 of 0.2−0.3. The cultures were further incubated for 48 h at 30 °C. The cells were harvested by centrifugation, washed three times with sterile distilled water, and then dried by lyophilization. The experiment was replicated three times.

Cloning and expression of Δ12CiFAD in Synechococcus 6803

Synechococcus elongatus (strain PCC 6803), containing an integration platform in neutral sites (NS1a and NS1b) to guide double homologous recombination, was used to express Δ12CiFAD. For this purpose, the plasmid pSyn_1 (Invitrogen) was digested with EcoRI and BamHI. The Δ12CiFAD ORF was amplified with specific primers (Table 1), with the forward primer containing a ribosome binding site and EcoRI restriction site and reverse primer containing a BamHI restriction site. PCR was performed as follows: 4 min at 94 °C, followed by 30 s at 94 °C, 30 s at 45 °C, and 1 min at 72 °C for 10 cycles, 30 s at 94 °C, 30 s at 60 °C, and 1 min at 72 °C for 20 cycles, and a final extension 72 °C for 10 min. The PCR product was cloned into the pMD-18 T vector, and the ORF was released by EcoRI/BamHI digestion. After cloning the Δ12CiFAD ORF into pSyn_1, the resulting plasmid was designated pSFAD12.

S. elongatus was cultured in BG11 medium at 30 °C under moderate light conditions (12 h 30 μE m−2 s−1). Transformation was conducted according to the manual, and transformants were selected on BG11 plates (1.5% [w/v] agar) containing 10 μg mL−1 spectinomycin. Solid cultures on BG11 plates were grown at 30 °C for 5−7 days under continuous 100 μE m−2 s−1 illumination with cool fluorescent white light. RNA was extracted and the successful recombination of the gene in Synechococcus sp. 6803 was confirmed by PCR. The positive clone was designated SE12. Expression was induced through nickel sulfate supplementation to a final concentration of 5 µM when cultures reached log phase. The cultures were further incubated for 5 days at 30 °C, and cells were harvested by centrifugation, washed three times with sterile distilled water, and then dried by lyophilization. The experiment was replicated three times.

Fatty acid analysis

For fatty acid analysis, 20 mg of lyophilized sample was added to a conical flask containing 30 mL petroleum ether. The solution was placed in ultrasound water (40.0 kHz, 600 W) for 30 min at 50 °C, and this operation was repeated two more times. Then, the solvent was removed by rotary vacuum evaporation at 50 °C. Glycerophospholipid FAs were transmethylated into fatty acid methyl esters (FAMEs) with 0.4 M KOH−methanol (v/v) at room temperature (15 °C). FAME analysis was performed using a Finnigan Trace GC−MS device. FAMEs were identified based on comparison with authentic standards (Sigma Chemicals Co., USA) and the peaks were integrated with Data Processing System Version 7.05 software (Zhejiang University, China).

Results and discussion

Bioinformatics analysis of Δ12CiFAD

The Δ12CiFAD gene of Antarctic microalga Chlamydomonas sp. ICE-L was cloned successfully and was thus designated. The Δ12CiFAD sequence had been deposited into Genbank under the accession number JN127366. Bioinformatic analysis revealed that the gene was 1269 bp in size and encoded a 422-amino acid peptide with a pI of 8.64 and a molecular weight of 48.5 kDa.

The amino acid sequence of Δ12CiFAD contained portions that coincided with the conserved sequences of chloroplast Δ12 dehydrogenase (GHDAGH, HNHHH and HVIHH; Table 2). Δ12FAD is the rate-limiting enzyme of the PUFAs metabolic pathway, and this protein catalyzes the formation of the second double bonds in the fatty acid carbon chain. Δ12CiFAD contained three histidine clusters, HDAGH (146−150), HNHHH (182−186), and HVPHH (344−348) (Fig. 1). Amino acid alignment of the Δ12CiFAD sequence with those of other plastidial homologs showed that all of these species had three highly conserved histidine clusters. In addition, the conserved histidine clusters of different proteins contained different conserved residues, suggesting that these genes might have originated from a common ancestor and had obtained a different function during the evolutionary process.

Table 2.

Conserved histidine-rich boxes of Δ12CiFAD in Chlamydomonas sp. ICE-L

Name H-box1 H-box2 H-box3
Δ12CiFAD sequence FVVGHDAGHRSFH EPWRIKHNHHHAKTN HDINVHVPHHVSS

Fig. 1.

Fig. 1

Alignment of amino acid sequences of Δ12CiFAD in comparison with other plastidial homologs. The conserved amino acids are on gray background. The three His boxes are indicated by subscripts and the potential transmembrane domains are framed. Sequences shown are Δ12FADs: BAA23881 Chlamydomonas reinhardtii, XP_002949932 Volvox carteri, AAA92800 Arabidopsis thaliana, AAA50157.1 Brassica napus

FAD enzymes perform dehydrogenation reactions that lead to the insertion of double bonds in fatty acids and are divided into soluble and integral membrane classes (Chen et al. 2013). Soluble desaturases are usually studied separately from integral membrane desaturases because the soluble enzyme exists only in plastids of higher plants, in addition to the wide distribution of membrane-bound enzymes much less their evolutionary history (Shanklin and Cahoon 1998). The phylogenetic tree (Fig. 2) showed that Δ12FADs were divided into two clusters, one from chloroplasts and the other from mitochondria. Δ12CiFAD was clustered with the Δ12FADs from chloroplasts, which meant Δ12CiFAD was located in Chlamydomonas sp. ICE-L chloroplast. Also, Δ12CiFAD was most closely related to the Δ12FADs from green algae, but distantly related to the Δ12FADs from cyanobacteria.

Fig. 2.

Fig. 2

Phylogenetic tree for Δ12FAD and related desaturases based on amino acid sequences

Effect of temperature and salinity on the expression of Δ12CiFAD

At the low temperature of – 20 °C, Δ12CiFAD expression continued to increase over 24 h, reaching a maximum at 24 h of two to five times the normal levels. The expression then decreased by 48 h and increased subsequently. At 10 °C, Δ12CiFAD expression increased over time, reaching a maximum at 12 days of two to three times the normal levels (Fig. 3). The relative composition of fatty acids differs among algal species and also strongly depends on environmental factors such as temperature, nutrient availability, and solar radiation (Piorreck et al. 1984; Roessler 2010). Temperature probably has an important effect on the fatty acid composition of algae and potentially supersedes the effect of other environmental parameters (Poerschmann et al. 2004; Spijkerman et al. 2012). In general, increasing PUFA content is the main mechanism through which marine microalgae respond to low temperatures. The marine microalga Pavlova salina produces lipids that contain approximately 50% omega-3 long chain polyunsaturated fatty acids (LC-PUFA) such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) (Zhou et al. 2007). Our studies have shown that, like Antarctic diatoms (Mock and Kroon 2002), Chlamydomonas sp. ICE-L evolved to accumulate large amounts of intracellular PUFA during long-term adaptive evolution.

Fig. 3.

Fig. 3

Expression of the Δ12CiFAD at different temperatures for different times with error bars (ɪ) showing standard deviation from the mean (n = 3)

We believe that Δ12CiFAD plays an important role in maintaining MUFA and PUFA ratios at different temperatures. However, Tang et al. (2005) reported that Δ12CiFAD was modified only at the post-transcriptional and post-translational levels at low temperature, rather being upregulated at the mRNA level. Although FADs have been widely studied in higher plants, there are few studies on their roles in polar microalgae. In Chlorella vulgaris IAM C-27, the transcription of Δ12FAD, which is located in the endoplasmic reticulum, was shown to increase gradually as the temperature decreased from 25 °C to 3 °C and was increased by 3.2-fold compared to the initial level after low-temperature treatment for 24 h (Suga et al. 2002). The results indicate that the temperature-dependent regulation of FAD occurs at the transcriptional and post-transcriptional level.

In conditions of high salinity, the expression of Δ12CiFAD was upregulated over 6 h, which was followed by expression that first declined and then increased again. The peak in expression occurred at different times under different conditions of salinity. The expression of Δ12CiFAD peaked at 8 days with 128‰ NaCl and was increased by 6.5-fold compared to control levels. With conditions of 64‰ and 96‰ NaCl, Δ12CiFAD expression peaked at 12 days, with 6.7- and 6.9-fold increases in expression, respectively, compared to that in the control group. Under low (16‰) salinity conditions, the expression of Δ12CiFAD showed an overall increasing trend, reaching the peak level of 9.6 at 8 days (Fig. 4).

Fig. 4.

Fig. 4

Expression of the Δ12CiFAD in different salinity for different times with error bars (ɪ) showing standard deviation from the mean (n = 3)

Transformants and PCR detection

Recombinants of SE12 and SC12 were screened for positive clones by PCR amplification (Fig. 5). The detection primers corresponded to amplification primers, and the results of electrophoresis of SE12 and SC12 PCR products are shown in Fig. 6, which showed that the sizes of the amplified fragments were consistent with expected results. It was thus presumed that the plasmid containing the target gene was successfully transformed. The sequences of the amplified fragments were then compared with the original ORF sequence; results showed that the sequence was correct with no mutations, verifying that the plasmid containing the target gene had been successfully transformed.

Fig. 5.

Fig. 5

Screening of transformants of SE12 and SC12 transformation

Fig. 6.

Fig. 6

Identification of the recombinant SE12 and SC12 by colony PCR

Analysis of fatty acid composition in recombinant strains

The recombinant transformants were successfully cultured and labeled. Recombinant SE12 and SC12 were then, respectively, induced. In Synechococcus, Δ12CiFAD activity resulted in the conversion of C18:1−C18:2 (Table 3). However, functional verification of Δ12CiFAD in S. cerevisiae was not achieved. Upon changing the induction conditions, including prolonging the induction time to 1 week or increasing the culture temperature to 10, 18, and 23 °C, no new fatty acids were detected in SC12.

Table 3.

Fatty acid composition of transgenic Synechococcus SE12 and Saccharomyces SC12 (n = 3)

Control (%)
(Synechococcus 6803)
SE12 (%) Control (%)
(S. cerevisiae)
SC12 (%)
C15:0 – – 7.53 ± 0.90 8.53 ± 0.18
C16:0 48.29 ± 4.08 54.05 ± 3.16 13.67 ± 1.22 12.18 ± 1.53
C16:1 24.41 ± 2.32 20.27 ± 1.04 44.62 ± 5.02 40.52 ± 4.11
C18:0 5.06 ± 0.98 7.85 ± 0.28 6.22 ± 1.19 6.71 ± 1.25
C18:1 17.15 ± 0.87 11.40 ± 0.33 30.03 ± 3.41 35.57 ± 5.01
C18:2 – 0.51 ± 0.15 – –

Δ12FAD enzymes from different species, or the same species in different locations, actually exhibit different substrate specificities, although the endoplasmic reticulum-localized Δ12FAD fatty acid desaturase can theoretically convert C16:1−C16:2, C17:1−C17:2, C18:1−C18:2, and C20:1−C20:2. Heterologous expression of Phaeodactylum tricornutum Δ12FAD (PtFAD2, PtFAD6) in S. cerevisiae and Synechococcus showed that Δ12FAD from the endoplasmic reticulum had a specific effect on the oleic acid (C18:1) synthesis of omega-6 PUFAs (C18:2), and the plastid FAD synthesis of C16:2 using only C16:1 as a substrate (Domergue et al. 2003). The fatty acid C18:2 was detected when Δ12FAD from the endoplasmic reticulum of the marine microalga Pinguiochrysis pyriformis was expressed in yeast (Matsuda et al. 2011). In contrast, only a small amount of C18:2 (0.3%) was detected with Δ12FAD from the freshwater microalga Pinguiochrysis incisa, and a variety of optimization experiments were not successful in increasing the expressed amount of C18:2 (Iskandarov et al. 2010). In this study, new C18:2 fatty acids were detected in recombinant Synechococcus, which indicated the expression of Δ12CiFAD. However, the new C18:2 fatty acids were not detected in recombinant S. cerevisiae under the experimental conditions, indicating that the activity of Chlamydomonas sp. ICE-L Δ12CiFAD could not be confirmed or that the content of new C18:2 fatty acids was too low to be detected. These results also indicated that Δ12CiFAD might only have a role in chloroplasts.

Conclusion

As the major primary producers of the Antarctic regions, Antarctic ice algae represent an important cryogenic algae resource with a collection of physiological adaptations allowing them to thrive in ice. Chlamydomonas sp. ICE-L is an excellent organism for the study of hypothermic algae adaptation to abiotic tolerance. A novel Δ12CiFAD was cloned from the Antarctic microalga Chlamydomonas sp. ICE-L. Based on bioinformatics analysis, the Δ12CiFAD protein was predicted to be localized in chloroplasts. Under low-temperature conditions of – 20 °C, Δ12CiFAD gene expression continued to increase over 24 h, reaching a maximum at 24 h. At 10 °C, Δ12CiFAD expression increased with time and reached its maximum at 14 days. In high salinity conditions, the expression of Δ12CiFAD expression was upregulated over 6 h. Further, under conditions of low salinity (16‰), the expression of Δ12CiFAD showed an overall increasing trend. In conclusion, Δ12CiFAD of Chlamydomonas sp. ICE-L was expressed in S. cerevisiae and Synechococcus. The successful expression of Δ12CiFAD in recombinant Synechococcus indicates not only that this enzyme might function in chloroplasts, but also that this enzyme has the potential to produce different high-value PUFAs.

Funding

This work was supported by the National Key Research and Development Program of China (No. 2018YFD0900705), the China Ocean Mineral Resources R&D Association (No. DY135-B2-14), the National Key Research and Development Program of China (No. 2018YFD0901103), the Natural Science Foundation of China (No. 41576187, No. 41776203), the Natural Science Foundation of Shandong (No. ZR2019BD023), Key Research and Development Program of Shandong Province (No. 2018GHY115034, No. 2018YYSP024, No. 2016YYSP017, No. 2017GHY15112, No. 2018GHY115039), Ningbo Public Service Platform for High-Value Utilization of Marine Biological Resources (No. NBHY-2017-P2), and Youth Fund Project of Shandong Natural Science Foundation (ZR2017QD008).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Contributor Information

Jinlai Miao, Phone: +86 532 88967430, Email: miaojinlai@fio.org.cn.

Xuguang Hou, Phone: +86 13370906007, Email: richardhoukk@163.com.

References

  1. An M, et al. Temperature regulates fatty acid desaturases at a transcriptional level and modulates the fatty acid profile in the Antarctic microalga Chlamydomonas sp. ICE-L. Bioresour Technol. 2013;134:151–157. doi: 10.1016/j.biortech.2013.01.142. [DOI] [PubMed] [Google Scholar]
  2. Chen H, Gu Z, Zhang H, Wang M, Chen W, Lowther WT, Chen YQ. Expression and purification of integral membrane fatty acid desaturases. PLoS One. 2013;8:e58139. doi: 10.1371/journal.pone.0058139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cheng J, Li K, Zhu Y, Yang W, Zhou J, Cen K. Transcriptome sequencing and metabolic pathways of astaxanthin accumulated in Haematococcus pluvialis mutant under 15% CO2. Bioresour Technol. 2017;228:99–105. doi: 10.1016/j.biortech.2016.12.084. [DOI] [PubMed] [Google Scholar]
  4. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. Multiple sequence alignment with the clustal series of programs. Nucleic Acids Res. 2003;31:3497–3500. doi: 10.1093/nar/gkg500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. de Jaeger L, Springer J, Wolbert EJH, Martens DE, Eggink G, Wijffels RH. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii. Bioresour Technol. 2017;245:1616–1626. doi: 10.1016/j.biortech.2017.06.128. [DOI] [PubMed] [Google Scholar]
  6. Domergue F, et al. New insight into Phaeodactylum tricornutum fatty acid metabolism. Cloning and functional characterization of plastidial and microsomal delta12-fatty acid desaturases. Plant Physiol. 2003;131:1648–1660. doi: 10.1104/pp.102.018317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Green MR, Sambrook J. A single-step method for the simultaneous preparation of DNA, RNA, and protein from cells and tissues. Cold Spring Harb protoc. 2018 doi: 10.1101/pdb.prot093500. [DOI] [PubMed] [Google Scholar]
  8. He S, Bystricky K, Leon S, Francois JM, Parrou JL. The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function. FEBS J. 2009;276:5432–5446. doi: 10.1111/j.1742-4658.2009.07227.x. [DOI] [PubMed] [Google Scholar]
  9. He YY, et al. Cloning and stress-induced expression analysis of calmodulin in the Antarctic alga Chlamydomonas sp. ICE-L. Curr Microbiol. 2017;74:921–929. doi: 10.1007/s00284-017-1263-5. [DOI] [PubMed] [Google Scholar]
  10. Iskandarov U, Khozin-Goldberg I, Cohen Z. Identification and characterization of Delta12, Delta6, and Delta5 desaturases from the green microalga Parietochloris incisa. Lipids. 2010;45:519–530. doi: 10.1007/s11745-010-3421-4. [DOI] [PubMed] [Google Scholar]
  11. Lin H, Shen H, Lee YK. Cellular and molecular responses of Dunaliella tertiolecta by expression of a plant medium chain length fatty acid specific Acyl-ACP thioesterase. Front Microbiol. 2018;9:619. doi: 10.3389/fmicb.2018.00619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  13. Matsuda T, et al. Molecular cloning of a Pinguiochrysis pyriformis oleate-specific microsomal Delta12-fatty acid desaturase and functional analysis in yeasts and thraustochytrids. J Biochem. 2011;150:375–383. doi: 10.1093/jb/mvr076. [DOI] [PubMed] [Google Scholar]
  14. Mock T, Kroon BM. Photosynthetic energy conversion under extreme conditions—II: the significance of lipids under light limited growth in Antarctic sea ice diatoms. Phytochemistry. 2002;61:53–60. doi: 10.1016/S0031-9422(02)00215-7. [DOI] [PubMed] [Google Scholar]
  15. Mou S, et al. Analysis of DeltapH and the xanthophyll cycle in NPQ of the Antarctic sea ice alga Chlamydomonas sp. ICE-L. Extremophiles. 2013;17:477–484. doi: 10.1007/s00792-013-0532-x. [DOI] [PubMed] [Google Scholar]
  16. Piorreck M, Baasch KH, Pohl P. Biomass production, total protein, chlorophylls, lipids and fatty acids of freshwater green and blue-green algae under different nitrogen regimes. Phytochemistry. 1984;23:207–216. doi: 10.1016/S0031-9422(00)80304-0. [DOI] [Google Scholar]
  17. Poerschmann J, Spijkerman E, Langer U. Fatty acid patterns in Chlamydomonas sp. as a marker for nutritional regimes and temperature under extremely acidic conditions. Microb Ecol. 2004;48:78–89. doi: 10.1007/s00248-003-0144-6. [DOI] [PubMed] [Google Scholar]
  18. Provasoli L. Nutrition and ecology of protozoa and algae. Annu Rev Microbiol. 1958;12:279–308. doi: 10.1146/annurev.mi.12.100158.001431. [DOI] [PubMed] [Google Scholar]
  19. Roessler PG. Environmental control of glycerolipid metabolism in microalgae: commercial implications and future research directions. J Phycol. 2010;26:393–399. doi: 10.1111/j.0022-3646.1990.00393.x. [DOI] [Google Scholar]
  20. Romero AM, Jorda T, Rozes N, Martinez-Pastor MT, Puig S. Regulation of yeast fatty acid desaturase in response to iron deficiency. Biochimica et Biophysica Acta Mol Cell Biol Lipids. 2018;1863:657–668. doi: 10.1016/j.bbalip.2018.03.008. [DOI] [PubMed] [Google Scholar]
  21. Santomartino R, Riego-Ruiz L, Bianchi MM. Three, two, one yeast fatty acid desaturases: regulation and function. World J Microbiol Biotechnol. 2017;33:89. doi: 10.1007/s11274-017-2257-y. [DOI] [PubMed] [Google Scholar]
  22. Shanklin J, Cahoon EB. Desaturation and related modifications of fatty acids1. Ann Rev Plant physiol Plant Mol Biol. 1998;49:611–641. doi: 10.1146/annurev.arplant.49.1.611. [DOI] [PubMed] [Google Scholar]
  23. Shi H, Wu R, Zheng Y, Yue X. Molecular mechanisms underlying catalytic activity of delta 6 desaturase from Glossomastix chrysoplasta and Thalassiosira pseudonana. J Lipid Res. 2018;59:79–88. doi: 10.1194/jlr.m079806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Spijkerman E, Wacker A, Weithoff G, Leya T. Elemental and fatty acid composition of snow algae in Arctic habitats. Front Microbiol. 2012;3:380. doi: 10.3389/fmicb.2012.00380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Suga K, et al. Two low-temperature-inducible Chlorella genes for delta12 and omega-3 fatty acid desaturase (FAD): isolation of delta12 and omega-3 fad cDNA clones, expression of delta12 fad in Saccharomyces cerevisiae, and expression of omega-3 fad in Nicotiana tabacum. Biosci Biotechnol Biochem. 2002;66:1314–1327. doi: 10.1271/bbb.66.1314. [DOI] [PubMed] [Google Scholar]
  26. Tang GQ, Novitzky WP, Carol Griffin H, Huber SC, Dewey RE. Oleate desaturase enzymes of soybean: evidence of regulation through differential stability and phosphorylation. Plant J Cell Mol Biol. 2005;44:433–446. doi: 10.1111/j.1365-313X.2005.02535.x. [DOI] [PubMed] [Google Scholar]
  27. Thiyagarajan S, Arumugam M, Senthil N, Vellaikumar S, Kathiresan S. Functional characterization and substrate specificity analysis of Δ6-desaturase from marine microalga Isochrysis sp. Biotechnol Lett. 2018;40:577–584. doi: 10.1007/s10529-017-2501-4. [DOI] [PubMed] [Google Scholar]
  28. Wang J, Chen W, Nian H, Ji X, Lin L, Wei Y, Zhang Q. Inhibition of polyunsaturated fatty acids synthesis decreases growth rate and membrane fluidity of Rhodosporidium kratochvilovae at low temperature. Lipids. 2017;52:729–735. doi: 10.1007/s11745-017-4273-y. [DOI] [PubMed] [Google Scholar]
  29. Zhang P, et al. A novel omega-3 fatty acid desaturase involved in acclimation processes of polar condition from Antarctic ice algae Chlamydomonas sp. ICE-L. Mar Biotechnol (New York, NY) 2011;13:393–401. doi: 10.1007/s10126-010-9309-8. [DOI] [PubMed] [Google Scholar]
  30. Zhang Z, Wei X, Liu W, Min X, Jin X, Ndayambaza B, Wang Y. Genome-wide identification and expression analysis of the fatty acid desaturase genes in Medicago truncatula. Biochem Biophys Res Commun. 2018;499:361–367. doi: 10.1016/j.bbrc.2018.03.165. [DOI] [PubMed] [Google Scholar]
  31. Zhou XR, et al. Isolation and characterization of genes from the marine microalga Pavlova salina encoding three front-end desaturases involved in docosahexaenoic acid biosynthesis. Phytochemistry. 2007;68:785–796. doi: 10.1016/j.phytochem.2006.12.016. [DOI] [PubMed] [Google Scholar]
  32. Zorin B, et al. Arachidonic acid is important for efficient use of light by the microalga Lobosphaera incisa under chilling stress. Biochimica et Biophysica Acta Mol Cell Biol Lipids. 2017;1862:853–868. doi: 10.1016/j.bbalip.2017.04.008. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES