Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2019 Aug 12;9(9):330. doi: 10.1007/s13205-019-1857-7

Identification of potentially novel functions of DNA polymerase zeta catalytic subunit in oriental river prawn, Macrobrachium nipoponense: cloning, qPCR, in situ hybridization and RNAi analysis

Shubo Jin 1, Yuning Hu 2, Hongtuo Fu 1,2,✉, Sufei Jiang 1, Yiwei Xiong 1, Hui Qiao 1, Wenyi Zhang 1, Yongsheng Gong 1, Yan Wu 1
PMCID: PMC6691017  PMID: 31448186

Abstract

The goal of this study was to analyze the functions of DNA polymerase zeta catalytic subunit (Rev3) in the oriental river prawn Macrobrachium nipponense (Mn-Rev3) with a focus on its potential roles in sex differentiation and development. The full length of Mn-Rev3 cDNA sequence was 6832 base pairs (bp) with an open reading frame of 6102 bp encoding 2033 amino acids. Mn-Rev3 showed the closest evolutionary relationship with Penaeus vannamei. The highest expression level of Mn-Rev3 occurred in the hepatopancreas and strong signals were observed in hepatopancreas cells, suggesting that Mn-Rev3 played a role in the immune system. Expression levels of Mn-Rev3 also were relatively high in the androgenic gland and testis, suggesting its potential roles in male sexual differentiation and development. During development, expression of Mn-Rev3 was highest on larval day 15 and relatively high from post-larval day 1 (PL1) to PL15, indicating that it played essential roles in promoting metamorphosis and gonad differentiation and development in M. nipponense. Strong Mn-Rev3 signals were detected in spermatids, spermatocytes, and sperm in the testes, and Mn-Rev3 expression was higher in the testes during the reproductive season than in the non-reproductive season. This result indicated that Rev3 promoted whole testis development, and especially sperm development, in M. nipponense. The expression level of Mn-Rev3 was high from ovary V to ovary II stages, indicating that Rev3 may be involved in yolk deposition. The expression level of Mn-insulin-like androgenic gland hormone (Mn-IAG) and the content of testosterone showed the same expression pattern as that of Mn-Rev3 after injection of double-stranded RNA of Mn-Rev3, which indicated that Rev3 had positive effects on male sexual differentiation and development in M. nipponense. The results of this study advance our understanding of male sexual development in M. nipponense and provide the basis for further studies of male sexual differentiation and development in crustaceans.

Keywords: Macrobrachium nipponense, Rev3, Sexual differentiation and development, RNAi, Testosterone

Introduction

The oriental river prawn, Macrobrachium nipponense (Crustacea; Decapoda; Palaemonidae), is widely distributed in freshwater and low-salinity estuarine regions of China and other Asian countries (Yu and Miyake 1972; Cai and Shokita 2006; Grave and Ghane 2006; Salman et al. 2006; Ma et al. 2011). The annual aquaculture production of M. nipponense reached 205,010 tons in 2016 (Bureau of Fisheries 2016). Male M. nipponense grow faster and reach larger size at harvest time compared to their female counterparts (Yu and Miyake 1972; Ma et al. 2011). Therefore, it is crucial to fully understand the sex differentiation and determination mechanisms of M. nipponense to establish culture techniques to produce all male progeny on a commercial scale.

The androgenic gland is a tissue present in most crustaceans. It produces hormones to promote male sexual differentiation, establish male sexual characteristics, and promote development of the testes (Sagi et al. 1990). Ablation of the androgenic gland from male Macrobrachium rosenbergii resulted in sex reversal to “neo-females”, and all male progeny was generated when the neo-females were mated with normal males (Sagi et al. 1986, 1990; Sagi and Cohen 1990). Thus, studies of the androgenic gland are important for understanding sexual differentiation and development in crustacean species.

Identifying and understanding the functions of the genes in the androgenic gland, especially those that may promote male differentiation and development, are important goals in shrimp aquaculture. The androgenic gland transcriptome and miRNA library have both been constructed for M. nipponense (Jin et al. 2013, 2015). A series of genes identified in the androgenic gland transcriptome have been analyzed and found to be involved in the sex differentiation and determination mechanism of M. nipponense (Jin et al. 2014, 2018a; Li et al. 2015; Ma et al. 2016).

DNA polymerase zeta catalytic subunit (Rev3) was identified from the androgenic gland proteome of M. nipponense. Proteomic profiling analysis of the androgenic gland showed that Rev3 was differentially expressed between the reproductive and non-reproductive seasons. Additionally, expression of Rev3 was higher in the androgenic gland compared to the testes and ovaries. Thus, Rev3 was predicted to be involved in male sexual differentiation and development in M. nipponense (Jin et al. 2018b). Rev3 also has been shown to play essential roles in the immune system. For example, in cultured human fibroblasts, Rev3 decreased UV-induced mutagenesis by carrying out translesion DNA synthesis (Kawamura et al. 2001; Tamuli and Kasbekar 2008). Similar roles of Rev3 in the immune system were also reported in vertebrates (Sonoda et al. 2003), the yeast Saccharomyces cerevisiae (Holbeck and Strathern 1997), and the mold Neurospora crassa (Sakai et al. 2002). The Rev3 gene was reported to be involved in maintaining genome stability and double strand break repair in these species.

The goal of this study was to analyze the functions of Rev3 in M. nipponense, with a focus on its potential roles in sex differentiation and development. The mRNA expression patterns of Rev3 in different tissues, developmental stages, and reproductive cycle stages of ovaries and testis were assessed using quantitative real-time PCR (qPCR). In situ hybridization and RNA interference (RNAi) were performed to further evaluate the functions of Rev3 in M. nipponense. The results of this study advance our understanding of the mechanism of sexual differentiation and development in M. nipponense and provide the basis for further studies in other crustaceans.

Materials and methods

Sample collection

The samples were collected followed by the previous study of our lab. Briefly, different tissues were collected from the healthy adult M. nipponense obtained from Tai Lake in Wuxi, China (120°13′44″E, 31°28′22″N). Specimens for the different stages of larval and post-larval developmental stages were from the full-sibs population, collected with their maturation process. The various phases of ovarian reproductive cycle were obtained according to the standard of previous reports (Qiao et al. 2015). The reproductive season of testis was collected at 28 °C in summer, while the nonreproductive season of tests was collected at 15 °C in winter. The samples were treated with phosphate buffer saline (PBS), and immediately frozen in liquid nitrogen until used for RNA extraction to prevent total RNA degradation.

Rapid amplification of cDNA ends (RACE)

As described in detail previously (Jin et al. 2014, 2018a), total RNA was extracted from androgenic gland as template using RNAiso Plus Reagent (Takara Bio Inc.), followed the protocol of the manufacturer. The RNase-free DNase I (Sangon, Shanghai, China) was used to treat the isolated RNA to eliminate possible genomic DNA contamination. BioPhotometer (Eppendorf, Hamburg, Germany) was used to measure the concentration of the total RNA sample with the A260/A280 in the range of 1.8–2.0. The RNA quality was then measured by 1% agarose gel.

As described in detail previously (Jin et al. 2014, 2018a), a M-MLV reverse transcriptase was used to perform the first strand 3′cDNA and 5′cDNA synthesis for gene cloning using the 3′-Full RACE Core Set Ver.2.0 kit and the 5′-Full RACE kit (Takara Bio Inc., Japan), respectively, with the reaction conditions recommended by the manufacturer. The synthesized cDNAs were kept at − 20 °C. 3′/5′-RACE PCR reactions were performed with the 3′ gene-specific primer (Rev3-3GSP1, Rev3-3GSP2) or 5′GSP (Rev3-5GSP1, Rev3-5GSP2) (Table 1). The partial unigene sequences were obtained from the M. nipponense androgenic gland transcriptome, and the 3′GSP and 5′GSP of each gene were designed based on the unigene sequence. 1% agarose gel was used to measure the PCR product.

Table 1.

Universal and specific primers used in this study

Primer name Nucleotide Sequence (5′ → 3′) Purpose
Rev3-3GSP1 CCATCTACTTCCCATGGTATGT FWD first primer for Rev3 3′ RACE
Rev3 -3GSP2 ATCCATTGACTGCCCTATCATT FWD second primer for Rev3 3′ RACE
3′RACE OUT TACCGTCGTTCCACTAGTGATTT RVS first primer for 3′ RACE
3′RACE IN CGCGGATCCTCCACTAGTGATTTCACTATAGG RVS second primer for 3′ RACE
5′RACE OUT CATGGCTACATGCTGACAGCCTA FWD first primer for 5′ RACE
5′RACE IN CGCGGATCCACAGCCTACTGATGATCAGTCGATG FWD second primer for 5′ RACE
Rev3-RTF AGTGACAGCAACGCTAGTGG FWD primer for Rev3 expression
Rev3-RTR GGCCAAACAACTCTGTCAGC RVS primer for Rev3 expression
EIF-F CATGGATGTACCTGTGGTGAAAC FWD primer for β-actin expression
EIF-R CTGTCAGCAGAAGGTCCTCATTA RVS primer for β-actin expression
Rev3 anti-sense Probe CATCTAATCCCTGCGAAGAGCCTGAAGGAACTTGTGAG Probe for Rev3 ISH analysis
Rev3 sense Probe CTCACAAGTTCCTTCAGGCTCTTCGCAGGGATTAGATG Probe for Rev3 ISH analysis
Rev3 RNAi-F TAATACGACTCACTATAGGGCACACTCGGATACCGTCCTT FWD primer for RNAi analysis
Rev3 RNAi-R TAATACGACTCACTATAGGGAGCCACTCCACAAGGAGAGA RVS primer for RNAi analysis
Open in a new tab

As described in detail previously (Jin et al. 2014, 2018a), the Gel Extraction kit (Sangon, Shanghai, China) was used to cut and purify the PCR products, following the manufacturer’s instructions. Amplified cDNA fragments were transferred into the pMD18-T vector (Takara Bio Inc., Japan). Recombinant bacteria were identified by blue/white screening and confirmed by PCR. An automated DNA sequencer (ABI Biosystem, USA) was used to determine the nucleotide sequences of the cloned cDNAs. BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/) was used to examine the nucleotide sequence similarities. The bioinformatics analysis has been described in detail previously.

Nucleotide sequence and bioinformatics analyses

As described in detail previously (Jin et al. 2014, 2018a), the primer designing tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) was used to design all primers used in this experiment. The 5′ and 3′ sequences from RACEs were assembled with the partial cDNA sequence corresponding to each fragmental sequence by DNAMAN 5.0. The BLASTX and BLASTN search program (http://www.ncbi.nlm.nih.gov/BLAST/) of GenBank was used to analyze the sequences based on the nucleotide and protein databases using. The ORF Finder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict the open reading frame. ClustalW1.81 was used to perform multiple sequence alignment. Molecular Evolutionary Genetics Analysis, MEGA 5.1 was used to construct the phylogenetic trees based on the amino acid sequences using the neighbor-joining method.

qPCR analysis

qPCR was used to measure the relative mRNA expression of Mn-Rev3 in different tissues, different developmental stages, and various reproductive cycle of testis and ovary. The Bio-Rad iCycler iQ5 Real-Time PCR System (Bio-Rad) was used to carry out the SYBR Green RT-qPCR assay. The procedure has been well described in details in previous studies (Jin et al. 2014, 2018a). The primers used for qPCR analysis were listed in Table 1. EIF was used as reference genes (Hu et al. 2018). The androgenic gland templates include undiluted, two times diluted, four times diluted and eight times diluted sample. The slope of the Mn-Rev3 and EIF at different concentrations of diluted samples was 1.312 and 1.323, respectively. Thus, the amplification efficiency between the target gene and EIF is the same in this study. The tissue with lowest expression level was set as 1 (a relative criterion), and other tissues were then compared with the relative criterion.

In situ hybridization

In situ hybridization was performed to analyze the mRNA locations of Mn-Rev3 in different tissues, including various reproductive cycle of ovary, the reproductive season of testis, hepatopancreas and androgenic gland. Primer5 software was used to design the anti-sense and sense probes of chromogenic in situ hybridization (CISH) study with DIG signal based on the cDNA sequence of each gene. The sequences of anti-sense and sense probes are listed in Table 1, and synthesized by Shanghai Sangon Biotech Company. The detailed procedures of in situ hybridization have been well described in previous studies (Jin et al. 2018a; Li et al. 2018). Slides were examined under light microscope for evaluation.

RNA interference (RNAi) analysis

RNAi was performed to analyze the novel roles on Mn-Rev3 in male sexual differentiation and development in M. nipponense. The specific RNAi primer with T7 promoter site was designed using Snap Dragon tools (http://www.flyrnai.org/cgibin/RNAifind_primers.pl), and are shown in Table 2. The Transcript Aid™ T7 High Yield Transcription kit (Fermentas, Inc, USA) was used to synthesize the Mn-Rev3 dsRNA with the reaction conditions recommended by the manufacturer. A total of 300 health mature male M. nipponense with body weight of 3.4–4.6 g were selected and divided into two groups, which are Rev3-dsRNA injection (N = 150) and vehicle injection (N = 150). As described in previous study (Li et al. 2018; Jiang et al. 2014), each prawn was injected with 4 μg/g Vg dsRNA or 4 μg/g vehicles. The Rev3 mRNA expression of the androgenic gland was investigated to detect the interference efficiency by qPCR after injection for 1, 4, 7,10, and 14 days (N ≥ 3). The insulin-like androgenic gland hormone (IAG) mRNA expression was investigated using the same template. Another 8 specimens were collected to measure the content of testosterone.

Table 2.

Amino acid sequence used for phylogenetic analysis of Rev3

Species Accession Number
Macrobrachium nipponense MH817848.1
Penaeus vannamei ROT65379.1
Hyalella azteca XP_018024008.1
Haliaeetus leucocephalus XP_010559968.1
Aquila chrysaetos Canadensis XP_011593804.1
Xenopus laevis XP_018117079.1
Notechis scutatus XP_026522470.1
Odocoileus virginianus texanus XP_020746045.1
Open in a new tab

Measurement of the content of testosterone

Testis were collected from both of the RNAi group and control group (N ≥ 8) after injection the ds-RNA of Mn-Rev3 for 1, 7 and 14 days. The samples were stayed under − 20 °C until the extraction of testosterone. Testosterone was extracted using methyl alcohol. BECKMAN ACESS II T Kit was used to measure the content of testosterone using Beckman Coulter Access 2. All samples were run in triplicate.

Statistical analysis

Quantitative data were expressed as mean ± SD. Statistical differences were estimated by one-way ANOVA followed by LSD and Duncan’s multiple range test. All statistics were measured using SPSS Statistics 13.0. A probability level of 0.05 was used to indicate significance (P < 0.05).

Results

Sequence analysis

The full-length Mn-Rev3 cDNA sequence was 6832 base pairs (bp) with an open reading frame of 6102 bp encoding 2033 amino acids. The 5′ and 3′ untranslated regions of Mn-Rev3 contained 210 bp and 520 bp, respectively. The cDNA sequence of Mn-Rev3 was submitted to GenBank with accession no MH817848.

Table 2 lists the species used to conduct Rev3 amino acid sequence BLAST analysis. Mn-Rev3 showed the highest sequence similarity with Penaeus vannamei, with a BLASTP similarity value of 66%. The identities between Mn-Rev3 and other well-defined Rev3 amino acid sequences were 49–53%. MEGA 5.1 was used to construct a condensed phylogenetic tree using the neighbor-joining method. The phylogenetic tree had two main branches; one included amino acid sequences from M. nipponense and P. vannamei, and the other included the amino acids sequences from the other species (Fig. 1). Mn-Rev3 showed the closest evolutionary relationship with other crustacean species.

Fig. 1.

Fig. 1

Open in a new tab

The phylogenetic tree of Rev3 from different organisms based on amino acid sequence comparisons. Species names and types of Rev3 are listed on the right of the tree

Expression of Mn-Rev3 in different tissues and developmental stages

Tissue distribution was determined by qPCR, which may reflect the physiological functions of a given protein. Among the different mature tissues (Fig. 2a), the highest expression of Mn-Rev3 occurred in the hepatopancreas (P < 0.05), followed by the androgenic gland and testes. Expression levels in the heart and ovaries were relatively low.

Fig. 2.

Fig. 2

Open in a new tab

Expression characterization of Mn-Rev3 in different tissues and developmental stages. The amount of Mn-Rev3 mRNA was normalized to the EIF transcript level. Data are shown as mean ± SD (standard deviation) of tissues from three separate individuals. Capital letters indicate expression difference between different samples. a Expression characterization in different tissues. b Expression characterization in different developmental stages

During the larval and post-larval developmental stages, Mn-Rev3 mRNA expression was lowest at larval developmental stage day 5 (L5) and peaked at L15. The expression level at L15 was 60.78-fold higher than that of L5 (P < 0.05). Although Mn-Rev3 mRNA expression gradually decreased from post-larval developmental stage day 1 (PL1) to PL15, it remained at a relatively high level compared with the levels for the larval developmental stage (Fig. 2b).

Expression of Mn-Rev3 during the reproductive cycle of testes and ovaries

During the reproductive cycle of the ovary (Fig. 3a), Mn-Rev3 mRNA expression peaked at stage II, followed by stages I and V. The lowest expression of Mn-Rev3 occurred in stage III. The gene expression level at stage II was 5.11-fold higher than that at stage III (P < 0.05). The gene expression level in the testes during the reproductive season was 2.97-fold higher than that during the non-reproductive season (P < 0.05) (Fig. 3b).

Fig. 3.

Fig. 3

Open in a new tab

Expression characterization of Mn-Rev3 in different reproductive cycles of testis and ovary. The amount of Mn-Rev3 mRNA was normalized to the EIF transcript level. Data are shown as mean ± SD (standard deviation) of tissues from three separate individuals. Capital letters indicate expression difference between different samples. a Expression characterization in different reproductive cycles of ovary. b Expression characterization in different reproductive season of testis

In situ hybridization analysis

The mRNA locations were determined in various phases of the ovarian reproductive cycle and in the testis, androgenic gland, and hepatopancreas by in situ hybridization. The fixed tissue samples were subjected to haematoxylin and eosin (HE) staining as well as in situ hybridization. HE staining showed that the mature testis included spermatids, spermatocytes, and sperm, but sperm were the dominant cells. The androgenic gland consisted of a funicular structure and androgenic gland cells. The hepatopancreas contained lipid granules and hepatopancreas cells (Fig. 4). Oogonia and follicle cells were observed in the stage I ovary, and they were derived via differentiation from ovarian epithelial cells. The follicular cavity formed from the follicle cells and were visible in stage II. Oocyte volume gradually increased in stage III, and yolk granules accumulated and were visible in the oocyte (stage IV) due to oogenesis and vitellogenesis development (Fig. 5). The in situ hybridization results revealed strong signals for Rev3 mRNA in all cells of the mature testis, including spermatids, spermatocytes, and sperm. In the androgenic gland, strong signals were observed in the funicular structure surrounding the androgenic gland cells, but no signal was directly observed in androgenic gland cells. Strong signals were observed in hepatopancreas cells but not in lipid granules (Fig. 4). Strong signals also were observed in oocytes and the cytoplasmic membrane in of ovary stages I, II, and V, but no signals were found in the nucleus and follicular cells. In ovary stages III and IV, strong signals were only detected in the nucleus (Fig. 5). No signals were observed when the sense RNA probe was used.

Fig. 4.

Fig. 4

Open in a new tab

Location of Rev3 gene was detected in testis, androgenic gland and hepatopancreas of M. nipponense by using in situ hybridization. Testis, androgenic gland and hepatopancreas were sampled at reproductive season. AG androgenic gland, ST spermatid, SC spermatocyte, SP sperm, M muscle, C androgenic gland cell, FS funicular structure, He hepatopancreas, LG lipid granules, HC hepatocytes. Scale bars = 50 μm

Fig. 5.

Fig. 5

Open in a new tab

Location of Rev3 gene was detected in Ovary I to Ovary V of M. nipponense using in situ hybridization. OC oocyte, N nucleus, CM cytoplasmic membrane, Y yolk granule, FC follicle cell. Scale bars = 50 μm

RNAi analysis

To evaluate the potentially novel functions of Mn-Rev3 in male sexual differentiation and development, RNAi analysis was performed in male samples. According to the qPCR analysis (Fig. 6a), Mn-Rev3 expression remained at a stable level over time in the control group (P > 0.05). However, Mn-Rev3 expression in the RNAi group gradually decreased from day 1 to day 7 and reached the lowest expression level on day7 (75% decrease of that in the control group on the same day). Expression then slightly increased up to day 14. The Mn-Rev3 expression levels on days 4, 7, and 10 after the injection of Mn-Rev3 double-stranded RNA (dsRNA) were significantly lower in the RNAi group compared to the control group (P < 0.05).

Fig. 6.

Fig. 6

Open in a new tab

Expression characterization of Mn-Rev3 and Mn-IAG at different days after Mn-Rev3 dsRNA injection. The amount of Mn-Rev3 and Mn-IAG mRNA was normalized to the EIF transcript level. Data are shown as mean ± SD (standard deviation) of tissues from three separate individuals. *Indicates significant expression difference between the RNAi group and control group at the sample day. a Expression characterization of Mn-Rev3 after Mn-Rev3 dsRNA injection. b Expression characterization of Mn-IAG after Mn-Rev3 dsRNA injection

We also evaluated the regulatory role of Mn-Rev3 with Mn-IAG (Fig. 6b). Mn-IAG expression levels were measured using the same cDNA template of the control and RNAi group. According to the qPCR analysis, Mn-IAG expression also remained stable over time in the control group (P > 0.05). However, Mn-IAG expression in the RNAi group showed the same expression pattern as that of Mn-Rev3. Mn-IAG expression gradually decreased from day 1 to day 7, had the lowest expression on day 7 (65% decrease compared with the same day for the control group), and expression levels on days 4, 7, and 10 after the injection of Mn-Rev3 dsRNA were significantly lower in the RNAi group compared to the control group (P < 0.05).

The contents of testosterone were also measured on days 1, 7, and 14 after Mn-Rev3 dsRNA injection (Fig. 7). The content of testosterone in the RNAi group was dramatically lower than that of the control group on the same day. The content of testosterone was lowest on day 7 in the RNAi group, which was 40% of the control group value on the same day (P < 0.05).

Fig. 7.

Fig. 7

Open in a new tab

Measurement the content of testosterone at different days after Mn-Rev3 dsRNA injection. Data are shown as mean ± SD (standard deviation) of tissues from three separate individuals. *Indicates significant expression difference between the RNAi group and control group at the sample day

Discussion

In a previous study, Rev3 was predicted to be a strong candidate gene for involvement in the sexual differentiation and development of M. nipponense. Rev3 also has been shown to have regulatory roles in the immune system (Holbeck and Strathern 1997; Kawamura et al. 2001; Sakai et al. 2002; Sonoda et al. 2003; Tamuli and Kasbekar 2008). In this study, we analyzed the functions of Rev3 in M. nipponense, focusing on its potential roles in sexual differentiation and development.

We performed qPCR analysis of Mn-Rev3 in various tissues and developmental stages of M. nipponense and in different parts of the reproductive cycle of the testes and ovaries. Expression of Mn-Rev3 was highest in the hepatopancreas, which is a major organ involved in the immune system. It produces digestive enzymes, absorbs digested food, and stores heavy metals. The high expression of Mn-Rev3 in the hepatopancreas indicated its important regulatory role in the immune system of M. nipponense. Mn-Rev3 expression also was relatively high in the androgenic gland and testis compared with the heart and ovary, indicating that it may play additional roles in male sexual differentiation and development in M. nipponense (Jin et al. 2018a). Mn-Rev3 expression was dramatically high at day 15 during larval development, indicating that it has positive effects on metamorphosis of M. nipponense (Zhang et al. 2013a, b). Mn-Rev3 expression gradually decreased from PL1 to PL15 during post-larval development, but the expression level still was higher level than that at L1–L10. Previous studies reported that the sensitive period for sex differentiation in M. nipponense was from PL7 to PL19 (Jin et al. 2016). The relatively high level of Mn-Rev3 expression during this sensitive period indicated that Rev3 may be involved in activation and promotion of gonad differentiation and development of M. nipponense.

In situ hybridization has been widely used to study gene function in M. nipponense. However, to the best of our knowledge, no previous studies focused on in situ hybridization of Rev3 in any species. In this study, strong signals for Mn-Rev3 were detected in spermatids, spermatocytes, and sperm, indicating that Rev3 is involved in the development of the whole testis. Mn-Rev3 expression in the testis also was dramatically higher during the reproductive season than during the non-reproductive season. Histological observation showed that spermatids were the dominant cells and spermatocytes and sperm were sparse during the non-reproductive season, whereas the majority of cells during the reproductive season were sperm. This result suggests that Rev3 plays an important role in sperm development. A strong Mn-Rev3 signal was observed in oocytes in ovary stages I, III, and V, indicating that it may be involved in ovarian development and yolk deposition (Li et al. 2018). Mn-Rev3 mRNA expression peaked at stage II, followed by stages I and V, which also indicated the important roles of Mn-Rev3 in ovarian development and yolk deposition in M. nipponense. Strong Mn-Rev3 signals were observed in the funicular structure surrounding the androgenic gland cells, but no signal was detected in androgenic gland cells. Histological observations of the post-larval developmental stages of M. nipponense indicated that the androgenic gland developed first via formation of the funicular structure, which was followed by formation of the androgenic gland cells (Jin et al. 2016). The lack of a Mn-Rev3 signal in androgenic gland cells indicated that Rev3 was not directly secreted by the androgenic gland, whereas the strong signals in the funicular structure suggested its essential role in the development of the funicular structure, which in turn promoted and supported the formation of androgenic gland cells. The strong signals in hepatopancreas cells suggested that the hepatopancreas played an important role in the immune system in M. nipponense.

RNAi is a technique in which gene expression or translation is inhibited by short dsRNA molecules in a cell’s cytoplasm (Tautz and Pfeifle 1989; Kusaba 2004; Jones 2005; Smith et al. 2009). RNAi has been widely used in gene function analysis in M. nipponense (Li et al. 2015, 2018; Qiao et al. 2018). In this study, Mn-Rev3 expression in the RNAi group was significantly lower than that of the control group on the same day, which indicated that the dsRNA effectively inhibited Mn-Rev3 expression. We also examined the regulatory relationship between Rev3 and IAG in M. nipponense. IAG is a hormone that is secreted by the androgenic gland. IAG is known to play essential roles in male differentiation and development in crustacean species (Ventura et al. 2009, 2011; Rosen et al. 2010). Ventura et al. (2012) reported that RNAi of IAG had a significant inhibitory effect on male sexual differentiation and development of the secondary sexual characteristics and spermatogenesis in Macrobrachium rosenbergii. IAG also has been shown to be specially expressed in the androgenic gland (Ma et al. 2016). In our study, qPCR analysis revealed that the Mn-IAG expression pattern was the same as that of Mn-Rev3 after injection with Mn-Rev3 dsRNA. In addition, the content of testosterone in the RNAi group was lower than that of the control group on the same day. Testosterone is a steroid hormone secreted by the testis or the ovaries and by the adrenal gland in small amounts. It has dramatic effects on maintaining muscle strength and quality, maintaining bone density and strength, and improving physical fitness (Södergård et al. 1982; Steidle et al. 2003; Page et al. 2005). The absence of testosterone in males can result in primary male sexual hypofunction, including Klinefelter syndrome, cryptorchidism, and interstitial dysplasia or dysplasia (Behre et al. 1999; Steidle et al. 2003). Testosterone was shown to cause sex reversal in fish species such as red tilapia (Cao et al. 1994), allogynogenetic crucian carp (Lou et al. 1994; Zhang et al. 2000), and the grouper Epinephelus akaara (Li et al. 2006). In crustacean species, testosterone can promote testis and sperm development (Kang et al. 1998), and it was shown to be involved in early gonad differentiation and development in M. nipponense (Jin et al. 2016). The results of our study suggested that Rev3 had positive effects on male sexual differentiation and development in M. nipponense by regulating the expression of IAG and secretion of testosterone.

In conclusion, we analyzed the potentially novel functions of Rev3 in male sexual differentiation and development of M. nipponense using qPCR, in situ hybridization, and RNAi. RNAi analysis indicated that Mn-Rev3 mRNA expression, Mn-IAG expression, and the content of testosterone showed similar patterns. These results suggested that Rev3 had positive effects on male sexual differentiation and development in M. nipponense.

Acknowledgements

This research was supported by grants from Central Public-interest Scientific Institution Basal Research Fund CAFS (2019JBFM02, 2019JBFM04); the National Key R&D Program of China (2018YFD0900201, 2018YFD0901303); Central Public-interest Scientific Institution Basal Research Fund CAFS (2019JBFM04); Jiangsu Agricultural Industry Technology System (JFRS-02); the National Natural Science Foundation of China (31572617); the China Agriculture Research System-48 (CARS-48); the New cultivar breeding Major Project of Jiangsu province (PZCZ201745).

Author’s contribution

SJ, HF, YH, and HQ: Conceived and designed the experiments. SJ, YH, YG, and WZ: Performed the experiments. The specimens were maintained by SJ, and YX. SJ: Analyzed the data. YG and YW: Contributed reagents/materials/analysis tools.

Compliance with ethical standards

Conflict of interest

We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted.

Ethical statements

All experiments involving M. nipponense in this study have been approved by Institutional Animal Care and Use Ethics Committee of the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences (Wuxi, China).

References

  1. Behre HM, Abshagen K, Oettel M, Hübler D, Nieschlag E. Intramuscular injection of testosterone undecanoate for the treatment of male hypogonadism: phase I studies. Eur J Endocrinol. 1999;140(5):414–419. doi: 10.1530/eje.0.1400414. [DOI] [PubMed] [Google Scholar]
  2. Bureau of Fisheries, Ministry of Agriculture, P.R.C . Fisheries economic statistics. In: Zhao XW, editor. China fishery yearbook. Beijing: China Agricultural Press; 2016. [Google Scholar]
  3. Cai Y, Shokita S. Report on a collection of freshwater shrimps (Crustacea: Decapoda: Caridea) from the Philippines, with descriptions of four new species. Raffles Bull Zool. 2006;54:245–270. [Google Scholar]
  4. Cao LQ, Tao YG, Tan HZ. Studies on unisexualization in Red Tipapia. J Fish China. 1994;18(1):75–80. [Google Scholar]
  5. Grave SD, Ghane A. The establishment of the oriental river prawn, Macrobrachium nipponense (de Haan, 1849) in Anzali Lagoon, Iran. Aquat Invasions. 2006;1(4):204–208. doi: 10.3391/ai.2006.1.4.2. [DOI] [Google Scholar]
  6. Holbeck SL, Strathern JN. A role for REV3 in mutagenesis during double-strand break repair in Saccharomyces cerevisiae. Genetics. 1997;147(3):1017–1024. doi: 10.1093/genetics/147.3.1017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hu YN, Fu HT, Qiao H, Sun SM, Zhang WY, Jin SB, Jiang SF, Gong YS, Xiong YW, Wu Y. Validation and evaluation of reference genes for quantitative real-time PCR in Macrobrachium nipponense. Int J Mol Sci. 2018;19(8):2258. doi: 10.3390/ijms19082258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Jiang FW, Fu HT, Qiao H, Zhang WY, Jiang SF, Xiong YW, Sun SM, Gong YS, Jin SB. The RNA interference regularity of transformer-2 gene of oriental river prawn Macrobrachium nipponense. Chinese Agricult Sci Bull. 2014;30(32):32–37. [Google Scholar]
  9. Jin SB, Fu HT, Zhou Q, Sun SM, Jiang SF, Xiong YW, Gong YS, Qiao H, Zhang WY. Transcriptome analysis of androgenic gland for discovery of novel genes from the oriental river prawn, Macrobrachium nipponense, using Illumina Hiseq 2000. PLoS ONE. 2013;8(10):e76840. doi: 10.1371/journal.pone.0076840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jin SB, Jiang SF, Xiong YW, Qiao H, Sun SM, Zhang WY, Gong YS, Fu HT. Molecular cloning of two tropomyosin family genes and expression analysis during development in oriental river prawn, Macrobrachium nipponense. Gene. 2014;546:390–397. doi: 10.1016/j.gene.2014.05.014. [DOI] [PubMed] [Google Scholar]
  11. Jin SB, Fu HT, Jiang SF, Xiong YW, Qiao H, Zhang WY, Gong YS, Wu Y. Identification of androgenic gland microRNAs and their targeted genes for discovery of sex-related microRNAs in oriental river prawn, Macrobrachium nipponense. Gen Mol Res. 2015;14(4):18396–18406. doi: 10.4238/2015.December.23.27. [DOI] [PubMed] [Google Scholar]
  12. Jin SB, Zhang Y, Guan HH, Fu HT, Jiang SF, Xiong YW, Qiao H, Zhang WY, Gong YS, Wu Y. Histological observation of gonadal development during post-larva in oriental river prawn, Macrobrachium nipponense. Chin J Fish. 2016;29(4):11–16. [Google Scholar]
  13. Jin SB, Fu HT, Jiang SF, Xiong YW, Sun SM, Qiao H, Zhang WY, Gong YS, Wu Y. Molecular cloning, expression, and in situ hybridization analysis of Forkhead Box Protein L2 during development in Macrobrachium nipponense. J World Aquacult Soc. 2018;49(2):429–440. doi: 10.1111/jwas.12510. [DOI] [Google Scholar]
  14. Jin SB, Fu HT, Sun SM, Jiang SF, Xiong YW, Gong YS, Qiao H, Zhang WY, Wu Y. iTRAQ-based quantitative proteomic analysis of the androgenic glands of the oriental river prawn, Macrobrachium nipponense, during nonreproductive and reproductive seasons. Comp Biochem Physiol D. 2018;26:50–57. doi: 10.1016/j.cbd.2018.03.002. [DOI] [PubMed] [Google Scholar]
  15. Jones HD. Wheat transformation: current technology and applications to grain development and composition. J Cereal Sci. 2005;41(2):137–147. doi: 10.1016/j.jcs.2004.08.009. [DOI] [Google Scholar]
  16. Kang XJ, Liu ZM, Zhou KX, Wang SA. Primary study of exogenous steroid hormone effect on the testis development of the Chinese Mitten-Handed Crab, Eriocheir sinensis (Crustcea, Decapoda) Donghai Mar Sci. 1998;16(1):39–44. [Google Scholar]
  17. Kawamura K, Wang JO, Bahar R, Koshikawa N, Shishikura T, Nakagawara A, Sakiyama S, Kajiwara K, Kimura M, Tagawa M. The error-prone DNA polymerase zeta catalytic subunit (Rev3) gene is ubiquitously expressed in normal and malignant human tissues. Int J Oncol. 2001;18(1):97–103. doi: 10.3892/ijo.18.1.97. [DOI] [PubMed] [Google Scholar]
  18. Kusaba M. RNA interference in crop plants. Curr Opin Biol. 2004;15:139–143. doi: 10.1016/j.copbio.2004.02.004. [DOI] [PubMed] [Google Scholar]
  19. Li GL, Liu XC, Lin HR. Effects of 17α-methyltestosterone on sex reversal in red-spotted grouper, Epinephelus akaara. J Fish China. 2006;30(2):145–150. [Google Scholar]
  20. Li FJ, Bai HK, Xiong YW, Fu HT, Jiang SF, Jiang SF, Jin SB, Sun SM, Qiao H, Zhang WY. Molecular characterization of insulin-like androgenic gland hormone-binding protein gene from the oriental river prawn Macrobrachium nipponense and investigation of its transcriptional relationship with the insulin-like androgenic gland hormone gene. Gen Comp Endocr. 2015;216(6):152–160. doi: 10.1016/j.ygcen.2014.12.007. [DOI] [PubMed] [Google Scholar]
  21. Li F, Qiao H, Fu HT, Sun SM, Zhang WY, Jin SB, Jiang SF, Gong YS, Xiong YW, Wu Y, Hu YN, Shan DY. Identification and characterization of opsin gene and its role in ovarian maturation in the oriental river prawn Macrobrachium nipponense. Comp Biochem Physiol B. 2018;218:1–12. doi: 10.1016/j.cbpb.2017.12.016. [DOI] [PubMed] [Google Scholar]
  22. Lou YD, Song TF, Wang YM, Wei H, Wu MC, Xu HM, Wang ZQ. Studies on sex control in allogynogenetic crucian carp. J Fish China. 1994;3:169–176. [Google Scholar]
  23. Ma KY, Feng JB, Lin JY, Li JL. The complete mitochondrial genome of Macrobrachium nipponense. Gene. 2011;487(2):160–165. doi: 10.1016/j.gene.2011.07.017. [DOI] [PubMed] [Google Scholar]
  24. Ma KY, Li JL, Qiu GF. Identification of putative regulatory region of insulin-like androgenic gland hormone gene (IAG) in the prawn Macrobrachium nipponense and proteins that interact with IAG by using yeast two-hybrid system. Gen Comp Endocr. 2016;229:112–118. doi: 10.1016/j.ygcen.2016.03.019. [DOI] [PubMed] [Google Scholar]
  25. Page ST, Amory JK, Bowman FD, Anawalt BD, Matsumoto AM, Bremner WJ, Tenover JL. Exogenous testosterone (T) alone or with finasteride increases physical performance, grip strength, and lean body mass in older men with low serum T. J Clin Endocrinol Metab. 2005;90(3):1502–1510. doi: 10.1210/jc.2004-1933. [DOI] [PubMed] [Google Scholar]
  26. Qiao H, Xiong YW, Zhang WY, Fu HT, Jiang SF, Sun SM, Bai HK, Jin SB, Gong YS. Characterization, expression, and function analysis of gonad-inhibiting hormone in oriental river prawn, Macrobrachium nipponense and its induced expression by temperature. Comp Biochem Physiol A. 2015;185:1–8. doi: 10.1016/j.cbpa.2015.03.005. [DOI] [PubMed] [Google Scholar]
  27. Qiao H, Jiang FW, Xiong YW, Jiang SF, Fu HT, Li F, Zhang WY, Sun SM, Jin SB, Gong YS, Wu Y. Characterization, expression patterns of molt-inhibiting hormone gene of Macrobrachium nipponense and its roles in molting and growth. PLoS ONE. 2018;13(6):e0198861. doi: 10.1371/journal.pone.0198861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rosen O, Manor R, Weil S, Gafni O, Linial A, Aflalo ED, Ventura T, Sagi A. A sexual shift induced by silencing of a single insulin-like gene in crayfish: ovarian upregulation and testicular degeneration. PLoS ONE. 2010;5:e15281. doi: 10.1371/journal.pone.0015281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sagi A, Cohen D. Growth, maturation and progeny of sex-reversed Macrobrachium rosenbetgii males. World Aquac. 1990;21(4):87–90. [Google Scholar]
  30. Sagi A, Cohen D, Wax Y. Production of Macrobrachium rosenbetgii in momosex population: yield characteristes under intensive monoculture conditions in cages. Aquaculture. 1986;51(3–4):265–275. doi: 10.1016/0044-8486(86)90318-2. [DOI] [Google Scholar]
  31. Sagi A, Cohen D, Milner Y. Effect of androgenic gland ablation on morphotypic differentiation and sexual characteristics of male freshwater prawns, Macrobrachium rosenbergii. Gen Comp Endocr. 1990;77:15–22. doi: 10.1016/0016-6480(90)90201-V. [DOI] [PubMed] [Google Scholar]
  32. Sakai W, Ishii C, Inoue H. The upr-1 gene encodes a catalytic subunit of the DNA polymerase zeta which is involved in damage-induced mutagenesis in Neurospora crassa. Mol Genet Genomics. 2002;267(3):401–408. doi: 10.1007/s00438-002-0671-8. [DOI] [PubMed] [Google Scholar]
  33. Salman SD, Page TJ, Naser MD, Yasser AG. The invasion of Macrobrachium nipponense (De Haan, 1849) (Caridea: Palaemonidae) into the southern Iraqi marshes. Aquat Invasions. 2006;1(3):109–115. doi: 10.3391/ai.2006.1.3.2. [DOI] [Google Scholar]
  34. Smith CA, Roeszler KN, Ohnesorg T, Cummins DM, Farlie PG, Doran TJ, Sinclair AH. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature. 2009;461:267–271. doi: 10.1038/nature08298. [DOI] [PubMed] [Google Scholar]
  35. Södergård R, Bäckström T, Shanbhag V, Carstensen H. Calculation of free and bound fractions of testosterone and estradiol-17 beta to human plasma proteins at body temperature. J Steroid Biochem. 1982;16(6):801–810. doi: 10.1016/0022-4731(82)90038-3. [DOI] [PubMed] [Google Scholar]
  36. Sonoda E, Okada T, Zhaol GY, Tateishi S, Araki K, Yarnaizumi M, Yagi T, Verkaik NS, van Gent DC, Takata M, Takeda S. Multiple roles of Rev3, the catalytic subunit of pole in maintaining genome stability in vertebrates. EMBO J. 2003;22(12):3188–3197. doi: 10.1093/emboj/cdg308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Steidle C, Schwartz S, Jacoby K, Sebree T, Smith T, Bachand R, North American AA2500 T Gel Study Group AA2500 testosterone gel normalizes androgen levels in aging males with improvements in body composition and sexual function. J Clin Endocrinol Metab. 2003;88(6):2673–2681. doi: 10.1210/jc.2002-021058. [DOI] [PubMed] [Google Scholar]
  38. Tamuli R, Kasbekar D. Dominant suppression of repeat-induced point mutation in Neurospora crassa by a variant catalytic subunit of DNA polymerase-zeta. Genetics. 2008;178(3):1169–1176. doi: 10.1534/genetics.107.079483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Tautz D, Pfeifle C. A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma. 1989;98(2):81–85. doi: 10.1007/BF00291041. [DOI] [PubMed] [Google Scholar]
  40. Ventura T, Manor R, Aflalo ED, Weil S, Raviv S, Glazer L, Sagi A. Temporal silencing of an androgenic gland-specific insulin-like gene affecting phenotypical gender differences and spermatogenesis. Endocrinology. 2009;150:1278–1286. doi: 10.1210/en.2008-0906. [DOI] [PubMed] [Google Scholar]
  41. Ventura T, Manor R, Aflalo ED, Weil S, Khalaila I, Rosen O, Sagi A. Expression of an androgenic gland-specific insulin-like peptide during the course of prawn sexual and morphotypic differentiation. ISRN Endocrinol. 2011;2011:476283. doi: 10.5402/2011/476283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ventura T, Manor R, Aflalo ED, Weil S, Rosen O, Sagi A. Timing sexual differentiation: full functional sex reversal achieved through silencing of a single insulin-like gene in the prawn, Macrobrachium rosenbergii. Biol Reprod. 2012;86:90. doi: 10.1095/biolreprod.111.097261. [DOI] [PubMed] [Google Scholar]
  43. Yu H, Miyake S. Five species of the genus Macrobrachium (Crustacea, Decapoda, Palaemonidae) from Taiwan. OHMU. 1972;3:45–55. [Google Scholar]
  44. Zhang PY, Hu W, Wang YP, Zhu ZY. Methyltestosterone induction of sex reversal in allogynogenetic crucian carp. Hereditas. 2000;22(1):25–27. [Google Scholar]
  45. Zhang YP, Qiao H, Zhang WY, Sun SM, Jiang SF, Gong YS, Xiong YW, Jin SB, Fu HT. Molecular cloning and expression analysis two sex-lethal homolog genesduring development in oriental river prawn, Macrobrachium nipponense. Genet Mol Res. 2013;12(4):4698–4711. doi: 10.4238/2013.October.18.8. [DOI] [PubMed] [Google Scholar]
  46. Zhang YP, Fu HT, Qiao H, Jin SB, Gong YS, Jiang SF, Xiong YW. cDNA cloning, characterization and expression analysis of a transformer-2 gene in the oriental river prawn, Macrobrachium nipponense. J World Aquacult Soc. 2013;44(3):338–349. doi: 10.1111/jwas.12039. [DOI] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES