Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Sep 1.
Published in final edited form as: Diagn Microbiol Infect Dis. 2019 Apr 29;95(1):59–66. doi: 10.1016/j.diagmicrobio.2019.04.011

Development of a multiplex real-time RT-PCR assay for simultaneous detection and differentiation of Influenza A, B, C and D viruses

Hewei Zhang 1,4, Yin Wang 1, Elizabeth Porter 1, Nanyan Lu 1, Yanhua Li 2, Fangfeng Yuan 1, Molly Lohman 1, Lance Noll 1, Wanglong Zheng 1, Colin Stoy 1, Yuekun Lang 2, Victor Huber 3, Wenjun Ma 2, Lalitha Peddireddi 1,2, Ying Fang 2, Jishu Shi 5, Gary Anderson 1,2, Xuming Liu 1,2,*, Jianfa Bai 1,2,*
PMCID: PMC6697560  NIHMSID: NIHMS1530916  PMID: 31130238

Abstract

Influenza is a common and contagious respiratory disease caused by influenza A, B, C, and D viruses (IAV, IBV, ICV, and IDV). A multiplex real-time RT-PCR assay was developed for simultaneous detection of IAV, IBV, ICV, and IDV. The assay was designed to target unique sequences in the matrix gene of IBV and ICV, the RNA polymerase subunit PB1 of IDV, and combined with USDA and CDC IAV assays, both target the matrix gene. The host 18S rRNA gene was included as an internal control. In silico analyses indicated high strain coverages: 97.9% for IBV, 99.5% for ICV, and 100% for IDV. Transcribed RNA, viral isolates and clinical samples were used for validation. The assay specifically detected target viruses without cross-reactivity, nor detection of other common pathogens. The limit of detection was approximately 30 copies for each viral RNA template, which was equivalent to a threshold cycle value of ~37.

Keywords: Influenza virus, Swine, Bovine, Multiplex PCR, Real-time PCR

1. Introduction

Influenza is a highly contagious viral respiratory disease caused by influenza viruses, which are single-strand, negative sense RNA viruses. The viruses belong to the family Orthomyxoviridae and are classified into four influenza virus genera. Each genus contains only one species, designated as influenza A, B, C, and D virus (IAV, IBV, ICV, and IDV) (King et al., 2018, Vemula et al., 2016). Influenza genomes are highly variable due to frequently occurred reassortments and mutations (Brockwell-Staats et al., 2009, Lowen, 2017, Lyons and Lauring, 2018, Steel and Lowen, 2014).

IAV is the most common and widely distributed pathogen that can infect humans, pigs, cattle, birds, and other animals (Nelson and Vincent, 2015, Vemula et al., 2016). The natural host and reservoir of IBV was long assumed to be restricted exclusively to humans, but recent serological, molecular, and experimental infection studies demonstrated that pigs are also susceptible to IBV infection (Ran et al., 2015), which supports and extends the previous observations made in the 1960s (Takátsy et al., 1969, Takatsy et al., 1967). ICV was first identified in humans in 1947, and it was originally thought to be exclusively a human pathogen until 1981, when it was also isolated from pigs in China (Yuanji and Desselberger, 1984, Yuanji et al., 1983), and recently identified in cattle in the US (Zhang et al., 2018a, Zhang et al., 2018b). IDV was first isolated and characterized in swine in 2011, and later identified in cattle (Collin et al., 2015, Hause et al., 2014, Hause et al., 2013, Mitra et al., 2016). Most recently, IDV infections in swine and bovine herds have been widely reported in China, Italy, Mexico, France, and Japan (Chiapponi et al., 2016, Foni et al., 2017, Horimoto et al., 2016, Rosignoli et al., 2017, Zhai et al., 2017).

Human and animal IAV and IBV have been well studied and various well-characterized diagnostic assays are available (Banerjee et al., 2018, Bell et al., 2014, Bruning et al., 2017, Cho et al., 2013, Vemula et al., 2016). However, there is a pressing need to develop new diagnostic assays, particularly those that can detect and differentiate multiple pathogens for rapid and accurate detection and differentiation of the two under-studied and under-diagnosed influenza viruses, ICV, and IDV.

Real-time PCR is considered the most practical and sensitive approach for identification of influenza viruses and other pathogens in most diagnostic laboratories (Hoffmann et al., 2009, Kralik and Ricchi, 2017, Vemula et al., 2016). Currently, the United States Department of Agriculture (USDA)-validated real-time RT-PCR (RT-qPCR) assay for detection of IAV in swine samples (adapted from an avian influenza assay) can generally cover the Eurasian and North American swine IAV and the 2009 pandemic H1N1 lineages of swine-origin (Slomka et al., 2010, Spackman and Suarez, 2008, Zhang and Harmon, 2014). In addition, the Centers for Disease Control and Prevention (CDC) RT-qPCR protocol for the universal detection of type A influenza viruses has been recommended by the World Health Organization (WHO) (Selvaraju and Selvarangan, 2010). Singleplex RT-qPCR assays were developed for the detection of IBV in humans (Ran et al., 2015, Selvaraju and Selvarangan, 2010), and ICV in humans (Faux, 2010, Howard et al., 2017, Pabbaraju et al., 2013, Salez et al., 2014), as well as IDV in swine and cattle (Faccini et al., 2017, Hause et al., 2013). Multiplex real-time RT-PCR (RT-mqPCR) assays were also developed for simultaneous detection of IBV and IAV (Hindiyeh et al., 2013, Hindiyeh et al., 2005, Smith et al., 2003, Templeton et al., 2004, Van Elden et al., 2001). However, no RT-mqPCR assay has been reported so far for simultaneous detection of any three or four influenza viruses. Due to frequent mutations in the viral genomes (Stellrecht, 2018), and more sequences have been identified every year, the previously designed RT-qPCR assays may not be able to detect the majority of current field strains and variants especially for ICV and IDV viruses. In silico analyses indicated that many published primers and probes have low coverage rates against the currently available influenza virus sequences, and the coverage rates of the above mentioned RT-qPCR assays are lower than 90%, and most of them are ranging from 40% to 60%. Such coverage rates are not sufficient to meet the needs for influenza surveillance and diagnosis.

The main objective of this study was to develop and validate a high-coverage, highly sensitive and specific RT-mqPCR assay to simultaneously detect and differentiate IAV, IBV, ICV, and IDV strains. In this study, RT-mqPCR assays for specific detection of IBV, ICV, and IDV (plus an internal control) were developed by designing primers and probes based on all currently available sequences. Then a 4-plex assay was formed and optimized by combining the IBV, ICV, and IDV assays with the internal control. The newly developed 4-plex IBV, ICV, and IDV assay was further combined with the currently used IAV assays recommended by USDA as well as OIE (World Organisation for Animal Health), CDC and WHO. The resulting 5-plex RT-mqPCR assay was optimized and validated for simultaneous detection and differentiation of all four influenza viruses.

2. Materials and methods

The American Association of Veterinary Laboratory Diagnosticians (AAVDL) and OIE standard guidelines on the basic procedures and quality control for the development, optimization, and validation of molecular assays were followed. The major protocols are described similarly in our previous publication (Shi et al., 2016).

2.1. Samples and virus isolates

A total of 720 swine clinical samples and 1,525 bovine clinical samples (including nasal swab, oral fluid, lung, blood, feces and stomached organ tissue homogenate) were collected from Kansas State Veterinary Diagnostic Laboratory (KSVDL) during 2016 and 2017 and were subjected to testing with the newly developed 5-plex assay. Additional 38 known swine IAV positive samples were collected at an abattoir in Iowa during 2012–2014, and 1 IAV, 4 IBV, 1 ICV, and 6 IDV cell isolates were kindly provided by Drs. Wenjun Ma and Jishu Shi of Kansas State University College of Veterinary Medicine.

2.2. Design of real-time RT-PCR assays

As the matrix (M) segment of IBV and ICV and the RNA polymerase complex subunit, PB1 segment of IDV are the most conserved segment to each virus, they were selected as the molecular targets for the assay design. According to all complete and near-complete segment sequences that were available from the GenBank, 6,593 IBV and 196 ICV M gene sequences, and 29 IDV PB1 sequences were used for primer and probe designs to achieve highest possible coverage rate. The host housekeeping gene, 18S rRNA gene that amplifies from swine, bovine, and human samples, was chosen to serve as an internal control to monitor the nucleic acid extraction efficiencies and potential PCR inhibitions (Bai et al., 2018). Real-time PCR primers were designed with annealing temperature (Tm) of approximately 60°C and the probes with Tm of approximately 63~65°C. The cloning and sequencing primer pairs were designed flanking the real-time RT-PCR targets for the construction of positive control plasmids and Sanger sequencing confirmation of the positive clinical samples. The IAV universal primers and probes were adopted from two RT-qPCR assays that are recommended by the USDA (OIE 2015, http://www.oie.int/standard-setting/terrestrial-manual/access-online/) and the CDC IAV assay (WHO 2017, http://www.who.int/influenza/resources/laboratories/en/). Both the USDA and CDC IAV assays are targeted on the matrix gene, and equal amount of primers and probes were used in the 5-plex RT-mqPCR assay. All primers and probes are listed in Table 1.

Table 1.

Primers and probes used for real-time RT-PCR, molecular cloning, and sequencing confirmation

Assay Target Gene Primer / probe Sequence (5’−3’) Tm (°C) Amplicon size (bp) in silico Coverage
Real-time PCR primers and probes
IBV1 M IBV1-Fa GCAGAGCAGCGAGATCTTCAG 62.8 96 IBV1:89.7%
IBV1-Fb CAGAGCAGCGAGATCCTCA 60.4 (5911/6593)
IBV1-R CTTTYCCCATTCCATTCATTGT 60.1–62.1
IBV1-Pr TEX615-CTGTGTTCATAGCTGAGACCATCTGC-IBRQ 65.5
IBV2 M IBV2-F TCCTGGAAATTATTCAATGCAAG 60.3 78 IBV2: 87.9%
IBV2-R CTGTGTGAATGTGATGCTTGTTT 60.1 (5794/6593)
IBV2-Pr TEX615-CGCAYAAAGCACAGAGYGTTCC-IBRQ 65.4–69.5 97.9% combined (6456/6593)
ICV1 M ICV1-F TCGGCAGATGGGAGAGATG 62.3 144 ICV1:95.4%
ICV1-R GAATTGGTGAGTTGTCGGTTTC 60.8 (187/196)
ICV1-pr MAX-CTCCCAGGTCAAGTCTCTCCCT-IBFQ 63.3
ICV2 M ICV2-F TGGCCTTGGAGAAGAAGCA 62.0 100 ICV2:74.0%
ICV2-R CAAGTGGGGTCTCATTATATTACTTCC 61.4 (145/196)
ICV2-Pra MAX-TGATTGCATAATATGGCCAAACTTTCT-IBFQ 64.6 99.5% combined (195/196)
ICV2-Prb MAX-TGTGATTACATAATATGGCCAAACTTTCTG-IBFQ 64.9
IDV PB1 IDV-F AATTCTGTGCCAATGAAGCTG 60.3 104 IDV:100%
IDV-Ra TGGCATATTTCTTTCACTTGTCC 60.4 (29/29)
IDV-Rb TGGCATATTTCTTTCGCTTGTC 61.4
IDV-Rc GCATGTTTCTTTCACTCGTCC 59.7
IDV-Pr Q705-CATAAGTTTGYCTTCCTTCAGTGAGCTT-BHQ3 63.4–66.7
IAV1-USDA M M25-F AGATGAGTCTTCTAACCGAGGTCG 62.3 100 USDA (OIE 2015)
M124-Ra TGCAAAAACATCTTCAAGTCTCTG 60.8
M124-Rb TGCAAAGACACTTTCCAGTCTCTG 63.5
M64-Pr FAM-TCAGGCCCCCTCAAAGCCGA-BHQ1 71.5
IAV2-CDC M InfA-F GACCRATCCTGTCACCTCTGAC 61.0–63.4 106 CDC (WHO 2017)
InfA-R AGGGCATTYTGGACAAAKCGTCTA 64.9–67.2
InfA-Pr FAM-TGCAGTCCTCGCTCACTGGGCACG-BHQ1 76.5
18S rRNA 18S rRNA 18S-F GGAGTATGGTTGCAAAGCTGA 60.3 100
18S-R GGTGAGGTTTCCCGTGTTG 61.4
18S-Pr Cy5-AAGGAATTGACGGAAGGGCA-BHQ3 64.0
Cloning and sequencing primers
IBV M IBV-cF TGCTTTTTAAAACCCAAAGACCAG 62.4 505
IBV-cR GCACTTCCATTACATCCTTTGCA 63.4
ICV M ICV12-cF2 AAAGCCAGCACAGCAATGAA 61.9 590
ICV12-cR1 TCAAAAATACCATCATTGGAAAAAGG 63.2
IDV PB1 IDV1-cF GTCAAGAACTTACTCCTACAGTAGAAC 55.6 360
IDV1-cR GTTCCTTTGAATGTTCCCTGTGT 61.6
Open in a new tab

In this study, the singleplex assay is defined as test on single target. The duplex assay is defined as test on one of the four influenza viruses along with the internal control (IC), 18S rRNA gene. The 5-plex assay includes IAV, IBV, ICV, and IDV plus the IC in a single reaction.

2.3. Extraction and purification of nucleic acid

The influenza virus RNA was extracted from 140 μL of clinical samples by QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA), or 100 μL cell culture (supernatants for IAV and IDV, allantoic fluids for IBV and ICV) by Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA) according to the manufacturer’s recommendations. Plasmid DNA was purified using Qiagen QIAprep MiniPrep kit, and PCR products (for cloning or sequencing) were purified using Qiagen QIAquick PCR purification kit.

2.4. Construction of positive control plasmids and preparation of in vitro transcribed RNA

The IBV and ICV M gene and IDV PB1 gene fragments flanking the RT-qPCR targets were reverse transcribed into cDNA using SuperScript III first-strand synthesis system (Invitrogen/ThermoFisher, Carlsbad, CA), then PCR amplified using TAKaRa LA Taq PCR kit (TaKaRa, Mountain View, CA). Purified PCR products were cloned into pCR4 vector and transformed into E. coli cells using Invitrogen TOPO TA PCR Cloning kit. In vitro transcribed RNA was produced using MEGAscript T7 Transcription kit (LifeTechnologies/ThermoFisher, Cartsbad, CA). Both the constructed plasmid DNA and the in vitro transcribed RNA were used as the templates for initial analytical analysis of the real-time PCR assays.

2.5. Real-time PCR protocols

All real-time PCR reactions were carried out in a 20 μL reaction that consists of 0.4 μM of each forward and reverse primer, 0.2 μM of each probe, 3 μL of template, 2 μL of 10x Multiplex Enzyme Mix, and 10 μL of 2×Multiplex RT-PCR Buffer from Path-ID Multiplex One-Step RT-PCR Kit (Applied Biosystems/ThermoFisher, Grand Island, NY). The thermocycling parameters include a reverse transcription step at 48°C for 10 min and RT inactivation and denaturation at 95°C°C for 10 min, followed by 45 cycles of denaturation at 95°C for 15s and annealing/extension at 60°C for 45s. The reactions were run with the Bio-Rad CFX96™ Touch™ Real-time PCR Detection System (Bio-Rad, Hercules, CA). The threshold cycle (Ct) values were generated and results were analyzed using Bio-Rad CFX Manager 3 software. Graphs were generated by GraphPad Prism 7 (GraphPad Software, La Jolla, CA).

2.6. Specificity analyses and diagnostic performance of the assays

Samples used for specificity analysis include: 1 IAV isolate and 55 IAV clinical samples; 4 IBV isolates; 1 ICV isolate and 38 bovine ICV samples; 6 IDV isolates and 71 IDV samples. Clinical samples positive to the influenza viruses were confirmed by Sanger sequencing or by other validated RT-PCR assays. Swine and bovine samples positive to other common pathogens and negative to influenza viruses, including 91 porcine circovirus type 2 (PCV2), 178 porcine circovirus type 3 (PCV3), 40 porcine deltacoronavirus (PDCoV), 58 porcine epidemic diarrhea virus (PEDV), 18 porcine parainfluenza virus (PPIV), 76 porcine reproductive and respiratory syndrome virus (PRRSV), 5 group A rotavirus, 1 group B rotavirus, and 2 group C rotavirus samples were also used for specificity analysis.

2.7. Sensitivity analyses with singleplex, duplex, and 5-plex assays

The sensitivity was determined by 10-fold serial dilutions of constructed plasmid DNA, in vitro transcribed RNA, RNA extracted from viral isolates, and RNA extracted from clinical positive samples, respectively. Standard curves were generated with singleplex, duplex, and 5-plex real-time RT-PCR reactions. The limit of detection (LOD) was determined using 95% Probit analysis at the detectable concentrations. Furthermore, the Ct values of duplex and 5-plex assays on 55 IAV, 71 IDV, and 21 ICV clinical samples were compared (Only 21 of the 38 ICV samples were available for this comparison, as others were no longer available).

3. Results

3.1. In silico analysis and prediction of assay coverage

Because of high level of divergence in influenza virus sequences, some of the primers and probes were designed with degenerate bases, and two pairs of primers and probes targeting different regions were designed for IBV and ICV assays. The coverage rate (%) is calculated as the percentage of total number of perfectly matched sets of “forward primer + reverse primer + probe” sequences over the total number of currently available sequences from the GenBank (as of November 15, 2017). The in silico analysis indicated that the coverage rates is 97.9% (6456/6593) for IBV, 99.5% (195/196) for ICV, and 100% (29/29) for IDV strains (Table 1).

3.2. Analytical sensitivity of the real-time PCR assays

From real-time PCR assays on plasmid DNA and in vitro transcribed RNA samples, the PCR amplification efficiencies (E%) were ranged 92%−105% with correlations coefficient (R2) greater than 0.99. The limit of detection (LOD) on in vitro transcribed RNA was approximately 30 copies per reaction for both singleplex and 5-plex assays. Specifically, 27 copies for IBV, 24 copies for ICV, and 35 copies for IDV, which corresponds to Ct values of 36–38. These were no noticeable Ct differences observed between the singleplex and 5-plex assays with plasmid DNA and in vitro transcribed RNA templates.

Since the constructed plasmids and in vitro transcribed RNA only contain a small portion of the influenza virus genome, to make sure the assay is not compromised when tested on full viral genome, the RNA samples extracted from cell cultures of the influenza viral isolates were tested with the singleplex and 5-plex real-time RT PCR assays. The standard curves plotted with Cts versus Log dilution factors or template concentrations showed that all the PCR amplification efficiencies (E%) and the correlations coefficient (R2) are within the satisfactory range (E% = 90%−110%, and R2 >0.990) (Figure 1 and Table 2). The standard curves of the internal control 18S rRNA showed no significant difference between the singleplex and 5-plex assays (Fig. 1A. Similar IC standard curves were generated but not shown in Fig. 1B, 1C, and 1D). In addition, very similar Cts were generated by the singleplex and 5-plex real-time RT PCR assays on the serial dilutions of RNA from viral cell cultures. The average Ct difference between the singleplex and 5-plex assays on serial dilutions of virus isolates was within a single Ct difference (< 0.6), which indicates that multiplexing does not significantly affect analytical sensitivities of the real-time RT PCR assays (Fig. 1 and Table 2).

Figure 1. Standard curves of RT-qPCR assays with serial dilutions of cultured virus isolates.

Figure 1.

Open in a new tab

Panel A: Standard curves of IAV and 18S rRNA at singleplex and 5-plex RT-qPCR assays; Panel B: IBV standard curves at singleplex and 5-plex RT-qPCR at starting viral isolate RNA concentration 2.7×105 copies/reaction; Panel C: ICV standard curves at singleplex and 5-plex RT-qPCR at starting concentration 2.4×105 copies/reaction; Panel D: IDV standard curves of singleplex and 5-plex RT-qPCR at starting concentration 3.5×105 copies/reaction.

Table 2.

Standard curve comparison of 5-plex and singleplex assays on viral isolates

Target IAV IBV ICV IDV
Assay singleplex 5-plex singleplex 5-plex singleplex 5-plex singleplex 5-plex
R2 0.998 0.998 0.995 0.997 0.994 0.995 0.997 0.999
E% 95.07 90.01 93.29 95.18 94.17 90.70 94.47 95.34
Ct on serial
dilutions		 10−1 19.37 19.80 22.52 22.92 23.10 22.61 22.81 23.14
10−2 23.11 23.18 25.53 26.25 26.28 25.86 26.02 26.38
10−3 26.36 26.74 29.18 29.64 30.44 29.27 29.64 29.82
10−4 29.83 30.49 33.24 33.32 33.58 32.81 33.23 33.31
10−5 33.15 34.35 36.13 36.60 36.80 36.80 36.51 36.87
10−6 36.77 37.45 N/A N/A N/A N/A N/A N/A
Ct difference 0.57 0.43 0.57 0.26
Open in a new tab

Note: 1) The starting viral RNA concentration for IBV, ICV, and IDV RT qPCR assays were 2.7×105, 2.4×105, and 3.5×105 copies/reaction, respectively. 2) Ct difference is the average absolute Ct value difference between the singleplex and 5-plex assays.

3.3. Assay sensitivity with diagnostic samples

To make sure the assay sensitivity is not compromise when tested on diagnostic samples, IAV, ICV and IDV positive clinical samples were used for further study (no positive IBV clinical samples available). The internal control was detected in all samples except the plasmids and in vitro transcribed RNA samples, indicating a good practice in nucleic acid extraction and there was no PCR inhibitions. To determine the LODs in terms of Ct cutoff values, the clinical samples were serially diluted by 10-fold at the first 5 dilutions, and followed by a serial of 2-fold dilutions for more accurate LOD determinations. The 5-plex real-time RT-PCR assay generated similar sensitivities to that generated by duplex assays. The standard curves plotted with Cts versus dilution factors showed that all PCR amplification efficiencies (E%) are ranged 90%−100% and the correlations coefficient (R2) are greater than 0.99.

The results also indicated that the reliable Ct cutoff values for influenza virus diagnosis can be defined as: Ct ≤36 are positives, Ct =36–39 are weak positive, and Ct >39 are negatives. In addition, the average Ct difference between the 5-plex and duplex assays on serial dilutions of clinical samples was within a single Ct difference (< 0.6), which indicates that results from the two assays are very close (Fig. 2 and Table 3).

Figure 2. Standard curves generated by theRT-qPCR assays with positive clinical samplesof IAV, ICV and IDV.

Figure 2.

Open in a new tab

Panel A:IAV standard curves atduplexed condition (with 18S rRNA)and compared with5-plex reactions (addition of IBV, ICV and IDV);Panel B:ICV standard curves atduplexedconditionand compared with that at 5-plex reaction;Panel C:IDV standard curves atduplexed conditionand compared with that at 5-plex reaction.

Table 3.

Comparison of assay sensitivities between 5-plex and duplex reactions on clinical positive samples

IAV clinical sample ICV clinical sample IDV clinical sample
Duplex 5-plex Duplex 5-plex Duplex 5-plex
Correlation coefficient R2 0.998 0.993 0.997 0.990 0.996 0.996
PCR efficiency (E) 90.12% 90.01% 95.22% 94.73% 90.69% 99.58%
Ct on serial dilutions* 10−1 21.03 21.00 22.61 22.62 20.52 20.43
10−2 24.40 24.24 26.06 26.09 23.53 23.66
10−3 27.91 27.73 29.61 29.52 26.95 26.95
10−4 31.66 31.20 33.19 33.19 31.04 30.31
10−5 35.14 34.55 36.25 36.03 34.34 33.45
1/2*10−5 36.30 35.90 37.52 37.35 35.54 34.31
1/4*10−5 37.42 37.17 38.46 38.87 36.24 35.57
1/8*10−5 38.52 39.07 N/A N/A 38.1 37.2
Ct difference between assays 0.33 0.13 0.58
Open in a new tab

3.4. Specificity of the duplex and 5-plex assays

The specificity of primers and probes was first evaluated by in silico analysis with NCBI primer design tool, which presented unique influenza virus target for each set of assay. To experimentally distinguish pathogens among influenza viruses and from other swine and bovine pathogens, cell cultures of the IAV, IBV, ICV, and IDV isolates, clinical samples positive to the influenza viruses (confirmed by Sanger sequencing or by other validated assays), and clinical sample negative to influenza viruses but positive to other common swine and bovine pathogens were assayed with duplex and 5-plex real-time RT-PCR. The results demonstrated that the IAV, IBV, ICV, and IDV assays detected the specific target viruses without cross detection of any non-target pathogens, including those that were positive to common swine and bovine pathogens listed in the Materials and Methods section.

3.5. Diagnostic performance of the duplex and 5-plex assays on clinical samples

A total of 55 IAV, 38 ICV, and 71 IDV positives were identified from clinical samples with the newly developed 5-plex assay. The 55 IAV positive samples include 37 positive IAV samples (swine nasal swabs) from the Iowa abattoir, 15 positives detected from 127 KSVDL archived swine nasal swabs (11.8%), 2 positives from 27 lung samples (7.4%), and 1 positive from 56 oral fluids (1.8%). From the 1525 archived bovine clinical samples with suspected respiratory diseases, 38 samples were assayed as positive to ICV, four were dual-positive to ICV and IDV, and 12 ICV positives (Ct <30) were confirmed by Sanger sequencing. Of these 38 positive ICV samples, 23 were identified from 952 nasal swabs (2.4%) and 15 positives from 498 lung samples (3.0%). Among the 71 IDV positive samples assayed in this study, 69 were positives and 2 were negatives as previously tested by the IDV assay currently used at KSVDL. Of these 71 positive IDV samples, 42 positives were identified from 952 nasal swabs (4.4%), 28 positives from 498 lung samples (5.6%), and 1 positive from 4 oral fluids. A total of 30 IDV positives (Ct<30) were confirmed by Sanger sequencing of the PB1 gene fragment. The four samples co-positive for ICV and IDV were also confirmed by Sanger sequencing. For the ICV and IDV positive samples that were not sequenced, some did not have enough amount of extracted RNA, and most samples with Ct >30 were not amplified by the sequencing primers using regular PCR, likely due to the low concentration and degradation of RNA samples during the storage, as the fragment sizes for Sanger sequencing (590 nt for ICV and 360 nt for IDV) are much larger than the real-time RT-PCR targets (100 or 144 nt for ICV and 104 nt for IDV).

The newly developed duplex and 5-plex assays were compared by testing 55 IAV, 21 ICV, and 71 IDV positive clinical samples, and generated similar Ct values with ranges of: 19.02~34.74 by IAV duplex and 19.22~35.35 by IAV 5-plex; 15.66~36.52 by ICV duplex and 15.33~36.61 by ICV 5-plex; 12.23~36.67 by IDV duplex, and 12.12–36.34 by IDV 5-plex. The averages of absolute differences in Ct values between the duplex and 5-plex assays on these 55 IAV, 21 ICV, and 71 IDV positive samples were 0.30 (ranging 0–0.98), 0.49 (0.07–1.91), and 0.43 (0–1.60), respectively, which were within a single Ct difference.

4. Discussion

Although a number of real-time PCR assays have been published and currently used for diagnosis of influenza viruses, due to the difficulty of real-time PCR design and the challenges of multiplexing, none is highly multiplexed and are with high strain coverage. Most of those assays especially ICV and IDV assays are not capable of detecting the majority of current field strains and variants, and are not sufficient to meet the needs of influenza surveillance and diagnosis. In this study, we developed a high coverage and highly multiplexed (5-plex) real-time RT-PCR assay for simultaneous detection and differentiation of all four influenza viruses. The in silico analysis indicated that the binding sites of our designed primers and probes are highly conserved, therefore the newly developed real-time PCR assays can potentially maintain high coverage against additional field influenza strains.

The benefits of multiplexing real-time PCR are obviously economics and convenience, such as cost-saving with fewer reactions and less reagents, time-saving, and enhanced throughput. In a multiplex real-time PCR, multiple targets (usually between 2 and 4) are detected simultaneously in the same reaction. However, the challenge of a probe-based multiplex real-time PCR assay is potentially reduced sensitivity by multiplexing, which is affected by the competition of reagents among different assays and potential interactions among different oligomers (Bai et al., 2018). With improved design of the assays and optimized PCR conditions in this study, our validation data demonstrate that the newly developed 5-plex assay is highly sensitive and specific in detection and differentiation of influenza A, B, C, and D viruses, from both virus isolates and clinical samples.

Among the 71 IDV positive samples, 2 samples were tested negative by the IDV assay currently used at KSVDL, but were positive for IDV tested with the newly developed 5-plex assay (Ct 28.36 and 32.84). This suggested that the new assay has a higher strain coverage or is more sensitive.

A total of 38 ICV positives were identified from cattle (with suspected respiratory diseases) in Kansas, Colorado, Minnesota, Missouri, Montana, Nebraska, Oklahoma, and Texas in the United States. Sequencing results confirmed the ICV positive PCR data. Although ICV of pig-origin was reported in China and Japan in 1980s and 1990s (Kimura et al., 1997, Yamaoka et al., 1991, Yuanji and Desselberger, 1984, Yuanji et al., 1983), influenza C virus has not been reported in bovine prior to our recent study (Zhang et al., 2018a).

Considering the interspecies transmission and infection of the emerging influenza D virus (first identified in Oklahoma) between pigs and cattle in recent years (Chiapponi et al., 2016, Collin et al., 2015, Foni et al., 2017, Hause et al., 2014, Hause et al., 2013, Mitra et al., 2016, Zhai et al., 2017), the newly identified ICV positive cases in the United States give us a timely alert of the potential risk that the emerging ICV may cause infections in pig and cattle populations.

The influenza viruses are zoonotic pathogens that can be transmitted between animals and human. Although the recently discovered influenza D viruses have been only identified from pigs and cattle, there are potential risk for IDV to infect human. In addition, previously the influenza C viruses were reported mainly from human infections, now cattle with ICV infections have been identified and confirmed in a number of states in the USA. Our assay can be used to monitor and diagnose ICV and other influenza viruses in cattle with suspected respiratory diseases.

Since the primers and probes of the real-time PCR assays on IBV, ICV, and IDV in this study were designed based on all available sequences from the GenBank database, and the IAV RT-qPCR primers and probes were adopted from the well-established USDA IAV assay (OIE 2015) and the CDC IAV assay (WHO 2017), the newly developed multiplex real-time PCR assay of IAV, IBV, ICV, and IDV can be used for the detection and differentiation of different influenza viruses in swine and bovine, and potentially for human and other animal species as well, although we need to keep validating the assay with more diagnostic samples, especially IBV samples. In addition, we may need to adjust the primer and probe sequences of any influenza assay due to the continuous variation of the viruses over time. Validation and modification of a molecular diagnostic assay appear to be a continuous process.

In conclusion, a high-coverage (inclusivity up to 98%−100%), highly sensitive, and highly multiplexed (5-plex), one-step real-time RT-PCR assay was developed and validated in this study. It should facilitate the detection and differentiation of influenza A, B, C, and D viruses under high throughput settings. To the best of our knowledge, this may be one of a few 5-plex real-time PCR assays that have been developed and validated for diagnostic applications.

Funding

This research was mainly supported by Swine Health Information Center (Grant No. 16–255 SHIC). Hewei Zhang’s scholarship to study at Kansas State University was supported by the China Scholarship Council. Wenjun Ma’s work was partially supported by NIAID funded Centers of Excellence for Influenza Research and Surveillance (contract number HHSN 272201400006C) and NIAID R21AI121906. Victor Huber’s work was funded by the National Institute of Allergy and Infectious Diseases, the National Institutes of Health (HHSN 266200700005C).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflict of interest

The authors declare that they have no conflicts of interest.

References

  1. Bai J, Trinetta V, Shi X, Noll LW, Magossi G, Zheng W, et al. A multiplex real-time PCR assay, based on invA and pagC genes, for the detection and quantification of Salmonella enterica from cattle lymph nodes. J Microbiol Methods 2018;148:110–6. [DOI] [PubMed] [Google Scholar]
  2. Banerjee D, Kanwar N, Hassan F, Essmyer C, Selvarangan R. Comparison of Six Sample-to-Answer Influenza A/B and Respiratory Syncytial Virus Nucleic Acid Amplification Assays Using Respiratory Specimens from Children. Journal of clinical microbiology 2018;56(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bell J, Bonner A, Cohen DM, Birkhahn R, Yogev R, Triner W, et al. Multicenter clinical evaluation of the novel Alere i Influenza A&B isothermal nucleic acid amplification test. Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology 2014;61(1):81–6. [DOI] [PubMed] [Google Scholar]
  4. Brockwell-Staats C, Webster RG, Webby RJ. Diversity of influenza viruses in swine and the emergence of a novel human pandemic influenza A (H1N1). Influenza and other respiratory viruses 2009;3(5):207–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bruning AHL, Leeflang MMG, Vos J, Spijker R, de Jong MD, Wolthers KC, et al. Rapid Tests for Influenza, Respiratory Syncytial Virus, and Other Respiratory Viruses: A Systematic Review and Meta-analysis. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2017;65(6):1026–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chiapponi C, Faccini S, De Mattia A, Baioni L, Barbieri I, Rosignoli C, et al. Detection of influenza D virus among swine and cattle, Italy. Emerging infectious diseases 2016;22(2):352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cho CH, Woo MK, Kim JY, Cheong S, Lee CK, An SA, et al. Evaluation of five rapid diagnostic kits for influenza A/B virus. Journal of virological methods 2013;187(1):51–6. [DOI] [PubMed] [Google Scholar]
  8. Collin EA, Sheng Z, Lang Y, Ma W, Hause BM, Li F. Cocirculation of two distinct genetic and antigenic lineages of proposed influenza D virus in cattle. Journal of virology 2015;89(2):1036–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Faccini S, De Mattia A, Chiapponi C, Barbieri I, Boniotti MB, Rosignoli C, et al. Development and evaluation of a new Real-Time RT-PCR assay for detection of proposed influenza D virus. Journal of virological methods 2017;243:31–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Faux C Influenza type C PCR for Clinical Microbiology: Springer; 2010. p. 311–2. [Google Scholar]
  11. Foni E, Chiapponi C, Baioni L, Zanni I, Merenda M, Rosignoli C, et al. Influenza D in Italy: towards a better understanding of an emerging viral infection in swine. Scientific Reports 2017;7(1):11660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hause BM, Collin EA, Liu R, Huang B, Sheng Z, Lu W, et al. Characterization of a novel influenza virus in cattle and Swine: proposal for a new genus in the Orthomyxoviridae family. MBio 2014;5(2):e00031–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hause BM, Ducatez M, Collin EA, Ran Z, Liu R, Sheng Z, et al. Isolation of a novel swine influenza virus from Oklahoma in 2011 which is distantly related to human influenza C viruses. PLoS pathogens 2013;9(2):e1003176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hindiyeh M, Kolet L, Meningher T, Weil M, Mendelson E, Mandelboim M. Evaluation of Simplexa Flu A/B & RSV for direct detection of influenza viruses (A and B) and respiratory syncytial virus in patient clinical samples. Journal of clinical microbiology 2013;51(7):2421–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hindiyeh M, Levy V, Azar R, Varsano N, Regev L, Shalev Y, et al. Evaluation of a multiplex real-time reverse transcriptase PCR assay for detection and differentiation of influenza viruses A and B during the 2001–2002 influenza season in Israel. Journal of clinical microbiology 2005;43(2):589–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hoffmann B, Beer M, Reid SM, Mertens P, Oura CA, van Rijn PA, et al. A review of RT-PCR technologies used in veterinary virology and disease control: sensitive and specific diagnosis of five livestock diseases notifiable to the World Organisation for Animal Health. Vet Microbiol 2009;139(1–2):1–23. [DOI] [PubMed] [Google Scholar]
  17. Horimoto T, Hiono T, Mekata H, Odagiri T, Lei Z, Kobayashi T, et al. Nationwide distribution of bovine influenza D virus infection in Japan. PloS one 2016;11(9):e0163828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Howard LM, Johnson M, Gil AI, Pekosz A, Griffin MR, Edwards KM, et al. A novel real-time RT-PCR assay for influenza C tested in Peruvian children. Journal of Clinical Virology 2017;96:12–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kimura H, Abiko C, Peng G, Muraki Y, Sugawara K, Hongo S, et al. Interspecies transmission of influenza C virus between humans and pigs. Virus research 1997;48(1):71–9. [DOI] [PubMed] [Google Scholar]
  20. King AMQ, Lefkowitz EJ, Mushegian AR, Adams MJ, Dutilh BE, Gorbalenya AE, et al. Changes to taxonomy and the International Code of Virus Classification and Nomenclature ratified by the International Committee on Taxonomy of Viruses (2018). Archives of virology 2018. [DOI] [PubMed] [Google Scholar]
  21. Kralik P, Ricchi M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Frontiers in Microbiology 2017;8:108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lowen AC. Constraints, Drivers, and Implications of Influenza A Virus Reassortment. Annual review of virology 2017;4(1):105–21. [DOI] [PubMed] [Google Scholar]
  23. Lyons DM, Lauring AS. Mutation and Epistasis in Influenza Virus Evolution. Viruses 2018;10(8). [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mitra N, Cernicchiaro N, Torres S, Li F, Hause BM. Metagenomic characterization of the virome associated with bovine respiratory disease in feedlot cattle identified novel viruses and suggests an etiologic role for influenza D virus. Journal of General Virology 2016;97(8):1771–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nelson MI, Vincent AL. Reverse zoonosis of influenza to swine: new perspectives on the human-animal interface. Trends in microbiology 2015;23(3):142–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pabbaraju K, Wong S, Wong A, May‐Hadford J, Tellier R, Fonseca K. Detection of influenza C virus by a real‐time RT‐PCR assay. Influenza and other respiratory viruses 2013;7(6):954–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ran Z, Shen H, Lang Y, Kolb EA, Turan N, Zhu L, et al. Domestic pigs are susceptible to infection with influenza B viruses. Journal of virology 2015;89(9):4818–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rosignoli C, Faccini S, Merenda M, Chiapponi C, Mattia Ad, Bufalo G, et al. Influenza D virus infection in cattle in Italy. Large Animal Review 2017;23(4):123–8. [Google Scholar]
  29. Salez N, Mélade J, Pascalis H, Aherfi S, Dellagi K, Charrel RN, et al. Influenza C virus high seroprevalence rates observed in 3 different population groups. Journal of Infection 2014;69(2):182–9. [DOI] [PubMed] [Google Scholar]
  30. Selvaraju SB, Selvarangan R. Evaluation of three influenza A and B real-time reverse transcription-PCR assays and a new 2009 H1N1 assay for detection of influenza viruses. Journal of clinical microbiology 2010;48(11):3870–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Shi X, Liu X, Wang Q, Das A, Ma G, Xu L, et al. A multiplex real-time PCR panel assay for simultaneous detection and differentiation of 12 common swine viruses. Journal of virological methods 2016;236:258–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Slomka MJ, Densham AL, Coward VJ, Essen S, Brookes SM, Irvine RM, et al. Real time reverse transcription (RRT)‐polymerase chain reaction (PCR) methods for detection of pandemic (H1N1) 2009 influenza virus and European swine influenza A virus infections in pigs. Influenza and other respiratory viruses 2010;4(5):277–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Smith AB, Mock V, Melear R, Colarusso P, Willis DE. Rapid detection of influenza A and B viruses in clinical specimens by Light Cycler real time RT-PCR. Journal of Clinical Virology 2003;28(1):51–8. [DOI] [PubMed] [Google Scholar]
  34. Spackman E, Suarez DL. Type A influenza virus detection and quantitation by real-time RT-PCR Avian influenza virus: Springer; 2008. p. 19–26. [DOI] [PubMed] [Google Scholar]
  35. Steel J, Lowen AC. Influenza A virus reassortment. Current topics in microbiology and immunology 2014;385:377–401. [DOI] [PubMed] [Google Scholar]
  36. Stellrecht KA. History of matrix genes mutations within PCR target regions among circulating influenza H3N2 clades over ten-plus-years. Journal of clinical virology 2018; 107: 11–18. [DOI] [PubMed] [Google Scholar]
  37. Takátsy G, Farkas E, Romvary J. Susceptibility of the domestic pig to influenza B virus. Nature 1969;222(5189):184. [DOI] [PubMed] [Google Scholar]
  38. Takatsy G, Romvary J, Farkas E. Susceptibility of the domestic swine to influenza B virus. Acta microbiologica Academiae Scientiarum Hungaricae 1967;14(3):309. [PubMed] [Google Scholar]
  39. Templeton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC. Rapid and sensitive method using multiplex real-time PCR for diagnosis of infections by influenza A and influenza B viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4. Journal of clinical microbiology 2004;42(4):1564–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Van Elden L, Nijhuis M, Schipper P, Schuurman R, Van Loon A. Simultaneous detection of influenza viruses A and B using real-time quantitative PCR. Journal of clinical microbiology 2001;39(1):196–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vemula SV, Zhao J, Liu J, Wang X, Biswas S, Hewlett I. Current approaches for diagnosis of influenza virus infections in humans. Viruses 2016;8(4):96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yamaoka M, Hotta H, Itoh M, Homma M. Prevalence of antibody to influenza C virus among pigs in Hyogo Prefecture, Japan. Journal of general virology 1991;72(3):711–4. [DOI] [PubMed] [Google Scholar]
  43. Yuanji G, Desselberger U. Genome analysis of influenza C viruses isolated in 1981/82 from pigs in China. The Journal of general virology 1984;65 (Pt 11):1857–72. [DOI] [PubMed] [Google Scholar]
  44. Yuanji G, Fengen J, Ping W, Min W, Jiming Z. Isolation of influenza C virus from pigs and experimental infection of pigs with influenza C virus. Journal of General Virology 1983;64(1):177–82. [DOI] [PubMed] [Google Scholar]
  45. Zhai S-L, Zhang H, Chen S-N, Zhou X, Lin T, Liu R, et al. Influenza D virus in animal species in Guangdong Province, southern China. Emerging infectious diseases 2017;23(8):1392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang H, Porter E, Lohman M, Lu N, Peddireddi L, Hanzlicek G, et al. Influenza C Virus in Cattle with Respiratory Disease, United States, 2016–2018. Emerg Infect Dis 2018a;24(10):1926–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang H, Porter EP, Lohman M, Lu N, Peddireddi L, Hanzlicek G, et al. Complete Genome Sequence of an Influenza C Virus Strain Identified from a Sick Calf in the United States. Microbiol Resour Announc 2018b;7(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhang J, Harmon KM. RNA extraction from swine samples and detection of influenza A virus in swine by real-time RT-PCR Animal Influenza Virus: Springer; 2014. p. 277–93. [DOI] [PubMed] [Google Scholar]

RESOURCES