Adipocytokines leptin and adiponectin function as mast cell activity modulators

Paulina Żelechowska; Ewa Brzezińska‐Błaszczyk; Magdalena Wiktorska; Sylwia Różalska; Sebastian Wawrocki; Elżbieta Kozłowska; Justyna Agier

doi:10.1111/imm.13090

. 2019 Jul 10;158(1):3–18. doi: 10.1111/imm.13090

Adipocytokines leptin and adiponectin function as mast cell activity modulators

Paulina Żelechowska ¹, Ewa Brzezińska‐Błaszczyk ^1,^✉, Magdalena Wiktorska ², Sylwia Różalska ³, Sebastian Wawrocki ⁴, Elżbieta Kozłowska ¹, Justyna Agier ¹

PMCID: PMC6700464 PMID: 31220342

Summary

A growing body of data indicates that adipocytokines, including leptin and adiponectin, are critical components not only of metabolic regulation but also of the immune system, mainly by influencing the activity of cells participating in immunological and inflammatory processes. As mast cells (MCs) are the key players in the course of those mechanisms, this study aimed to evaluate the impact of leptin and adiponectin on some aspects of MC activity. We documented that in vivo differentiated mature tissue MCs from the rat peritoneal cavity express a receptor for leptin (OB‐R), as well as receptors for adiponectin (AdipoR1 and AdipoR2). We established that leptin, but not adiponectin, stimulates MCs to release of histamine as well as to generation of cysteinyl leukotrienes (cysLTs) and chemokine CCL2. We also found that both adipocytokines affect mRNA expression of various cytokines/chemokines. Leptin and adiponectin also activate MCs to produce reactive oxygen species. Moreover, we documented that leptin significantly augments the surface expression of receptors for cysLTs, i.e. CYSLTR1, CYSLTR2, and GPR17 on MCs, while adiponectin increases only GPR17 expression, and decreases CYSLTR2. Finally, we showed that both adipocytokines serve as potent chemoattractants for MCs. In intracellular signaling in MCs activated by leptin Janus‐activated kinase 2, phospholipase C, phosphatidylinositol 3‐kinase (PI3K), extracellular signal‐regulated kinase (ERK1/2), and p38 molecules play a part whereas the adiponectin‐induced activity of MCs is mediated through PI3K, p38, and ERK1/2 pathways. Our observations that leptin and adiponectin regulate MC activity might indicate that adipocytokines modulate the different processes in which MCs are involved.

Keywords: humoral factors, immune response, inflammation, mast cell

Abbreviations

AdipoR1: adiponectin receptor 1
AdipoR2: adiponectin receptor 2
AMPK: AMP‐activated protein kinase
APC: allophycocyanin
cysLT: cysteinyl leukotriene
DMEM: Dulbecco's modified Eagle's medium
ERK: extracellular signal‐regulated kinase
FITC: fluorescein isothiocyanate
GM‐CSF: granulocyte–macrophage colony‐stimulating factor
IFN: interferon
IL: interleukin
JAK: Janus‐activated kinase
MAPK: mitogen‐activated protein kinase
OB‐R: leptin receptor
p38: mitogen‐activated protein kinase
PBS: phosphate‐buffered saline
PE: phycoerythrin
PerCP: peridinin chlorophyll protein
PI3K: phosphatidylinositol 3‐kinase
PLC: phospholipase C
qRT‐PCR: quantitative reverse transcription polymerase chain reaction
ROS: reactive oxygen species
STAT: signal transducer and activator of transcription
TGF‐β: transforming growth factor β
TNF: tumor necrosis factor

Introduction

Adipocytokines (or adipokines), biologically active molecules, are mainly produced by fat cells called adipocytes, although they are also found in immune cells, such as lymphocytes, neutrophils, basophils, and mast cells (MCs).1, 2 The relevance of adipocytokines in physiology is based on either direct or indirect effects on the regulation of several processes including energy homeostasis, regulation of body metabolism, angiogenesis, and cardiovascular function.1, 3 Mounting evidence also links adipokines to immunity indicating that they are also crucial humoral components that modulate and control the course of immunological mechanisms.4 Adipocytokines play an emerging role in the regulation of inflammatory processes; some of them are considered to have mainly pro‐inflammatory activity, like leptin, resistin, and visfatin, whereas adiponectin or omentin are known for their anti‐inflammatory properties.2, 4, 5 Leptin is one of the most potent adipokines that, for example, enhances adhesion molecule expression in endothelial cells and eosinophils, and acts as a survival factor for monocytes, neutrophils, and eosinophils.6, 7, 8, 9 It activates monocytes/macrophages, eosinophils, and basophils to produce pro‐inflammatory mediators and cytokines.7, 10, 11 Leptin has also been implicated in monocyte/macrophage, granulocyte, and dendritic cell influx.7, 11, 12, 13 Conversely, anti‐inflammatory adiponectin decreases endothelial cell expression of adhesion molecules and induces monocyte apoptosis.14, 15 Moreover, adiponectin has been reported to act on monocytes/macrophages, and dendritic cells to stimulate the anti‐inflammatory mediator production,16 as well as to suppress eosinophil and endothelial cell migration.17, 18

Mast cells are long‐lived granular tissue‐dwelling cells that reside at different locations throughout the body. They tend to be located predominantly in the subepithelial layers of the skin and the respiratory system, as well as the gastrointestinal and genitourinary tracts.19 MCs are well known for their ability to produce and secrete a plethora of biologically active mediators. Activation of MCs leads to release of stored, cytoplasmic granule‐associated factors, such as histamine, proteases, proteoglycans, and some cytokines and chemokines. This is followed by the production of lipid mediators – leukotrienes (LTs), prostaglandins, and thromboxanes, as well as the de novo synthesis of cytokines, chemokines, and growth factors.20 MC‐derived mediators noticeably influence the activity of adjacent cells and tissues. Hence, MCs participate in maintaining body homeostasis and various physiological and pathological processes including allergic reactions and are well known for their involvement in host defense.21, 22, 23, 24, 25 Importantly, MCs are widely recognized as primary effector cells of inflammatory processes, as they affect different stages of inflammation, including its initiation and maintenance, as well as its resolution. Hence, they are involved in both acute and chronic as well as low‐grade inflammation.26, 27, 28

Considering the significant involvement of MCs in the course of inflammation, and at the same time bearing in mind that adipocytokines have a strong influence on inflammatory processes, it seems to be of great importance to establish whether those factors modulate MC activity. There is currently a lack of data showing the immediate outcome of leptin and adiponectin on those cells. In the current study, we documented that in vivo differentiated mature tissue MCs from the rat peritoneal cavity express leptin and adiponectin receptors. We also established that both adipocytokines might influence some aspects of MC biology. Leptin triggers MCs to pro‐inflammatory activity, as it stimulates those cells to generate and release mediators engaged in promoting inflammation. In turn, adiponectin seems to support mainly anti‐inflammatory MC responses as it enhances the production of factors with anti‐inflammatory/immunosuppressive properties. We also observed that leptin stimulation resulted in an increase of the surface expression of receptors for cysteinyl (cys)LTs on MCs, whereas adiponectin enhances only GPR17 appearance, and decreases CYSLTR2 levels. We documented that both adipocytokines serve as potent chemoattractants for rat MCs. The involvement of some signaling molecules, such as Janus‐activated kinase (JAK2), phospholipase C (PLC), phosphatidylinositol 3‐kinase (PI3K), extracellular signal‐regulated kinase 1/2 (ERK1/2), and p38 kinase, in leptin‐ or adiponectin‐induced MC responses, was estimated.

Materials and methods

Reagents

Dulbecco's modified Eagle's medium (DMEM) was obtained from Biowest (Riverside, MO). Hank's balanced salt solution, NaHCO₃, fetal calf serum, gentamicin, and glutamine were purchased from GIBCO (Gaithersburg, MD). NaCl, KCl, MgCl₂, CaCl₂, HEPES, NaOH, glucose, HCl, o‐phthalaldehyde, compound 48/80, calcium ionophore A23187, lipopolysaccharide from Escherichia coli, Percoll^®, hematoxylin, toluidine blue, trypan blue, bovine serum albumin, laminin from human placenta, phosphate‐buffered saline (PBS), ethanol 99.8%, PI3K inhibitor LY294002, and PLC inhibitor U‐73122 were all obtained from Sigma‐Aldrich (St Louis, MO). Human plasma fibronectin purified protein and JAK2 inhibitor AG490 were purchased from Merck Millipore (Billerica, MA) and ERK1/2 inhibitor PD98059 and p38 kinase inhibitor SB203580 were purchased from InvivoGen (San Diego, CA). Recombinant rat leptin, recombinant rat tumor necrosis factor (TNF), goat IgG isotype antibodies, rabbit IgG isotype antibodies, and the rat interleukin‐10 (IL‐10) Quantikine ELISA Kit were obtained from R&D Systems (Minneapolis, MN). Recombinant rat adiponectin was purchased from BioVendor (Brno, Czech Republic). The RNeasy^® Mini Kit was obtained from Qiagen (Valencia, CA). Both the iScript™ cDNA Synthesis Kit and the iTaq™ Universal SYBR^® Green Supermix were obtained from Bio‐Rad Laboratories (Hercules, CA). Primers were purchased from IBB PAN (Warsaw, Poland). Mouse anti‐rat IgE monoclonal IgG1 antibodies (anti‐IgE) were purchased from AbD Serotec (Oxford, UK). BD CellFIX™, purified mouse anti‐rat high‐affinity IgE receptor (FcεRI) and purified mouse monoclonal IgG1 anti‐rat mast cells, clone AR32AA4 (mAb AA4) antibodies were obtained from BD Biosciences (San Jose, CA). Rabbit polyclonal IgG antibodies against leptin receptor (OB‐R) and 2′,7′‐dichlorodihydrofluorescein diacetate (H₂DCFDA) were purchased from ThermoFisher Scientific (Waltham, MA). Rabbit monoclonal IgG antibodies against adiponectin receptor 1 (AdipoR1), goat polyclonal IgG antibodies against adiponectin receptor 2 (AdipoR2), and the R‐phycoerythrin (PE), fluorescein isothiocyanate (FITC), and peridinin chlorophyll protein (PerCP) conjugation kits were obtained from Abcam (Cambridge, UK). Goat polyclonal IgG antibodies against CYSLTR1, CYSLTR2, and GPR17; mouse monoclonal IgG2b antibodies against IL‐1β; mouse monoclonal IgG1 antibodies against IL‐4, granulocyte–macrophage colony‐stimulating factor (GM‐CSF), CCL3, and transforming growth factor‐β (TGF‐β); and normal mouse IgG isotype control were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX). Alexa Fluor^® 488‐conjugated goat anti‐rabbit polyclonal antibodies and Alexa Fluor^® 488‐conjugated rabbit anti‐goat polyclonal antibodies were obtained from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA). Brefeldin A was purchased from BioLegend (San Diego, CA). Rat CCL2 and cysLT‐specific immunoassay kits were purchased from Wuhan Fine Biotech Co. (Wuhan, China) and Cayman Chemical (Ann Arbor, MI), respectively. The 48‐well Boyden microchamber and the 8‐μm‐pore‐size polycarbonate filters were purchased from Neuro Probe (Gaithersburg, MD).

Isolation of primary MCs

Primary MCs were collected from peritoneal cavities of female albino Wistar rats weighing 200–250 g by lavage, with 50 ml of 1% Hank's balanced salt solution supplemented with 0·015% NaHCO₃. After an abdominal massage, the cell suspension was removed from the peritoneal cavity, centrifuged (150 g, 5 min, 20°), and washed twice in complete DMEM (cDMEM), comprising DMEM supplemented with 10% fetal calf serum, 2 mm glutamine, and 10 μg/ml gentamicin. To obtain purified MCs, the cell suspensions were resuspended in 72·5% isotonic Percoll^® and centrifuged (190 g, 15 min, 20°). The upper cell layer was removed, and pelleted MCs were washed twice in cDMEM by centrifugation (150 g, 5 min, 20°). After washing, MCs were counted and resuspended in an appropriate volume of cDMEM [for flow cytometric analysis, quantitative reverse transcription polymerase chain reaction (qRT‐PCR), confocal microscopy technique, and migration assay] or medium for rat MCs, containing 137 mm NaCl, 2·7 mm KCl, 1 mm CaCl₂, 1 mm MgCl₂, 10 mm HEPES buffer, 5·6 mm glucose, and 1 mg/ml bovine serum albumin (for histamine release assay, cysLTs, CCL2, and IL‐10 synthesis measurements) to obtain an MC concentration of 1·5 × 10⁶ cells per ml. MCs were prepared with purity >98%, as determined by metachromatic staining with toluidine blue (see Supplementary material, Fig. S1e). The viability of MCs was >98%, as estimated by trypan blue exclusion method. The purity of MCs exceeded 98%, as determined using a flow cytometry method with FITC‐conjugated anti‐rat FcεRI as well as PE‐conjugated anti‐rat mast cell (mAb AA4) antibodies, which recognize two derivatives of the ganglioside GD1b that are unique to the surface of rat MCs (see Supplementary material, Fig. S1a–d). All experimental animal procedures were carried out in strict accordance with the recommendations in the act on the protection of animals used for scientific or educational purposes. Animal experiments were approved by the Local Ethics Committee for Experiments on Animals in Lodz (approval number: 55/ŁB42/2016).

Cell preparation for flow cytometric and confocal microscopy analyses

Constitutive expression of FcεRI, MC‐specific gangliosides recognized by mAb AA4, OB‐R, AdipoR1, AdipoR2, CYSLTR1, CYSLTR2, and GPR17 receptors was assessed in native MCs (i.e. non‐stimulated cells). For leptin‐ and adiponectin‐induced cysLT receptor expression, MCs were incubated with leptin at final concentrations of 1 or 100 ng/ml or with adiponectin at final concentrations of 1 or 10 μg/ml for 1 hr in a humidified atmosphere with 5% CO₂ at 37°. Then, MCs were fixed with BD CellFIX™ solution for 15 min at 4° and washed twice with 1 × PBS. Next, MCs were resuspended in 1 × PBS and stained for 1 hr with FITC‐conjugated mouse anti‐FcεRI antibodies (dilution 1 : 100), rabbit polyclonal anti‐OB‐R antibodies (dilution 1 : 100), rabbit monoclonal anti‐AdipoR1 antibodies (dilution 1 : 100), goat polyclonal anti‐AdipoR2 antibodies (dilution 1 : 100), or goat polyclonal IgG antibodies against CYSLTR1, CYSLTR2, or GPR17 (dilution 1 : 100). For control, MCs were stained with rabbit or goat IgG isotype control with irrelevant specificity. Primary antibody was not added to the sample to certify non‐specific binding of the secondary antibody. Cells were then washed with 1 × PBS and incubated with Alexa Fluor^® 488‐conjugated secondary antibodies (dilution 1 : 100) and simultaneously co‐stained with the PE‐conjugated mouse monoclonal anti‐rat mast cells antibody (mAb AA4; dilution 1 : 100) in 1 × PBS for 1 hr in the dark. Following this, the cells were washed twice and finally resuspended in 1 × PBS before receptor assessment. After each period of incubation, MC viability was examined using the trypan blue exclusion test.

For determination of reactive oxygen species (ROS) generation, MCs were incubated with leptin at 1 or 100 ng/ml and adiponectin at 1 or 10 μg/ml, or with medium alone for 30 min in a humidified atmosphere with 5% CO₂ at 37°. Indicator for ROS, H₂DCFDA, was used at a concentration of 2 μm for 10 min. After that, cells were washed and resuspended in 1 × PBS.

Flow cytometry

For constitutive expression of surface FcεRI, MC‐specific gangliosides recognized by mAb AA4, OB‐R, AdipoR1, AdipoR2 as well as constitutive and leptin‐ or adiponectin‐induced surface expression of CYSLTR1, CYSLTR2, and GPR17, and for intracellular cytokine staining, 10 000 events in each sample were analyzed using a FACSCalibur™ flow cytometer with cellquest™ software (BD Biosciences). All flow cytometry measurements of MCs were gated on the threshold applying on the FL2 channel fluorescence (for mAb AA4‐PE). Fluorescence specific for FITC‐, Alexa Fluor^® 488‐ or PerCP‐conjugated antibodies was measured only in the case of MC gating on the FL2 channel.

Confocal microscopy

The samples were mounted on microscope slides, and images were captured using an LSM 510 Meta confocal laser scanning microscope (Zeiss, Oberkochen, Germany) combined with an Axiovert 200 M (Zeiss) inverted microscope equipped with a Plan‐Neofluar objective (40×/0·6). All settings were held constant throughout the experiments except for gain factor, which was adjusted individually for each receptor. The fluorescence was recorded using the argon laser (488 nm) and a BP filter set (505 nm). The same laser line was used for Nomarski differential interference contrast microscopy. All signals obtained from confocal microscopy were validated with profile view image analysis and the diagrams presenting intensity values were placed beside each microphotograph. The mean fluorescence intensity (expressed in arbitrary units, AU) was calculated for each of the samples. The calculations were performed for at least 40 different points randomly selected in compartments with receptor expression. Isotype control staining confirming the specificity of the primary antibody is shown in the Supplementary material (Fig. S3d).

Histamine release assay

Purified MCs suspended in medium for rat MCs were incubated with leptin at final concentrations of 0·1, 1, 10, 50, or 100 ng/ml, adiponectin at final concentrations of 0·01, 0·1, 1, 10, or 30 μg/ml, compound 48/80, a well‐known potent MC degranulation factor, at a final concentration of 5 μg/ml (positive control) or buffer alone (spontaneous histamine release) in a water bath for 30 min at 37° with constant stirring. For time–course experiments, MCs were incubated with leptin at a final concentration of 50 ng/ml for 0, 1, 3, 5, 10, or 30 min. After incubation, the reaction was stopped by adding 1·9 ml of cold medium. Next, the cell suspension was centrifuged (253 g, 5 min, 4°), and the supernatants were decanted into other tubes. A total of 2 ml distilled water was added to each tube with the cell pellets. The histamine content was determined in both cell pellets (residual histamine) and supernatants (released histamine) by a spectrofluorometric method using o‐phthalaldehyde (the excitation wavelength was 360 nm, and the fluorescence wavelength was 450 nm). Histamine release was expressed as a percentage of the total cellular content of the amine.

CysLT synthesis analysis

Purified MCs suspended in rat MC medium were incubated with leptin at final concentrations of 0·1, 1, 10, 50, or 100 ng/ml, adiponectin at final concentrations of 0·01, 0·1, 1, 10, or 30 μg/ml, calcium ionophore A23187 at a final concentration of 5 μg/ml (positive control) or buffer alone (spontaneous release) in a water bath for 1 hr at 37° with constant stirring. The supernatants were collected by centrifugation. The concentration of cysLTs in supernatants was evaluated by ELISA kit according to the manufacturer's instructions. The sensitivity of the assay was <20 pg/ml.

CCL2 and IL‐10 generation measurement

Purified MCs suspended in cDMEM were incubated with leptin at final concentrations of 0·1, 1, 10, 50, or 100 ng/ml, adiponectin at final concentrations of 0·01, 0·1, 1, 10, or 30 μg/ml, anti‐IgE at a final concentration of 5 μg/ml (positive control for CCL2 assay), lipopolysaccharide from E. coli at a final concentration of 5 μg/ml (positive control for IL‐10 assay), or buffer alone (spontaneous CCL2/IL‐10 generation). Incubation was carried out in a humidified atmosphere with 5% CO₂ for 3 hr at 37°. The supernatants were collected by centrifugation. CCL2 and IL‐10 concentrations in supernatants were evaluated using ELISA kits according to the manufacturer's instructions. The sensitivities of the CCL2 and IL‐10 assays were <9·375 pg/ml and <10 pg/ml, respectively.

Quantitative RT‐PCR

Quantitative RT‐PCR was used to determine leptin‐ and adiponectin‐induced cytokine/chemokine mRNA levels in MCs. Purified MCs suspended in cDMEM were stimulated with leptin at a final concentration of 50 ng/ml or adiponectin at a final concentration of 10 μg/ml for 2 hr at 37° in a humidified atmosphere with 5% CO₂. For control, MCs were incubated under the same conditions without leptin/adiponectin. Total RNA was isolated from cells using an RNeasy^® Mini Kit, and cDNA was synthesized according to the manufacturer's instructions of iScript™ cDNA Synthesis Kit. The qRT‐PCR was performed on the CFX96 Touch™ Real‐Time PCR Detection System (Bio‐Rad Laboratories) using iTaq™ Universal SYBR^® Green Supermix. PCR volumes consisted of 5 μl of iTaq™ Universal SYBR^® Green Supermix, 1 μl of cDNA, 2 μl of primers (5 mm), and 2 μl of PCR‐grade water included in the kit. Primer sequences are shown in Table 1. Cycling conditions were as follows: initial denaturation at 95° for 3 min followed by 40 cycles of denaturation at 95° for 10 seconds, annealing at 60° for 10 seconds, and then extension at 72° for 20 seconds. The fold changes of the tested samples were calculated using the Bio‐Rad CFX maestro™ software, based on the ΔΔCt method. The expression of cytokine/chemokine mRNAs was corrected by normalization based on the transcript level of the housekeeping gene rat Actb. Unstimulated specimens were used as the calibrator samples.

Table 1.

Sequences of primers used in the study

Gene name	Primer sequence (5′–3′)
Actb	Forward: TCTGTGTGGATTGGTGGCTCTA
Actb	Reverse: CTGCTTGCTGATCCACATCTG
Il1b	Forward: CACCTCTCAAGCAGAGCACAG
Il1b	Reverse: GGGTTCCATGGTGAAGTCAAC
Il4	Forward: ATGCACCGAGATGTTTGTACC
Il4	Reverse: TTTCAGTGTTCTGAGCGTGGA
Il6	Forward: TCCTACCCCAACTTCCAATGCTC
Il6	Reverse: TTGGATGGTCTTGGTCCTTAGCC
Il10	Forward: CACTGCTATGTTGCCTGCTC
Il10	Reverse: TTCATGGCCTTGTAGACACC
Il18	Forward: AAACCCGCCTGTGTTCGA
Il18	Reverse: ATCAGTCTGGTCTGGGATTCGT
Il33	Forward: TCGCACCTGTGACTGAAATC
Il33	Reverse: ACACAGCATGCCACAAACAT
Tnf	Forward: AAATGGGCTCCCTCTCATCAGTTC
Tnf	Reverse: TCTGCTTGGTGGTTTGCTACGAC
Ccl2	Forward: ATGCAGTTAATGCCCCACTC
Ccl2	Reverse: TTCCTTATTGGGGTCAGCAC
Ccl3	Forward: CATGGCGCTCTGGAACGAA
Ccl3	Reverse: TGCCGTCCATAGGAGAAGCA
Ccl4	Forward: TATGAGACCAGCAGCCTTTGC
Ccl4	Reverse: GCACAGATTTGCCTGCCTTT
Ifna	Forward: CTGCTGTCTAGGATGTGACCTGC
Ifna	Reverse: TTGAGCCTTCTGGATCTGCTG
Ifnb	Forward: CGTTCCTGCTGTGCTTCTC
Ifnb	Reverse: TGTAACTCTTCTCCATCTGTGAC
Ifng	Forward: ACGCCGCGTCTTGGTTT
Ifng	Reverse: AGGCTTTCAATGAGTGTGCTT
Gmcsf	Forward: AGACCCGCCTGAAGCTATACAA
Gmcsf	Reverse: CTGGTAGTGGCTGGCTATCATG
Tgfb	Forward: CGTGGAAATCAATGGGATCAG
Tgfb	Reverse: GGAAGGGTCGGTTCATGTCA

Open in a new tab

Intracellular cytokine staining

For the detection of intracellular cytokines, purified MCs suspended in cDMEM were incubated with leptin at a final concentration of 50 ng/ml, adiponectin at a final concentration of 10 μg/ml or buffer alone (non‐stimulated MCs) for 4 hr at 37° in a humidified atmosphere with 5% CO₂. Brefeldin A was added to all samples, and MCs were fixed, washed, and permeabilized. MCs were stained using PerCP‐conjugated antibodies against IL‐1β, IL‐4, CCL3, GM‐CSF, and TGF‐β (all used at a dilution of 1 : 100) and analyzed by flow cytometry. The percentage of cytokine‐producing cells was assessed.

Migration assay

The MC migratory response to leptin and adiponectin was examined using a Boyden microchamber assay in a 48‐well micro‐chemotaxis chamber. Thirty microliters of leptin at final concentrations ranging from 10⁻¹ to 100 ng/ml or adiponectin, at final concentrations ranging from 10⁻¹ to 30 μg/ml, or TNF at final concentrations of 0·01 or 0·05 pg/ml (positive control), or buffer alone (control spontaneous migration) were placed into the lower compartments of the microchamber. Migration assays were conducted using laminin‐coated or fibronectin‐coated polycarbonate 8‐μm pore‐size membranes. Filters were coated overnight at room temperature with laminin or fibronectin at a concentration of 100 μg/ml. The filters were air‐dried for at least 1 hr before use. The lower compartments were covered with a micropore filter, and 50 μl of the cell suspensions were applied to the upper compartments. Subsequently, the chemotaxis chamber was incubated for 3 hr in a humidified atmosphere with 5% CO₂ at 37°. After the incubation period, MCs adherent to the upper surface of the membrane were removed by scraping with a rubber blade. Migrating cells adherent to the lower surface of the membrane were fixed in 99·8% ethanol, stained for 10 min with hematoxylin, cleared in distilled water, and mounted on a microscope slide. MC migration was quantified by counting the number of cells that had traversed the membrane and were attached to the bottom surface of the filter. Ten high‐power fields were calculated in each assay (×250). Spontaneous migration served as a control and was referred to as 100%. The results were presented as a percentage of control migration.

Treatment of MCs with signaling pathway inhibitors

For analysis of cell signaling pathways, purified MCs were pretreated with several signaling molecule inhibitors or medium alone for 1 hr at 37° in a water bath with constant stirring, before the main procedure execution. JAK2 inhibitor (AG490) was used at a concentration of 10 μm, PI3K inhibitor (LY294002) was used at a concentration of 5 μm, ERK1/2 inhibitor (PD98059) was used at a concentration of 5 μm, p38 inhibitor (SB203580) was used at a concentration of 10 μm, and PLC inhibitor (U‐73122) was used at a concentration of 1 μm. The concentrations of all applied inhibitors were chosen in the preliminary experiments, in accordance with the manufacturer's instructions, and none of the inhibitors affected MC viability, as examined by trypan blue exclusion assay.

Statistical analysis

The statistical analysis of the experimental data was performed using statistica 13 software (Statsoft Inc, Tulsa, OK). Data are presented as mean ± standard deviation (SD). Normality of distribution was tested with the Shapiro–Wilk test. All comparisons between groups were carried out using Student's t‐test for small groups. Values of P < 0·05 were considered statistically significant.

Results

Expression of leptin and adiponectin receptors by native MCs

Flow cytometry and confocal microscopy were used to determine the surface expression of OB‐R, AdipoR1, and AdipoR2 by native rat MCs. As demonstrated in Fig. 1(a–c) and the Supplementary material (Fig. S2a–c), MCs express all studied receptors constitutively. A confocal microscopy analysis confirmed the presence of OB‐R, AdipoR1, and AdipoR2 in native MCs (Fig. 1d–f). Co‐staining with anti‐rat mast cell mAb AA4 antibodies confirmed that measured cells are MCs (see Supplementary material, Fig. S3a–c). Confocal and fluorescence intensity images showed that cell surface signals for OB‐R and AdipoR1 were comparable and reach up to 54·2 ± 19·9 AU (Fig. 1d) and 68·1 ± 20·8 AU (Fig. 1e), respectively. In the case of AdipoR1 expression, image analysis revealed that the intensity of cell surface fluorescence was 93·4 ± 44·2 AU (Fig. 1f). Controls for non‐specific binding of the secondary antibody confirmed the specificity of antibodies (data not shown).

Constitutive expression of OB‐R, AdipoR1, and AdipoR2 in mature rat peritoneal mast cells (MCs). (a–c) Flow cytometric analysis of surface receptor expression: shaded tracings – isotype control, open tracings – OB‐R/AdipoR1/AdipoR2 expression. (d–f) Confocal microscopy images of surface receptor expression in MCs. Single confocal sections (midsection of cells) showing the presence of OB‐R/AdipoR1/AdipoR2 and fluorescence intensity diagrams beside microphotographs showing the distribution of fluorescence in cells. The results shown are representative of three independent experiments performed in duplicate. The signal was visualized with green Alexa 488.

Effect of leptin and adiponectin on MC histamine release and cysLT generation

The effect of various concentrations of leptin and adiponectin on MC degranulation and histamine release was evaluated. As demonstrated in Fig. 2(a), leptin activated MCs to dose‐dependent release of histamine at all tested concentrations. MCs challenged with this adipocytokine at 50 ng/ml released up to 45·3 ± 4·0% of histamine. In turn, adiponectin failed to induce MC degranulation and histamine release above background levels (Fig. 2b). A potent degranulation inducer, i.e. compound 48/80, induced MC histamine secretion up to 54·6 ± 4·8%. Time–course experiments revealed statistically significant (P < 0·01) histamine release within 5 min of incubation with leptin (Fig. 2c).

Effect of leptin and adiponectin on mast cell (MC) histamine release. (a, b) MCs were incubated with different concentrations of leptin or adiponectin, compound 48/80 at 5 μg/ml (positive control) or medium alone for 30 min. (c) MCs were stimulated with leptin at 50 ng/ml for 1, 3, 5, 10 or 30 min. (d) MCs were pretreated with medium alone (none), Janus‐activated kinase (JAK2) inhibitor AG490 (10 μm), phosphatidylinositol 3‐kinase (PI3K) inhibitor LY294002 (5 μm), extracellular signal‐regulated kinase 1/2 (ERK1/2) inhibitor PD98059 (5 μm), p38 inhibitor SB203580 (10 μm) or phospholipase C (PLC) inhibitor U‐73122 (1 μm) for 1 hr before stimulation with leptin (50 ng/ml) for 30 min. Results are the mean ± SD of three independent experiments performed in duplicate. *P < 0·05, **P < 0·01, ***P < 0·001.

We next examined the involvement of some intracellular signaling molecules, such as JAK2, PI3K, ERK1/2, p38, as well as PLC in leptin‐induced MC histamine release. We documented that MC pretreatment with ERK1/2 inhibitor PD98059 noticeably and statistically significantly (P < 0·001) suppressed leptin‐mediated histamine release. We also established that PLC inhibitor U‐73122 and JAK2 inhibitor AG490 significantly (P < 0·01 and P < 0·05, respectively) reduced histamine release by MCs in response to leptin stimulation (Fig. 2d).

Next, we evaluated the effect of leptin and adiponectin on cysLT generation and release. Leptin stimulation caused dose‐dependent cysLT generation by MCs. At leptin concentration of 0·1 or 50 ng/ml, rat MCs released up to 26·5 ± 1·5 pg per 1·5 × 10⁶ cells and 76·4 ± 3·0 pg per 1·5 × 10⁶ cells, respectively. In comparison, cysLT production and release after ionophore A23187 stimulation, which is a well‐known stimulating agent to LT synthesis and release,29 were as high as 163·6 ± 10·8 pg per 1·5 × 10⁶ cells (Fig. 3a). As shown in Fig. 3(b), adiponectin did not stimulate cysLT production and release by MCs. We then asked whether JAK2, PI3K, ERK1/2, and p38 are engaged in the leptin‐induced cysLT generation. Pretreatment of MCs with JAK2 inhibitor AG490, ERK1/2 inhibitor PD98059, and p38 inhibitor, i.e. SB203580, caused a statistically significant (P < 0·001) decrease in leptin‐mediated cysLT generation and release. We also found that pretreatment of MCs with PI3K inhibitor LY294002 resulted in partially but statistically significant (P < 0·01) decrease in the leptin‐induced cysLT generation (Fig. 3c).

Effect of leptin and adiponectin on mast cell (MC) cysteinyl leukotriene (cysLT) generation. (a, b) MCs were incubated with different concentrations of leptin or adiponectin, calcium ionophore A23187 at 5 μg/ml (positive control) or medium alone for 1 hr. (c) MCs were pretreated with medium alone (none), Janus‐activated kinase (JAK2) inhibitor AG490 (10 μm), phosphatidylinositol 3‐kinase (PI3K) inhibitor LY294002 (5 μm), extracellular signal‐regulated kinase 1/2 (ERK1/2) inhibitor PD98059 (5 μm) or p38 inhibitor SB203580 (10 μm) for 1 hr before stimulation with leptin (50 ng/ml). Results are the mean ± SD of three independent experiments performed in duplicate. *P < 0·05, **P < 0·01, ***P < 0·001.

Effect of leptin and adiponectin on MC CCL2 and IL‐10 generation

Next, we investigated whether leptin and adiponectin, used at different concentrations, stimulate MCs to de novo CCL2 production. Rat MCs were incubated with leptin or adiponectin for 3 hr, using medium alone or anti‐IgE as negative and positive controls, respectively. Significantly greater amounts of chemokine CCL2 were synthesized and released from MCs stimulated with 100 ng/ml of leptin than those stimulated with anti‐IgE (Fig. 4a). The MCs released up to 171·8 ± 30·6 pg CCL2 per 1·5 × 10⁶ MCs following exposure to 100 ng/ml leptin, compared with 105·7 ± 10·0 pg CCL2 per 1·5 × 10⁶ MCs following anti‐IgE stimulation. As shown in Fig. 4b, adiponectin did not activate CCL2 production and release by MCs.

Effect of leptin and adiponectin on mast cells (MCs). (a, b) CCL2 and (c, d) interleukin‐10 (IL‐10) generation. MCs were incubated with different concentrations of leptin or adiponectin, anti‐IgE at 5 μg/ml or *Escherichia coli* lipopolysaccharide at 5 μg/ml (positive controls for CCL2 and IL‐10 assay, respectively) or medium alone for 3 hr. (e) MCs were pretreated with medium alone (none), phosphatidylinositol 3‐kinase (PI3K) inhibitor LY294002 (5 μm), extracellular signal‐regulated kinase 1/2 (ERK1/2) inhibitor PD98059 (5 μm) or p38 inhibitor SB203580 (10 μm) for 1 hr before stimulation with adiponectin (10 μg/ml). Results are the mean ± SD of three independent experiments performed in duplicate. *P < 0·05, **P < 0·01, ***P < 0·001.

The effect of leptin and adiponectin on IL‐10 generation and release by MCs was also assessed. Adiponectin, but not leptin, caused IL‐10 production by those cells (Fig. 4c, d). Of the various concentrations of adiponectin, the greatest IL‐10 generation was observed at 30 μg/ml, rising to 115·4 ± 21·6 pg per 1·5 × 10⁶ cells. We then asked whether PI3K, ERK1/2, and p38 play a role in the adiponectin‐induced IL‐10 generation. We showed that MC pre‐incubation with PI3K inhibitor LY294002 and p38 inhibitor SB203580 statistically significantly (P < 0·001) reduced adiponectin‐mediated IL‐10 synthesis (Fig. 4e).

Effect of leptin and adiponectin on MC cytokine/chemokine mRNA levels and intracellular cytokine production

Then, qRT‐PCR was carried out and the fold change of cytokine/chemokine mRNA expression in leptin‐stimulated MCs (50 ng/ml) and adiponectin‐stimulated MCs (10 μg/ml) compared with non‐stimulated cells was assessed (Fig. 5a). Among the cytokines/chemokines measured in leptin‐stimulated MCs, the highest mRNA expression levels were observed for pro‐inflammatory ones, i.e. IL‐4 (11‐fold increase), IL‐1β (7‐fold increase), CCL2 (4·6‐fold increase), TNF (4·5‐fold increase), CCL3 (4‐fold increase), IL‐33 (2·2‐fold), and interferon‐α (IFN‐α; 2·1‐fold), whereas levels of mRNAs corresponding to the anti‐inflammatory cytokines IL‐10 and TGF‐β were decreased relative to non‐stimulated MCs. Also, the mRNA levels for IL‐6, CCL4, IFN‐γ, and GM‐CSF were lower in leptin‐stimulated MCs in comparison with non‐stimulated cells. At the same time, we documented that leptin did not influence IL‐18 and IFN‐β mRNA expression in these cells.

Effect of leptin and adiponectin on mast cells (MCs) (a) cytokine/chemokine mRNA expression, and intracellular (b, g) interleukin‐1β (IL‐1β), (c, h) IL‐4, (d, i) CCL3, (e, j) granulocyte–macrophage colony‐stimulating factor (GM‐CSF), and (f, k) transforming growth factor‐β (TGF‐β) production. (a) MCs were incubated with leptin (50 ng/ml) or adiponectin (10 μg/ml) for 2 hr. Total mRNA was extracted and converted into cDNA, and qRT‐PCR was conducted to evaluate cytokine/chemokine mRNA expression. The expression of mRNAs was corrected by normalization based on the transcript level of the housekeeping gene rat *Actb*. Results are expressed as the mean of three independent experiments. (b–f) MCs were incubated with leptin (50 ng/ml), adiponectin (10 μg/ml), or medium alone (NS) for 4 hr in a humidified atmosphere with 5% CO ₂ at 37°. The percentages of cytokine‐producing cells were assessed. The results shown are representative of three independent experiments performed in duplicate. (g–k) Same as for (b–f). Results are the mean ± SD of three independent experiments performed in duplicate. (l) Isotype control staining confirming the specificity of the antibodies used in intracellular staining.

We observed that stimulation of rat MCs with adiponectin resulted in a substantial increase in mRNA expression of the anti‐inflammatory cytokines TGF‐β (14·4‐fold) and IL‐10 (3·8‐fold). Adiponectin incubation of MCs led to reduced expression of IL‐18, IL‐33, CCL2, CCL4, IFN‐α, IFN‐β, and IFN‐γ. In contrast, adiponectin stimulation of MCs resulted in up‐regulation of IL‐4 (9‐fold), IL‐1β (6·4‐fold), GM‐CSF (3·6‐fold), TNF (3·5‐fold), and CCL3 (3·3‐fold) expression. We also found that adiponectin did not affect IL‐6 mRNA expression in those cells.

By intracellular staining with flow cytometry analysis, we noticed that the production of IL‐1β, IL‐4, and CCL3 (Fig. 5b–d, g–i) were increased in both leptin‐ and adiponectin‐stimulated MCs. We also observed that stimulation of rat primary MCs with adiponectin, but not leptin, resulted in intracellular production of GM‐CSF and TGF‐β (Fig. 5e,f, j,k). Isotype control staining confirmed the specificity of the used antibodies (Fig. 5l).

Effect of leptin and adiponectin on ROS production by MCs

Confocal microscopy was used to examine the influence of leptin at 1 or 100 ng/ml and adiponectin at 1 or 10 μg/ml on ROS generation. Treatment with leptin at 1 ng/ml induced four‐fold greater ROS production (213·4 ± 27·6 AU) (Fig. 6a), and adiponectin used at 1 μg/ml induced three‐fold greater production (116·7 ± 22·7 AU) compared with the respective controls (45·4 ± 6·7 AU and 34·5 ± 11·9 AU) (Fig. 6b). Interestingly, the basal level of ROS increased by approximately five‐fold (236·0 ± 13·1 AU) in the case of treatment with higher concentration of leptin (100 ng/ml) and was five‐fold higher following treatment with adiponectin used at 10 μg/ml (162·7 ± 22·1 AU) compared with non‐stimulated MCs.

Effect of leptin and adiponectin on reactive oxygen species (ROS) production by mast cells (MCs). MCs were incubated with (a) 1 or 100 ng/ml leptin, (b) 1 or 10 μg/ml adiponectin or medium alone (NS). Indicator for ROS, 2′,7′‐dichlorodihydrofluorescein diacetate (H₂ DCFDA), was used at a concentration of 2 μm for 10 min. The results shown are representative of three independent experiments performed in duplicate. Fluorescence intensity diagrams showing the distribution of fluorescence in cells were mounted.

Effect of leptin and adiponectin on surface cysLT receptor expression on MCs

We were next interested in determining whether leptin and adiponectin stimulation influences CYSLTR1, CYSLTR2, and GPR17 surface expression by mature rat MCs. Receptor expression was evaluated on native MCs, as well as on MCs exposed to leptin at a concentration of 1 or 100 ng/ml and adiponectin at a concentration of 1 or 10 μg/ml for 1 hr. It was found that the baseline level of CYSLTR1 expression was significantly up‐regulated (P < 0·001) following incubation with 1 ng/ml and 100 ng/ml leptin, reaching 364·2 ± 46·1% and 587·2 ± 66·2% of control CYSLTR1 expression on native MCs, respectively (Fig. 7a). Incubation of MCs with 1 and 10 μg/ml of adiponectin resulted in a non‐significant increase in CYSLTR1 expression level compared with the control non‐stimulated MCs (140·9 ± 13·5% and 171·9 ± 47·0% of control CYSLTR1 expression, respectively).

Effect of leptin and adiponectin stimulation on (a) CYSLTR1, (b) CYSLTR2, (c) GPR17 surface expression in mast cells (MCs). MCs were incubated with medium alone, leptin at 1 or 100 ng/ml and adiponectin at 1 or 10 μg/ml. Left panel: representative flow cytometry histograms showing CYSLTR1, CYSLTR2, and GPR17 expression. Shaded tracings – isotype control, open tracings – receptor expression in native cells (green), leptin‐ or adiponectin‐induced cells at 1 ng/ml and 1 μg/ml, respectively (violet), leptin‐ and adiponectin‐induced cells at 100 ng/ml and 10 μg/ml, respectively (blue). Right panel: constitutive receptor expression served as a control and was referred to 100%. The results are presented as a percentage of constitutive receptor expression. Results are the mean of fluorescent intensity ± SD of three experiments performed in duplicate. *P < 0·05, **P < 0·01, ***P < 0·001.

As shown in Fig. 7(b), MC stimulation with leptin used at a concentration of 1 or 100 ng/ml resulted in a statistically significant (P < 0·01 and P < 0·05, respectively) increase in CYSLTR2 level, compared with the control non‐stimulated MCs (174·0 ± 8·8% and 250·2 ± 64·8% of control CYSLTR2 expression, respectively). In turn, adiponectin at 1 μg/ml caused a significant decrease (P < 0·01) in CYSLTR2 expression compared with non‐stimulated cells (12·8 ± 2·0% of control CYSLTR2 expression), whereas MC incubation with a higher adiponectin concentration (10 μg/ml) resulted in non‐significant CYSLTR2 expression level decrease, reaching 78·5 ± 11·8% of control CYSLTR2 expression on native MCs.

Both leptin and adiponectin enhanced the GPR17 expression level (Fig. 7c). MC stimulation with 1 or 100 ng/ml of leptin resulted in significant increase (P < 0·05 and P < 0·01, respectively) in GPR17 expression (291·6 ± 78·1 and 460·0 ± 102·8% of control GPR17 expression, respectively). It was also noticed that the baseline level of GPR17 expression was significantly up‐regulated following incubation with 1 μg/ml (P < 0·01) and 10 μg/ml (P < 0·001) adiponectin, reaching 214·3 ± 30·0% and 261·8 ± 7·3% of control GPR17 expression on native MCs, respectively.

Effect of leptin and adiponectin on MC migratory response

Mast cells were incubated with leptin or adiponectin for 3 hr in a Boyden microchamber, used at a wide range of concentrations, to determine their capability to induce MC migration. For comparison, we studied the migration of MCs in response to TNF, a well‐known mature MC chemotactic factor.30 We found that leptin, at all concentrations used, induced MC migration in the presence of the extracellular matrix proteins. A maximal response for leptin‐induced MC migration was observed at a concentration of 10^–1 ng/ml in the presence of laminin (323·9 ± 24·7% of control migration) and fibronectin (223·5 ± 26·9% of control migration) (Fig. 8a). Under the same experimental conditions, rat MCs were found to migrate in response to adiponectin. The optimal concentration of this adipokine for maximal migration of MCs was 10⁻¹ μg/ml in the presence of laminin (151·7 ± 16·7% of control migration) and 10⁻³ μg/ml in the presence of fibronectin (143·6 ± 6·3% of control migration) (Fig. 8b). For comparison, rat MCs also migrated in response to TNF stimulation with the optimal concentration of TNF for maximal migration of MCs being 0·01 pg/ml (Fig. 8c).

(a) Leptin‐induced, (b) adiponectin‐induced, and (c) tumor necrosis factor ( TNF) ‐induced mast cell (MC) migration. MCs were incubated with different concentrations of leptin, adiponectin, TNF (positive control) or medium alone (control spontaneous MC migration) for 3 hr at 37° in a Boyden microchamber. Laminin‐coated (○) or fibronectin‐coated (●) filters were used. (d) MCs were pretreated with medium alone (none), Janus‐activated kinase (JAK2) inhibitor AG490 (10 μm), phosphatidylinositol 3‐kinase (PI3K) inhibitor LY294002 (5 μm), extracellular signal‐regulated kinase 1/2 (ERK1/2) inhibitor PD98059 (5 μm) or p38 inhibitor SB203580 (10 μm) for 1 hr before stimulation with leptin (0·1 ng/ml). (e) MCs were pretreated with medium alone (none), PI3K inhibitor LY294002 (5 μm), ERK1/2 inhibitor PD98059 (5 μm) or p38 inhibitor SB203580 (10 μm) for 1 hr before stimulation with adiponectin (0·1 μg/ml). Ten high‐power fields were counted in each assay (×250). Spontaneous migration served as a control and was referred to 100%. Each point represents the mean ± SD of three independent experiments performed in duplicate. *P < 0·05, **P < 0·01, ***P < 0·001.

To evaluate the intracellular mechanisms involved in the leptin‐induced MC migratory response, we examined the impact of JAK2 inhibitor AG490, PI3K inhibitor LY294002, ERK1/2 inhibitor PD98059, and p38 inhibitor SB203580. We noticed that MC pretreatment with AG490, LY294002, and PD98059 significantly (P < 0·001) abolished MC migration toward leptin. We also found that pretreatment of MCs with p38 inhibitor SB203580 resulted in a partial, but statistically significant (P < 0·05), decrease in leptin‐mediated MC migration (Fig. 8d).

We also asked whether PI3K, ERK1/2, and p38 play a role in adiponectin‐induced MC migration. We documented that MC pretreatment with ERK1/2 inhibitor PD98059 statistically significantly suppressed adiponectin‐mediated migration (P < 0·001). However, MC pre‐incubation with PI3K inhibitor LY294002 and p38 inhibitor SB203580 did not affect MC migration (Fig. 8e).

Discussion

A growing body of evidence indicates that the course of inflammation is regulated not only by humoral factors such as cytokines, chemokines, complement components, acute‐phase proteins, or heat‐shock proteins but also by adipocytokines. Adipocytokines influence cell influx to the site of inflammation by affecting the expression of adhesion molecules in endothelial cells, monocytes/macrophages, granulocytes, and dendritic cells, and they act as chemoattractants for those cells. Adipocytokines also activate endothelial cells, monocytes/macrophages, eosinophils, basophils, and dendritic cells to synthesize a broad spectrum of various mediators, which regulate the course of inflammation. Also, adipocytokines affect the activity of macrophages and dendritic cells by induction of anti‐inflammatory mediator synthesis. However, few data are available regarding the direct effect of adipocytokines on MCs. As MCs are involved in diverse inflammatory processes, in the present study, we decided to evaluate the influence of leptin and adiponectin on some aspects of tissue MC activity.

We documented that leptin stimulates MCs to histamine secretion as well as to cysLTs and chemokine CCL2 generation. In contrast, adiponectin fails to activate MCs to the production and release of these mediators. We also provided unique data that adiponectin, in the same way as leptin, activates MCs to ROS production, although at a lower level than in leptin‐stimulated cells. It is widely known that histamine plays an essential role in the regulation of immune responses and actively promotes inflammatory processes.31, 32, 33 Similarly, cysLTs and chemokine CCL2 are factors that noticeably contribute to supporting and maintaining inflammatory responses, as they stimulate various cells to the production of pro‐inflammatory mediators, augment vascular permeability, enhance cell adhesion to the vascular epithelium, and may recruit immune cells into inflamed tissues.34, 35 Likewise, ROS exert diverse pro‐inflammatory effects.36

Furthermore, our present findings indicate that both adipocytokines affect mRNA expression of various cytokines/chemokines. In particular, these factors up‐regulate the mRNA level of IL‐1β, TNF, and CCL3, which all, in different ways, promote the development of inflammation.37 It is worthy of note that adiponectin, but not leptin, sharply increases the mRNA expression of the cytokines with anti‐inflammatory and immunosuppressive functions, i.e. IL‐10 and TGF‐β.38, 39 Adiponectin increases the mRNA expression of GM‐CSF, a cytokine exerting pro‐inflammatory or anti‐inflammatory/regulatory effects, as well.40 Interestingly, leptin, like adiponectin, significantly up‐regulates mRNA level of IL‐4, i.e. the cytokine that strongly affects B and T helper type 2 cell differentiation and survival,41 plays a critical role in regulating the function of macrophages and MCs,42, 43 and controls the mechanisms of inflammatory processes.44 Moreover, we demonstrated that leptin and adiponectin augment the intracellular production of IL‐1β, IL‐4, and CCL3, which clearly confirmed that both adipocytokines affect the synthesis of those cytokines by MCs. Intracellular cytokine staining also confirmed that adiponectin induces the enhanced synthesis of GM‐CSF and TGF‐β by MCs.

Our findings also indicate that leptin markedly augments the surface expression of receptors for cysLTs, i.e. CYSLTR1, CYSLTR2, and GPR17 on MCs, whereas adiponectin increases only GPR17 expression, and decreases CYSLTR2 level. It should be underlined that GPR17 functions as a negative regulator of LTD₄‐mediated CYSLTR1 activation.45 These results are intriguing, as they might suggest that leptin enhances and adiponectin reduces MC responsiveness to cysLTs, mediators that actively promote the development of inflammation within tissues.34 An important observation is that both adipocytokines, in the presence of extracellular matrix proteins, induce MC migratory response, as this means that both adipocytokines may act as potent MC chemoattractants, particularly in their milieu. However, this effect is more pronounced in leptin‐induced MC migration. MC influx in local tissues may notably promote an ongoing inflammatory process.

To date, it has not been entirely clear what are the precise leptin and adiponectin concentrations in physiological conditions. Nevertheless, it is indicated that average levels of circulating leptin range from 5 to 15 ng/ml in healthy individuals.46 In turn, physiological adiponectin serum concentrations range from 2 to 20 μg/ml, which is 1000‐fold higher than most other adipocytokines including leptin.47 Therefore, we assume that the concentrations of both adipokines used in this study correspond to those occurring under physiological conditions.

The functional receptor for leptin has been identified. It is established that this adipocytokine acts through the membrane‐spanning receptor OB‐R, which belongs to the class I cytokine receptor family.48 It is also documented that leptin signaling occurs typically by way of the JAK/signal transducer and activator of transcription (STAT) pathway with the primary involvement of JAK2 molecule. In leptin signaling, a crucial role of PI3K, ERK1/2, mitogen‐activated protein kinase (MAPK), and AMP‐activated protein kinase (AMPK) pathways is also suggested.48, 49 Moreover, Zhou, et al.50 studied the involvement of JAK2, IκB, PI3K, ERK1/2, p38, JNK, and STAT5 molecules in leptin‐induced cytokine production by bone‐marrow‐derived MCs and leptin‐induced histamine release from these cells. OB‐R is present in peripheral tissues and different immune cell populations, i.e. B and T cells, natural killer cells, macrophages/monocytes, granulocytes, and epithelial and dendritic cells.51 There is also some information that MCs express OB‐R. This receptor has been demonstrated on human tissue MCs52 and murine bone‐marrow‐derived MCs.50 In our previous paper, we showed the expression of OB‐R on rat tissue MCs.53 Our present findings confirmed the presence of OB‐R on these cells. Furthermore, we established that inhibition of JAK2 molecule significantly reduced leptin‐induced MC histamine release, cysLT production, and migration. These results seem to indicate that OB‐R is involved in leptin‐mediated MC activity. Besides, we found that leptin‐mediated histamine secretion from MCs required the activity of both PLC and ERK1/2, but not PI3K or p38 molecules. What is more, leptin‐induced cysLT synthesis and the MC migratory response depended on PI3K, p38, and ERK1/2 involvement.

Adiponectin exerts its actions by binding to receptors AdipoR1 and AdipoR2, which are seven‐transmembrane domain receptors with an internal N‐terminus and an external C‐terminus.54 Our understanding of precise adiponectin‐mediated signal transduction pathways is still limited. However, it has been indicated that the signaling pathways involved in adiponectin‐induced cell response/activity are tissue‐/cell‐type‐specific, including mainly p38 MAPK, ERK1/2 MAPK, and PI3K pathways.55, 56, 57 Receptors for adiponectin were found in adipocytes, hepatocytes, and muscle cells54 but they are also identified in B and natural killer cells, monocytes, and neutrophils.58 In the present study, for the first time, we have provided evidence that fully mature rat tissue MCs express both AdipoR1 and AdipoR2, as assessed by flow cytometry and confocal microscopy. Moreover, our results showed that adiponectin‐induced IL‐10 generation by MCs was mediated via PI3K and p38, but not ERK1/2, pathways, whereas MC migratory response is ERK1/2‐dependent but did not require PI3K and p38 involvement.

It must be emphasized that there is currently a lack of data regarding the direct action of leptin on MC activity. Only Zhou et al.50 established that this adipocytokine directly induces histamine release as well as IL‐13, IFN‐γ, and CCL2 synthesis, but reduces IL‐4, IL‐6, IL‐10, and CCL3 production by murine bone‐marrow‐derived MCs. Besides, we previously indicated that leptin induces Ca²⁺‐dependent MC degranulation as well as cysLTs and CCL3 production.59 Our present findings provided further information on leptin impact on MC activity. Moreover, our observations that adiponectin affects tissue MC response are entirely innovative as, to our best knowledge, there is no information about the direct impact of adiponectin on MC activity.

In conclusion, in the current paper, we clearly demonstrated that mature tissue MCs constitutively express receptors for leptin, i.e. OB‐R, and adiponectin, i.e. AdipoR1 and AdipoR2. Moreover, we indicated that these two adipocytokines affect MC activity. Our findings seem to be of great importance inasmuch as MCs are numerous within connective tissues, and they are the source of many different mediators with a broad range of biological activities. That is why MCs are involved in mechanisms of various physiological and pathological processes, and especially they are key players in inflammatory reactions. Hence, observations that leptin and adiponectin regulate MC activity might indicate that adipocytokines modulate the different processes in which MCs are involved. In particular, it is worth noting that MCs are present in the adipose tissue, and their number in individuals with obesity is notably increased. Furthermore, increasing evidence suggest that MCs are involved in low‐grade inflammation within adipose tissue, a state accompanying obesity.28 Hence, data obtained in this study could imply that the involvement of MCs in obesity‐related low‐grade inflammation might be affected by adipocytokines. Further studies regarding the impact of leptin, adiponectin, and also other adipocytokines, on MC activity in inflammation as well as other pathological processes, are needed.

Disclosures

The authors declared no conflicts of interest.

Author contributions

P.Ż., J.A., and E.B.B. designed the study and wrote the paper; P.Ż., S.R., S.W., and M.W. performed the research; E.K. created the figures and table, and compiled the references; E.B.B. revised and finalized the paper.

Supporting information

Figure S1. Representative flow cytometry analysis of mast cells (MCs) showing gating strategy based on (a, b) SSC/FSC, (c) surface expression of MC‐specific gangliosides recognized by mAb AA4, and (d) FcεRI co‐stained with mAb AA4. (e) Toluidine blue staining of rat peritoneal MCs (original magnification × 400).

Click here for additional data file.^{(335.3KB, tif)}

Figure S2. Left panel: Representative flow cytometry dot plots for analysis of constitutive expression for (a) OB‐R, (b) AdipoR1, and (c) AdipoR2 in mature rat peritoneal primary mast cells (MCs) co‐stained with mAb AA4 antibodies recognizing MC‐specific gangliosides. Right panel: Representative flow cytometry histograms showing OB‐R, AdipoR1, and AdipoR2 expression. The results shown are representative of three independent experiments performed in duplicate.

Click here for additional data file.^{(194.1KB, tif)}

Figure S3. Confocal microscopy images of surface (a) OB‐R (green; Alexa 488) and AA4 (orange; PE), (b) AdipoR1 (green; Alexa 488) and AA4 (orange; PE), (c) AdipoR2 (green; Alexa 488) and AA4 (orange; PE) expression in mature rat peritoneal mast cells (MCs). Fluorescence in the merged image represents co‐localization of OB‐R/AdipoR1/AdipoR2 and AA4 in MCs. (d) Isotype control staining for confocal results.

Click here for additional data file.^{(370.6KB, tif)}

Click here for additional data file.^{(14KB, docx)}

Acknowledgements

This work was supported by the Medical University of Lodz (grant numbers 502‐03/6‐164‐01/502‐64‐105, 503/6‐164‐01/503‐61‐001, 503/6‐164‐01/503‐66‐001).

References

1. Fasshauer M, Blüher M. Adipokines in health and disease. Trends Pharmacol Sci 2015; 36:461–70. [DOI] [PubMed] [Google Scholar]
2. Mancuso P. The role of adipokines in chronic inflammation. Immunotargets Ther 2016; 5:47–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Deng Y, Scherer PE. Adipokines as novel biomarkers and regulators of the metabolic syndrome. Ann N Y Acad Sci 2010; 1212:E1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Żelechowska P, Kozłowska E, Pastwińska J, Agier J, Brzezińska‐Błaszczyk E. Adipocytokine involvement in innate immune mechanisms. J Interferon Cytokine Res 2018; 38:527–38. 10.1089/jir.2018.0102 [DOI] [PubMed] [Google Scholar]
5. Carbone F, La Rocca C, Matarese G. Immunological functions of leptin and adiponectin. Biochimie 2012; 94:2082–8. [DOI] [PubMed] [Google Scholar]
6. Schroeter MR, Leifheit M, Sudholt P, Heida NM, Dellas C, Rohm I, et al Leptin enhances the recruitment of endothelial progenitor cells into neointimal lesions after vascular injury by promoting integrin‐mediated adhesion. Circ Res 2008; 103:536–44. [DOI] [PubMed] [Google Scholar]
7. Wong CK, Cheung PF, Lam CW. Leptin‐mediated cytokine release and migration of eosinophils: implications for immunopathophysiology of allergic inflammation. Eur J Immunol 2007; 37:2337–48. [DOI] [PubMed] [Google Scholar]
8. Najib S, Sánchez‐Margalet V. Human leptin promotes survival of human circulating blood monocytes prone to apoptosis by activation of p42/44 MAPK pathway. Cell Immunol 2002; 220:143–9. [DOI] [PubMed] [Google Scholar]
9. Bruno A, Conus S, Schmid I, Simon HU. Apoptotic pathways are inhibited by leptin receptor activation in neutrophils. J Immunol 2005; 174:8090–6. [DOI] [PubMed] [Google Scholar]
10. Acedo SC, Gambero S, Cunha FG, Lorand‐Metze I, Gambero A. Participation of leptin in the determination of the macrophage phenotype: an additional role in adipocyte and macrophage crosstalk. Vitro Cell Dev Biol Anim 2013; 49:473–8. [DOI] [PubMed] [Google Scholar]
11. Suzukawa M, Nagase H, Ogahara I, Han K, Tashimo H, Shibui A, et al Leptin enhances survival and induces migration, degranulation, and cytokine synthesis of human basophils. J Immunol 2011; 186:5254–60. [DOI] [PubMed] [Google Scholar]
12. Gruen ML, Hao M, Piston DW, Hasty AH. Leptin requires canonical migratory signaling pathways for induction of monocyte and macrophage chemotaxis. Am J Physiol Cell Physiol 2007; 293:C1481–8. [DOI] [PubMed] [Google Scholar]
13. Mattioli B, Straface E, Matarrese P, Quaranta MG, Giordani L, Malorni W, et al Leptin as an immunological adjuvant: enhanced migratory and CD8⁺ T cell stimulatory capacity of human dendritic cells exposed to leptin. FASEB J 2008; 22:2012–22. [DOI] [PubMed] [Google Scholar]
14. Ouchi N, Kihara S, Arita Y, Maeda K, Kuriyama H, Okamoto Y, et al Novel modulator for endothelial adhesion molecules: adipocyte‐derived plasma protein adiponectin. Circulation 1999; 100:2473–6. [DOI] [PubMed] [Google Scholar]
15. Yokota T, Oritani K, Takahashi I, Ishikawa J, Matsuyama A, Ouchi N, et al Adiponectin, a new member of the family of soluble defense collagens, negatively regulates the growth of myelomonocytic progenitors and the functions of macrophages. Blood 2000; 96:1723–32. [PubMed] [Google Scholar]
16. Wolf AM, Wolf D, Rumpold H, Enrich B, Tilg H. Adiponectin induces the anti‐inflammatory cytokines IL‐10 and IL‐1RA in human leukocytes. Biochem Biophys Res Commun 2004; 323:630–5. [DOI] [PubMed] [Google Scholar]
17. Yamamoto R, Ueki S, Moritoki Y, Kobayashi Y, Oyamada H, Konno Y, et al Adiponectin attenuates human eosinophil adhesion and chemotaxis: implications in allergic inflammation. J Asthma 2013; 50:828–35. [DOI] [PubMed] [Google Scholar]
18. Bråkenhielm E, Veitonmäki N, Cao R, Kihara S, Matsuzawa Y, Zhivotovsky B, et al Adiponectin induced antiangiogenesis and antitumor activity involve caspase‐mediated endothelial cell apoptosis. Proc Natl Acad Sci USA 2004; 101:2476–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Krystel‐Whittemore M, Dileepan KN, Wood JG. Mast cell: a multi‐functional master cell. Front Immunol 2016; 6:620. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Mukai K, Tsai M, Saito H, Galli SJ. Mast cells as sources of cytokines, chemokines, and growth factors. Immunol Rev 2018; 282:121–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. da Silva EZ, Jamur MC, Oliver C. Mast cell function: a new vision of an old cell. J Histochem Cytochem 2014; 62:698–738. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Moon TC, Befus AD, Kulka M. Mast cell mediators: their differential release and the secretory pathways involved. Front Immunol 2014; 5:569. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Anand P, Singh B, Jaggi AS, Singh N. Mast cells: an expanding pathophysiological role from allergy to other disorders. Naunyn Schmiedebergs Arch Pharmacol 2012; 385:657–70. [DOI] [PubMed] [Google Scholar]
24. Rodewald HR, Feyerabend TB. Widespread immunological functions of mast cells: fact or fiction? Immunity 2012; 37:13–24. [DOI] [PubMed] [Google Scholar]
25. Conti P, Carinci F, Caraffa A, Ronconi G, Lessiani G, Theoharides TC. Link between mast cells and bacteria: antimicrobial defense, function and regulation by cytokines. Med Hypotheses 2017; 106:10–4. [DOI] [PubMed] [Google Scholar]
26. Pastwińska J, Agier J, Dastych J, Brzezińska‐Błaszczyk E. Mast cells as the strength of the inflammatory process. Pol J Pathol 2017; 68:187–96. [DOI] [PubMed] [Google Scholar]
27. Conti P, Ronconi G, Kritas SK, Caraffa A, Theoharides TC. Activated mast cells mediate low‐grade inflammation in type 2 diabetes: interleukin‐37 could be beneficial. Can J Diabetes 2018; 42:568–73. [DOI] [PubMed] [Google Scholar]
28. Żelechowska P, Agier J, Kozłowska E, Brzezińska‐Błaszczyk E. Mast cells participate in chronic low‐grade inflammation within adipose tissue. Obes Rev 2018; 19:686–97. [DOI] [PubMed] [Google Scholar]
29. Penzo D, Petronilli V, Angelin A, Cusan C, Colonna R, Scorrano LP, et al Arachidonic acid released by phospholipase A2 activation triggers Ca²⁺‐dependent apoptosis through the mitochondrial pathway. J Biol Chem 2004; 279:25219–25. [DOI] [PubMed] [Google Scholar]
30. Brzezińska‐Błaszczyk E, Pietrzak A, Misiak‐Tłoczek AH. Tumor necrosis factor (TNF) is a potent rat mast cell chemoattractant. J Interferon Cytokine Res 2007; 27:911–9. [DOI] [PubMed] [Google Scholar]
31. Jutel M, Blaser K, Akdis CA. The role of histamine in regulation of immune responses. Chem Immunol Allergy 2006; 91:174–87. [DOI] [PubMed] [Google Scholar]
32. Benly P. Role of histamine in acute inflammation. Int J Pharm Sci Res 2015; 7:373–6. [Google Scholar]
33. Branco ACCC, Yoshikawa FSY, Pietrobon AJ, Sato M. Role of histamine in modulating the immune response and inflammation. Mediators Inflamm 2018; 2018:9524075. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Kanaoka Y, Boyce JA. Cysteinyl leukotrienes and their receptors: cellular distribution and function in immune and inflammatory responses. J Immunol 2004; 173:1503–10. [DOI] [PubMed] [Google Scholar]
35. Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein‐1 (MCP‐1): an overview. J Interferon Cytokine Res 2009; 29:313–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Ingram SL, Diotallevi M. Reactive oxygen species: rapid fire in inflammation. Biochemist 2017; 39:30–3. [Google Scholar]
37. Abdulkhaleq LA, Assi MA, Abdullah R, Zamri‐Saad M, Taufiq‐Yap YH, Hezmee MNM. The crucial roles of inflammatory mediators in inflammation: a review. Vet World 2018; 11:627–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. Regulation and functions of the IL‐10 family of cytokines in inflammation and disease. Annu Rev Immunol 2011; 29:71–109. [DOI] [PubMed] [Google Scholar]
39. Yoshimura A, Wakabayashi Y, Mori T. Cellular and molecular basis for the regulation of inflammation by TGF‐β. J Biochem 2010; 147:781–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Bhattacharya P, Budnick I, Singh M, Thiruppathi M, Alharshawi K, Elshabrawy H, et al Dual role of GM‐CSF as a pro‐inflammatory and a regulatory cytokine: implications for immune therapy. J Interferon Cytokine Res 2015; 35:585–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Gadani SP, Cronk JC, Geoffrey T, Norris GT, Kipnis J. Interleukin‐4: a cytokine to remember. J Immunol 2012; 189:4213–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Ho IC, Miaw SC. Regulation of IL‐4 expression in immunity and diseases. Adv Exp Med Biol 2016; 941:31–77. [DOI] [PubMed] [Google Scholar]
43. McLeod JJ, Baker B, Ryan JJ. Mast cell production and response to IL‐4 and IL‐13. Cytokine 2015; 75:57–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Luzina IG, Keegan AD, Heller NM, Rook GA, Shea‐Donohue T, Atamas SP. Regulation of inflammation by interleukin‐4: a review of “alternatives”. J Leukoc Biol 2012; 92:753–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Maekawa A, Balestrieri B, Austen KF, Kanaoka Y. GPR17 is a negative regulator of the cysteinyl leukotriene 1 receptor response to leukotriene D₄ . Proc Natl Acad Sci USA 2009; 106:11685–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Dardeno TA, Chou SH, Moon HS, Chamberland JP, Fiorenza CG, Mantzoros CS. Leptin in human physiology and therapeutics. Front Neuroendocrinol 2010; 31:377–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Turer AT, Scherer PE. Adiponectin: mechanistic insights and clinical implications. Diabetologia 2012; 55:2319–26. [DOI] [PubMed] [Google Scholar]
48. Wauman J, Zabeau L, Tavernier J. The leptin receptor complex: heavier than expected? Front Endocrinol (Lausanne) 2017; 8:30. [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Frühbeck G. Intracellular signalling pathways activated by leptin. Biochem J 2006; 393:7–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Zhou Y, Yu X, Chen H, Sjöberg S, Roux J, Zhang L, et al Leptin deficiency shifts mast cells toward anti‐inflammatory actions and protects mice from obesity and diabetes by polarizing M2 macrophages. Cell Metab 2015; 22:1045–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Fernández‐Riejos P, Najib S, Santos‐Alvarez J, Martín‐Romero C, Pérez‐Pérez A, González‐Yanes C, et al Role of leptin in the activation of immune cells. Mediators Inflamm 2010; 2010:568343. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Taildeman J, Pérez‐Novo CA, Rottiers I, Ferdinande L, Waeytens A, De Colvenaer V, et al Human mast cells express leptin and leptin receptors. Histochem Cell Biol 2009; 131:703–11. [DOI] [PubMed] [Google Scholar]
53. Żelechowska P, Wiktorska M, Różalska S, Stasikowska‐Kanicka O, Wągrowska‐Danilewicz M, Agier J, et al Leptin receptor is expressed by tissue mast cells. Immunol Res 2018; 66:557–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Yamauchi T, Iwabu M, Okada‐Iwabu M, Kadowaki T. Adiponectin receptors: a review of their structure, function and how they work. Best Pract Res Clin Endocrinol Metab 2014; 28:15–23. [DOI] [PubMed] [Google Scholar]
55. Shehzad A, Iqbal W, Shehzad O, Lee YS. Adiponectin: regulation of its production and its role in human diseases. Hormones (Athens) 2012; 11:8–20. [DOI] [PubMed] [Google Scholar]
56. Ghoshal K, Bhattacharyya M. Adiponectin: probe of the molecular paradigm associating diabetes and obesity. World J Diabetes 2015; 6:151–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Ozaki KI, Awazu M, Tamiya M, Iwasaki Y, Harada A, Kugisaki S, et al Targeting the ERK signaling pathway as a potential treatment for insulin resistance and type 2 diabetes. Am J Physiol Endocrinol Metab 2016; 310:E643–51. [DOI] [PubMed] [Google Scholar]
58. Pang TT, Narendran P. The distribution of adiponectin receptors on human peripheral blood mononuclear cells. Ann N Y Acad Sci 2008; 1150:143–5. [DOI] [PubMed] [Google Scholar]
59. Żelechowska P, Agier J, Różalska S, Wiktorska M, Brzezińska‐Błaszczyk E. Leptin stimulates tissue rat mast cell pro‐inflammatory activity and migratory response. Inflamm Res 2018; 67:789–99. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file.^{(335.3KB, tif)}

Click here for additional data file.^{(194.1KB, tif)}

Click here for additional data file.^{(370.6KB, tif)}

Click here for additional data file.^{(14KB, docx)}

[imm13090-bib-0001] 1. Fasshauer M, Blüher M. Adipokines in health and disease. Trends Pharmacol Sci 2015; 36:461–70. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0002] 2. Mancuso P. The role of adipokines in chronic inflammation. Immunotargets Ther 2016; 5:47–56. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0003] 3. Deng Y, Scherer PE. Adipokines as novel biomarkers and regulators of the metabolic syndrome. Ann N Y Acad Sci 2010; 1212:E1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0004] 4. Żelechowska P, Kozłowska E, Pastwińska J, Agier J, Brzezińska‐Błaszczyk E. Adipocytokine involvement in innate immune mechanisms. J Interferon Cytokine Res 2018; 38:527–38. 10.1089/jir.2018.0102 [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0005] 5. Carbone F, La Rocca C, Matarese G. Immunological functions of leptin and adiponectin. Biochimie 2012; 94:2082–8. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0006] 6. Schroeter MR, Leifheit M, Sudholt P, Heida NM, Dellas C, Rohm I, et al Leptin enhances the recruitment of endothelial progenitor cells into neointimal lesions after vascular injury by promoting integrin‐mediated adhesion. Circ Res 2008; 103:536–44. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0007] 7. Wong CK, Cheung PF, Lam CW. Leptin‐mediated cytokine release and migration of eosinophils: implications for immunopathophysiology of allergic inflammation. Eur J Immunol 2007; 37:2337–48. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0008] 8. Najib S, Sánchez‐Margalet V. Human leptin promotes survival of human circulating blood monocytes prone to apoptosis by activation of p42/44 MAPK pathway. Cell Immunol 2002; 220:143–9. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0009] 9. Bruno A, Conus S, Schmid I, Simon HU. Apoptotic pathways are inhibited by leptin receptor activation in neutrophils. J Immunol 2005; 174:8090–6. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0010] 10. Acedo SC, Gambero S, Cunha FG, Lorand‐Metze I, Gambero A. Participation of leptin in the determination of the macrophage phenotype: an additional role in adipocyte and macrophage crosstalk. Vitro Cell Dev Biol Anim 2013; 49:473–8. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0011] 11. Suzukawa M, Nagase H, Ogahara I, Han K, Tashimo H, Shibui A, et al Leptin enhances survival and induces migration, degranulation, and cytokine synthesis of human basophils. J Immunol 2011; 186:5254–60. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0012] 12. Gruen ML, Hao M, Piston DW, Hasty AH. Leptin requires canonical migratory signaling pathways for induction of monocyte and macrophage chemotaxis. Am J Physiol Cell Physiol 2007; 293:C1481–8. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0013] 13. Mattioli B, Straface E, Matarrese P, Quaranta MG, Giordani L, Malorni W, et al Leptin as an immunological adjuvant: enhanced migratory and CD8⁺ T cell stimulatory capacity of human dendritic cells exposed to leptin. FASEB J 2008; 22:2012–22. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0014] 14. Ouchi N, Kihara S, Arita Y, Maeda K, Kuriyama H, Okamoto Y, et al Novel modulator for endothelial adhesion molecules: adipocyte‐derived plasma protein adiponectin. Circulation 1999; 100:2473–6. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0015] 15. Yokota T, Oritani K, Takahashi I, Ishikawa J, Matsuyama A, Ouchi N, et al Adiponectin, a new member of the family of soluble defense collagens, negatively regulates the growth of myelomonocytic progenitors and the functions of macrophages. Blood 2000; 96:1723–32. [PubMed] [Google Scholar]

[imm13090-bib-0016] 16. Wolf AM, Wolf D, Rumpold H, Enrich B, Tilg H. Adiponectin induces the anti‐inflammatory cytokines IL‐10 and IL‐1RA in human leukocytes. Biochem Biophys Res Commun 2004; 323:630–5. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0017] 17. Yamamoto R, Ueki S, Moritoki Y, Kobayashi Y, Oyamada H, Konno Y, et al Adiponectin attenuates human eosinophil adhesion and chemotaxis: implications in allergic inflammation. J Asthma 2013; 50:828–35. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0018] 18. Bråkenhielm E, Veitonmäki N, Cao R, Kihara S, Matsuzawa Y, Zhivotovsky B, et al Adiponectin induced antiangiogenesis and antitumor activity involve caspase‐mediated endothelial cell apoptosis. Proc Natl Acad Sci USA 2004; 101:2476–81. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0019] 19. Krystel‐Whittemore M, Dileepan KN, Wood JG. Mast cell: a multi‐functional master cell. Front Immunol 2016; 6:620. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0020] 20. Mukai K, Tsai M, Saito H, Galli SJ. Mast cells as sources of cytokines, chemokines, and growth factors. Immunol Rev 2018; 282:121–50. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0021] 21. da Silva EZ, Jamur MC, Oliver C. Mast cell function: a new vision of an old cell. J Histochem Cytochem 2014; 62:698–738. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0022] 22. Moon TC, Befus AD, Kulka M. Mast cell mediators: their differential release and the secretory pathways involved. Front Immunol 2014; 5:569. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0023] 23. Anand P, Singh B, Jaggi AS, Singh N. Mast cells: an expanding pathophysiological role from allergy to other disorders. Naunyn Schmiedebergs Arch Pharmacol 2012; 385:657–70. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0024] 24. Rodewald HR, Feyerabend TB. Widespread immunological functions of mast cells: fact or fiction? Immunity 2012; 37:13–24. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0025] 25. Conti P, Carinci F, Caraffa A, Ronconi G, Lessiani G, Theoharides TC. Link between mast cells and bacteria: antimicrobial defense, function and regulation by cytokines. Med Hypotheses 2017; 106:10–4. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0026] 26. Pastwińska J, Agier J, Dastych J, Brzezińska‐Błaszczyk E. Mast cells as the strength of the inflammatory process. Pol J Pathol 2017; 68:187–96. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0027] 27. Conti P, Ronconi G, Kritas SK, Caraffa A, Theoharides TC. Activated mast cells mediate low‐grade inflammation in type 2 diabetes: interleukin‐37 could be beneficial. Can J Diabetes 2018; 42:568–73. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0028] 28. Żelechowska P, Agier J, Kozłowska E, Brzezińska‐Błaszczyk E. Mast cells participate in chronic low‐grade inflammation within adipose tissue. Obes Rev 2018; 19:686–97. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0029] 29. Penzo D, Petronilli V, Angelin A, Cusan C, Colonna R, Scorrano LP, et al Arachidonic acid released by phospholipase A2 activation triggers Ca²⁺‐dependent apoptosis through the mitochondrial pathway. J Biol Chem 2004; 279:25219–25. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0030] 30. Brzezińska‐Błaszczyk E, Pietrzak A, Misiak‐Tłoczek AH. Tumor necrosis factor (TNF) is a potent rat mast cell chemoattractant. J Interferon Cytokine Res 2007; 27:911–9. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0031] 31. Jutel M, Blaser K, Akdis CA. The role of histamine in regulation of immune responses. Chem Immunol Allergy 2006; 91:174–87. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0032] 32. Benly P. Role of histamine in acute inflammation. Int J Pharm Sci Res 2015; 7:373–6. [Google Scholar]

[imm13090-bib-0033] 33. Branco ACCC, Yoshikawa FSY, Pietrobon AJ, Sato M. Role of histamine in modulating the immune response and inflammation. Mediators Inflamm 2018; 2018:9524075. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0034] 34. Kanaoka Y, Boyce JA. Cysteinyl leukotrienes and their receptors: cellular distribution and function in immune and inflammatory responses. J Immunol 2004; 173:1503–10. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0035] 35. Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein‐1 (MCP‐1): an overview. J Interferon Cytokine Res 2009; 29:313–26. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0036] 36. Ingram SL, Diotallevi M. Reactive oxygen species: rapid fire in inflammation. Biochemist 2017; 39:30–3. [Google Scholar]

[imm13090-bib-0037] 37. Abdulkhaleq LA, Assi MA, Abdullah R, Zamri‐Saad M, Taufiq‐Yap YH, Hezmee MNM. The crucial roles of inflammatory mediators in inflammation: a review. Vet World 2018; 11:627–35. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0038] 38. Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. Regulation and functions of the IL‐10 family of cytokines in inflammation and disease. Annu Rev Immunol 2011; 29:71–109. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0039] 39. Yoshimura A, Wakabayashi Y, Mori T. Cellular and molecular basis for the regulation of inflammation by TGF‐β. J Biochem 2010; 147:781–92. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0040] 40. Bhattacharya P, Budnick I, Singh M, Thiruppathi M, Alharshawi K, Elshabrawy H, et al Dual role of GM‐CSF as a pro‐inflammatory and a regulatory cytokine: implications for immune therapy. J Interferon Cytokine Res 2015; 35:585–99. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0041] 41. Gadani SP, Cronk JC, Geoffrey T, Norris GT, Kipnis J. Interleukin‐4: a cytokine to remember. J Immunol 2012; 189:4213–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0042] 42. Ho IC, Miaw SC. Regulation of IL‐4 expression in immunity and diseases. Adv Exp Med Biol 2016; 941:31–77. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0043] 43. McLeod JJ, Baker B, Ryan JJ. Mast cell production and response to IL‐4 and IL‐13. Cytokine 2015; 75:57–61. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0044] 44. Luzina IG, Keegan AD, Heller NM, Rook GA, Shea‐Donohue T, Atamas SP. Regulation of inflammation by interleukin‐4: a review of “alternatives”. J Leukoc Biol 2012; 92:753–64. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0045] 45. Maekawa A, Balestrieri B, Austen KF, Kanaoka Y. GPR17 is a negative regulator of the cysteinyl leukotriene 1 receptor response to leukotriene D₄ . Proc Natl Acad Sci USA 2009; 106:11685–90. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0046] 46. Dardeno TA, Chou SH, Moon HS, Chamberland JP, Fiorenza CG, Mantzoros CS. Leptin in human physiology and therapeutics. Front Neuroendocrinol 2010; 31:377–93. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0047] 47. Turer AT, Scherer PE. Adiponectin: mechanistic insights and clinical implications. Diabetologia 2012; 55:2319–26. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0048] 48. Wauman J, Zabeau L, Tavernier J. The leptin receptor complex: heavier than expected? Front Endocrinol (Lausanne) 2017; 8:30. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0049] 49. Frühbeck G. Intracellular signalling pathways activated by leptin. Biochem J 2006; 393:7–20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0050] 50. Zhou Y, Yu X, Chen H, Sjöberg S, Roux J, Zhang L, et al Leptin deficiency shifts mast cells toward anti‐inflammatory actions and protects mice from obesity and diabetes by polarizing M2 macrophages. Cell Metab 2015; 22:1045–58. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0051] 51. Fernández‐Riejos P, Najib S, Santos‐Alvarez J, Martín‐Romero C, Pérez‐Pérez A, González‐Yanes C, et al Role of leptin in the activation of immune cells. Mediators Inflamm 2010; 2010:568343. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0052] 52. Taildeman J, Pérez‐Novo CA, Rottiers I, Ferdinande L, Waeytens A, De Colvenaer V, et al Human mast cells express leptin and leptin receptors. Histochem Cell Biol 2009; 131:703–11. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0053] 53. Żelechowska P, Wiktorska M, Różalska S, Stasikowska‐Kanicka O, Wągrowska‐Danilewicz M, Agier J, et al Leptin receptor is expressed by tissue mast cells. Immunol Res 2018; 66:557–66. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0054] 54. Yamauchi T, Iwabu M, Okada‐Iwabu M, Kadowaki T. Adiponectin receptors: a review of their structure, function and how they work. Best Pract Res Clin Endocrinol Metab 2014; 28:15–23. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0055] 55. Shehzad A, Iqbal W, Shehzad O, Lee YS. Adiponectin: regulation of its production and its role in human diseases. Hormones (Athens) 2012; 11:8–20. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0056] 56. Ghoshal K, Bhattacharyya M. Adiponectin: probe of the molecular paradigm associating diabetes and obesity. World J Diabetes 2015; 6:151–66. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13090-bib-0057] 57. Ozaki KI, Awazu M, Tamiya M, Iwasaki Y, Harada A, Kugisaki S, et al Targeting the ERK signaling pathway as a potential treatment for insulin resistance and type 2 diabetes. Am J Physiol Endocrinol Metab 2016; 310:E643–51. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0058] 58. Pang TT, Narendran P. The distribution of adiponectin receptors on human peripheral blood mononuclear cells. Ann N Y Acad Sci 2008; 1150:143–5. [DOI] [PubMed] [Google Scholar]

[imm13090-bib-0059] 59. Żelechowska P, Agier J, Różalska S, Wiktorska M, Brzezińska‐Błaszczyk E. Leptin stimulates tissue rat mast cell pro‐inflammatory activity and migratory response. Inflamm Res 2018; 67:789–99. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Adipocytokines leptin and adiponectin function as mast cell activity modulators

Paulina Żelechowska

Ewa Brzezińska‐Błaszczyk

Magdalena Wiktorska

Sylwia Różalska

Sebastian Wawrocki

Elżbieta Kozłowska

Justyna Agier

Summary

Abbreviations

Introduction

Materials and methods

Reagents

Isolation of primary MCs

Cell preparation for flow cytometric and confocal microscopy analyses

Flow cytometry

Confocal microscopy

Histamine release assay

CysLT synthesis analysis

CCL2 and IL‐10 generation measurement

Quantitative RT‐PCR

Table 1.

Intracellular cytokine staining

Migration assay

Treatment of MCs with signaling pathway inhibitors

Statistical analysis

Results

Expression of leptin and adiponectin receptors by native MCs

Figure 1.

Effect of leptin and adiponectin on MC histamine release and cysLT generation

Figure 2.

Figure 3.

Effect of leptin and adiponectin on MC CCL2 and IL‐10 generation

Figure 4.

Effect of leptin and adiponectin on MC cytokine/chemokine mRNA levels and intracellular cytokine production

Figure 5.

Effect of leptin and adiponectin on ROS production by MCs

Figure 6.

Effect of leptin and adiponectin on surface cysLT receptor expression on MCs

Figure 7.

Effect of leptin and adiponectin on MC migratory response

Figure 8.

Discussion

Disclosures

Author contributions

Supporting information

Acknowledgements

References

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases