Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Aug 20.
Published in final edited form as: Brain Res. 2016 Apr 14;1642:461–466. doi: 10.1016/j.brainres.2016.04.031

Sex differences in Gadd45b expression and methylation in the developing rodent amygdala

Stacey L Kigar a, Liza Chang b, Margaret R Hayne b, Nicolette T Karls b, Anthony P Auger b,c,*
PMCID: PMC6701186  NIHMSID: NIHMS1534544  PMID: 27086974

Abstract

Precise spatiotemporal epigenetic regulation of the genome facilitates species-typical development; sexual differentiation of the brain by gonadal hormones and sex chromosomes causes extensive epigenetic reprogramming of many cells in the body, including the brain, and may indirectly predispose males and females to different psychiatric conditions. We and others have demonstrated sex differences in DNA methylation, as well as in the enzymes that form, or ‘write’, this epigenetic modification. However, while a growing body of evidence suggests that DNA methylation undergoes rapid turnover and is dynamically regulated in vivo, to our knowledge no studies have been done investigating whether sex differences exist in the epigenetic ‘erasers’ during postnatal development. Here we report sex differences in the expression of growth arrest and DNA damage inducible factor β (Gadd45b), but not family members α (a) or γ (g), in the neonatal and juvenile rodent amygdala.

Keywords: Epigenetics, Gadd45b, sex differences, amygdala

1. Introduction:

The developing mammalian brain is uniquely sensitive to environmental and hormonal cues; during so-called ‘sensitive periods’, extensive epigenetic programming and reprogramming is occurring (A. P. Auger et al., 2011; Roth and David Sweatt, 2010; Weaver et al., 2004). Abnormalities in the epigenome acquired during development can cause long-lasting and adverse effects on such far-reaching behavioral and physiological traits as memory (Korosi et al., 2012), parental behavior (Champagne et al., 2006), sexual differentiation (A. P. Auger and Jessen, 2009; Matsuda et al., 2011; Nugent et al., 2015), drug-seeking behavior (Massart et al., 2015), and are furthermore linked to psychiatric dysfunction (Bagot et al., 2014; Labonté et al., 2013; McGowan et al., 2009). In fact, drugs directed at epigenetic factors are a proposed target in the treatment of psychiatric disorders (Szyf, 2015). Interestingly, in addition to altered programming of the neural epigenome, biological sex is a highly salient risk factor in the development of psychiatric disorders ((Chase et al., 2015), reviewed in (Kigar and A. P. Auger, 2013)). This makes it a priority to understand the basic biological signaling mechanisms at play in controlling the epigenome during sexual differentiation.

We and others have previously demonstrated sex differences in the abundance of epigenetic modifications such as 5-methylcytosine (5mC) (Kurian et al., 2010; Nugent et al., 2015) and histone acetylation or methylation (Tsai et al., 2009). We have also shown that there are sex differences in the expression of epigenetic factors that increase or decrease gene transcription; specifically, males have higher levels of co-activators such as steroid receptor coactivator-1 (Src-1) (A. P. Auger et al., 2000) and cyclic-AMP response element-binding protein (CBP) (A. P. Auger et al., 2002), whereas females have higher levels of co-repressors such as methyl cytosine binding protein 2 (MeCP2) (Kurian et al., 2007) and nuclear receptor corepressor (NCoR)(Jessen et al., 2010). Finally, sex differences have been observed in the expression or activity of enzymes that catalyze formation of epigenetic modifications, including DNA methyltransferase 3a (Dnmt3a) (Kolodkin and A. P. Auger, 2011), Dnmt1 (Nugent et al., 2015), and several histone deacetylases (Xu et al., 2008a; 2008b).

While DNA methylation was previously thought to be a static and/or permanent epigenetic modification (Wu and Zhang, 2010), a growing body of evidence suggests it undergoes rapid turnover and is dynamically regulated in vivo (C. J. Auger et al., 2011; Feng et al., 2010; Ma et al., 2009). Briefly, ten-eleven translocation (Tet) enzymes are able to catalyze conversion of 5mC into 5-hydroxymethylcytosine (5hmC); 5hmC will eventually be converted to a uracil analog, resulting in a DNA base pair mismatch that will be excised. Importantly, the growth arrest and DNA damage inducible factor (Gadd45) β (b), α (a) and γ (g) family of proteins appear to participate in DNA demethylation through an as-yet unidentified mechanism (Niehrs and Schäfer, 2012); in particular, Gadd45b is required for stimulus-induced DNA demethylation (Ma et al., 2009).

We have recently demonstrated a role for Gadd45b in dampening juvenile male rats’ drive to engage in ‘rough and tumble play’ (Kigar et al., 2015), suggesting it may be an important risk factor in the development of abnormal social behaviors. We were specifically looking at the function of Gadd45b within the developing amygdala—a region of the brain critically important in the formation of socioemotional behaviors (LeDoux, 2007; Phelps and LeDoux, 2005; Shaw et al., 2004). While sex differences in Gadd45b mRNA expression have been observed in the adult prefrontal cortex (Blaze and Roth, 2013), it is unknown whether sex differences exist in its expression in steroid hormone-responsive brain regions, e.g. the amygdala and hypothalamus. Here we address this knowledge gap by examining the expression of the Gadd45 protein family at two important developmental time points—twenty-four hours after birth and the beginning of the juvenile social play period.

2. Results

mRNA sex differences in demethylase factors at postnatal day 1 (P1)

Sex differences in the expression of Gadd45b, but not related family members Gadd45a and Gadd45g, were found in the PI amygdala, where females had higher levels of Gadd45b mRNA than males: [Gadd45b (female: 0.6337 ± 0.05103, N=9; male: 0.4061 ± 0.02500, N=8. p=0.0016); Gadd45a (female: 0.5947 ± 0.03712, N=8; male: 0.5194 ± 0.04059, N=9. p=0.1947); Gadd45g (female: 0.5548 ± 0.1090, N=10; male: 0.5148 ± 0.1017, N=8. p=0.7958)] (Fig. 1A). We observed no sex differences in Gadd45 family members in the PI hypothalamus: [Gadd45b (female: 0.6698 ± 0.05339, N=8; male: 0.5863 ± 0.03181, N=9. p=0.1877); Gadd45a (female: 0.5775 ± 0.07341, N=8; male: 0.4809 ± 0.04452, N=10. p=0.2566); Gadd45g (female: 0.6181 ± 0.06382, N=8; male: 0.5893 ± 0.04411, N=9. p=0.7108)] (Fig. 1B).

Figure 1:

Figure 1:

Open in a new tab

Sex differences in the mRNA expression of Gadd45 family members Gadd45b, Gadd45a, and Gadd45g at postnatal day 1 (P1) in two brain regions A. amygdala and B. hypothalamus known to be steroid hormone-responsive during early neonatal development. **p<0.01

Effect of hormone treatment on Gadd45 expression in females

Neonatal females were injected subcutaneously with hormone or vehicle on P0 and P1 before sacrifice on P2. There was a significant overall effect of hormone treatment on the expression of Gadd45b mRNA in females, where dihydrotestosterone (DHT)-treated females showed less expression than oil-treated females (one-way ANOVA; F(3,27) = 4.130, p = 0.0170. Tukey’s post hoc; q = 4.873) (Fig. 2A). We observed no effects of hormones on remaining family members Gadd45a or Gadd45g: [Gadd45a (oil: 0.4269 ± 0.04353, N=8; testosterone: 0.4621 ± 0.05316, N=7; estrogen: 0.4041 ± 0.06577, N=6. dihydrotestosterone: 0.3387 ± 0.02716, N=7. p=0.3371); Gadd45g (oil: 0.4424 ± 0.09015, N=6; testosterone: 0.4833 ± 0.08918, N=7; estrogen: 0.4458 ± 0.1031, N=6. dihydrotestosterone: 0.4555 ± 0.1221, N=7. p=0.9917)] (Fig. 2B–C).

Figure 2:

Figure 2:

Open in a new tab

Gadd45 family members’ mRNA expression in the amygdala of hormone-treated females: A. Gadd45b, B. Gadd45a, and C. Gadd45g. Females were treated with either vehicle (O = oil) or hormone [T = testosterone, E = estrogen, D = dihydrotestosterone (DHT)] twice and then sacrificed at P2. Posthoc analysis of Gadd45b mRNA levels revealed a significant difference between oil-treated and DHT-treated females. *p<0.05

mRNA sex differences in Gadd45 family members at postnatal day 25 (P25)

Sex differences in the expression of Gadd45b, but not related family members Gadd45a and Gadd45g, were also found in the P25 amygdala, where females had higher levels of Gadd45b mRNA than males: [Gadd45b (female: 0.6490 ± 0.04799, N=10; male: 0.4676 ± 0.04679, N=8. p=0.0170); Gadd45a (female: 0.5579 ± 0.04441, N=10; male: 0.6194 ± 0.06860, N=9. p=0.4535); Gadd45g (female: 0.5682 ± 0.08165, N=10; male: 0.6458 ± 0.02790, N=8. p=0.4268)] (Fig. 3A). We observed no sex differences in Gadd45 family members in the P25 hypothalamus: [Gadd45b (female: 0.6683 ± 0.03507, N=11; male: 0.6340 ± 0.03228, N=8. p=0.4976); Gadd45a (female: 0.6206 ± 0.03230, N=11; male: 0.5424 ± 0.01264, N=7. p=0.0820); Gadd45g (female: 0.5959 ± 0.02852, N=10; male: 0.6353 ± 0.03555, N=9. p=0.3961)] (Fig. 3B).

Figure 3:

Figure 3:

Open in a new tab

Sex differences in mRNA expression of Gadd45 family members in the postnatal day 25 (P25) A. amygdala and B. hypothalamus. *p<0.05

Methylation changes in the Gadd45b promoter

We used a methylation sensitive restriction enzyme (MSRE) assay to examine relative amounts of DNA methylation at an estrogen receptor α (ERα) response element (ERE) in the P25 amygdala Gadd45b promoter. Doing so, we found sex differences in methylation at an AciI (CCGC) cut site, where males had more than females: Gadd45b (female: 0.3972 ± 0.04209, N=10; male: 0.6356 ± 0.1068, N=9. p=0.0453) (Fig. 4).

Figure 4:

Figure 4:

Open in a new tab

Sex differences in Gadd45b promoter methylation at an estrogen receptor α (ERα) response element (ERE) in the juvenile amygdala (postnatal day 25 (P25)). *p<0.05

3. Discussion:

Herein we present data describing neurodevelopmental sex differences in the mRNA expression of Gadd45b, a protein involved in DNA demethylation (Ma et al., 2009). Of the three Gadd45 family members, Gadd45b alone exhibited hormone responsivity in the amygdala, but not the hypothalamus (Fig. 1, 3). Specifically, females expressed greater levels of Gadd45b mRNA neonatally (Fig. 1A) and this effect was also present during the juvenile period (Fig. 3A). The reduced mRNA expression observed in males furthermore corresponds with increased methylation at an ERE site within the Gadd45b promoter (Fig. 4), suggesting that the demethylation factor Gadd45b is itself under epigenetic control. Moreover, steroid hormone treatment at PO and PI caused a repressive effect on Gadd45b mRNA expression in the neonatal female amygdala (Fig. 2A), suggesting that Gadd45b levels are sensitive to changes in peripheral gonadal hormones. Interestingly, only treatment with dihydrotestosterone, and not estradiol or testosterone, resulted in decreased Gadd45b levels in the amygdala (Fig. 2A). As dihydrotestosterone binds with high affinity to androgen receptors (Wilson and French, 1976), this suggests androgen receptors may be responsible for the sex difference found in Gadd45b levels within the developing amygdala and supports previous literature reporting that androgens are important for this region’s masculinization (Cooke et al., 2003; Meaney and Stewart, 1981). As hormones reduce the expression of Gadd45b, it is possible that Gadd45b facilitates some of the changes induced by steroid-mediated sexual differentiation of the brain. Indeed, lowering Gadd45b levels using siRNA results in increased juvenile social play behavior, which is typically higher in males (Kigar et al., 2015). As reducing Gadd45b levels increases male-typical behavior later in life, it is not surprising that females exhibit higher levels of Gadd45b during brain sexual differentiation.

The Gadd45 family is a highly conserved group of small, nuclearly-localized proteins whose peripheral expression can be rapidly induced by a variety of environmental stimuli, including gamma irradiation (Engelmann et al., 2007), ultraviolet treatment (Gupta et al., 2006), and histone deacetylase inhibition (Chen et al., 2002). Interestingly, environmentally responsive changes to neuronal Gadd45b expression have also been reported. For example, its expression is upregulated by photons of light in the superchiasmatic nucleus (Porterfield et al., 2007), in response to electroconvulsive therapy in the hippocampus (Ma et al., 2009), and increases rapidly following hippocampal, amygdalar, and striatal learning tasks (Keeley et al., 2006; Sultan et al., 2012). Our current data indicates that Gadd45b is also sensitive to hormones and biological sex during brain development.

The swift induction of Gadd45b expression in response to environmental cues appears to be an important component of the DNA demethylation pathway. Specifically, a study of neuronal-activity induced changes to DNA methylation in the hippocampus of Gadd45b knock-out mice showed that Gadd45b was required for rapid demethylation of the brain derived neurotrophic factor (BDNF) promoter at exon IV (Ma et al., 2009). Furthermore, recent data from our lab demonstrated that early life perturbations to Gadd45b expression in the amygdala resulted in both immediate and long-term increases in promoter methylation of the norepinephrine-binding autoreceptor, α2-adrenoceptor (Adra2a)—consistent with Gadd45b’s role as a DNA demethylase (Kigar et al., 2015). While the mechanism by which this feat is accomplished has yet to be determined as Gadd45b itself is non-enzymatic, it may involve recruitment of deaminases or other factors involved in base excision repair [e.g. activation-induced deaminase/apolipoprotein B mRNA editing cytokine, or AID/APOBEC); for review, see (Grayson and Guidotti, 2012; Kigar and A. P. Auger, 2013)].

Clinically, Gadd45b overexpression was observed in the postmortem tissue of patients whom, while living, were diagnosed with either schizophrenia (SZ) or bipolar disorder (BPD) (Gavin et al., 2012); the authors concluded that this overexpression may be compensatory, as it has been extensively studied that in postmortem SZ tissue, chromatin is in a restricted state (Abdolmaleky et al., 2006; Chase et al., 2015; Gavin et al., 2009; Grayson et al., 2005; Huang and Akbarian, 2007; Huang et al., 2007; Ruzicka et al., 2007; Veldic et al., 2004; 2005; 2007). Presently it is unclear what factors may lead to the overexpression seen in postmortem SZ and BPD tissue; however, in an animal model of early life stress, Gadd45b mRNA levels were repressed in the adult prefrontal cortex (PFC) (Blaze and Roth, 2013). This may suggest that perturbations during the sensitive period of neonatal development may somehow influence its expression later in life, though this hypothesis remains to be tested.

As sex differences in risk and resilience to psychiatric disorders have been noted, and sex-specific expression of epigenetic factors appear to underlie this phenomenon (Chase et al., 2015; Kigar and A. P. Auger, 2013), it will be an important future direction to establish whether Gadd45b dictates a repressive or permissive chromatin environment, and whether this is also sex-specific. One intriguing possibility is that Gadd45b acts not to compensate for a restrictive environment with respect to chromatin, but instead mobilizes the expression of repressive factors in some brain regions, including the amygdala, and may thus exacerbate transcriptional repression. For example, we have recently demonstrated that Gadd45b knockdown decreased the expression of MeCP2 in the neonatal amygdala of male rats (Kigar et al., 2015), and have previously reported that there are sex differences in the expression of MeCP2 (Kurian et al., 2007). If Gadd45b is directly responsible for MeCP2 expression, the directionality would be consistent with the Gadd45b sex difference reported here (Fig. 1A).

In conclusion, we find that Gadd45b levels are different between males and females at a critical time point in amygdalar development. These data suggest that both increased and decreased gene expression is a necessary component for typical sexual differentiation of the brain, as females appear to express both more repressive epigenetic factors (Jessen et al., 2010; Kolodkin and A. P. Auger, 2011; Kurian et al., 2008) and higher levels of a putative DNA demethylation factor, Gadd45b. It remains to be determined if increased Gadd45b underlies the increased expression of repressive epigenetic factors observed in females. It is possible that the increased expression of repressive machinery in females may function to protect the developing female brain from the masculinizing effects of either hormonal or non-hormonal factors involved in brain sexual differentiation (A. P. Auger and Jessen, 2009; Kigar and A. P. Auger, 2013). Nonetheless, these data bolster and support preexisting evidence from the literature that sex differences exist at the level of the neural epigenome.

4. Materials and Methods

Animals and weaning environment

Sprague Dawley female rats, purchased from Charles River Laboratories (Wilmington, MA), were bred in our colony and allowed to deliver normally. Cages were checked regularly to determine the day of birth (P0). Juveniles were weaned at P21 into cages of 5 with mixed sex littermates. Animals were housed under standard laboratory conditions (light/dark cycle of 12/12 h, food and water ad libitum). All procedures were approved by the University of Wisconsin-Madison Animal Care and Use Committee.

Sex difference data sets

Males and females from multiple litters were sacrificed via rapid decapitation at 24 h (P1; n = 10 males, n = 10 females) or first anesthetized with isoflourane and then rapidly decapitated 25 days after birth (P25; n = 9 males, n = 11 females). Brains were collected, and the amygdala and hypothalamus were microdissected with razorblades.

Hormone-treated data set

As published previously (Kolodkin and A. P. Auger, 2011), newborn female rats were given subcutaneous injections of 100μg testosterone propionate (T; n = 7), 100μg of estradiol benzoate (E; n = 6), 250μg of dihydrotestosterone (D; n = 7), or sesame oil (O; n = 8). Selected drug dosages were based on literature demonstrating these concentrations of hormone are required to attain male-typical levels in the hypothalamus during development (Amateau et al., 2004). Animals were injected with hormone or oil both immediately and 24 h after birth. Female brains were collected 48 h (P2) after birth.

Quantification of mRNA

RNA concentrations were determined using the Qubit Quantification Platform (Invitrogen; catalog #Q32857). RNA conversion to cDNA was performed in an Eppendorf MasterCycler Personal PCR machine via the ImPromII™ Reverse Transcription System (Promega; catalog #A3800). Real-time quantitative polymerase chain reaction (RT-PCR) was conducted using a Stratagene Mx3000P™ real time PCR system, and cDNA was amplified with GoTaq Colorless Master Mix (Promega; catalog #M7132), SYBR green (Invitrogen; catalog #S33102), and ROX as a reference dye (Invitrogen; 12223-012). Following amplification, a dissociation melt curve and DNA gel analysis were performed to ensure the purity of PCR products. cDNA levels were normalized to a housekeeping gene, Ywhaz, using the ΔΔCt method. Ywhaz was chosen based on previous literature citing its remarkable stability in rat brain gene expression when compared to other commonly used housekeeping genes (Bonefeld et al., 2008; Gubern et al., 2009). Primers used in this experiment are found in Table 1.

Table 1:

mRNA Primer sequences and Pubmed accession numbers for RT-qPCR
Ywhaz NM_013011 TTGAGCAGAAGACGGAAGGT GAAGCATTGGGGATCAAGAA
Gadd45b NM_001008321 GCTGGCCATAGACGAAGAAG GCCTGATACCCTGACGATGT
Gadd45a NM_024127 GCTACTGGAGAACGACAAGAG CCATTGTGATGAATGTGGGTTC
Gadd45g NM_001077640 CTGAATGTGGACCCTGACAAT AACGCCTGGATCAACGTAAA
Open in a new tab

Quantification of DNA methylation

DNA methylation was assessed using an adapted version of the methylation sensitive restriction enzyme (MSRE) assay (C. J. Auger et al., 2011; Edelmann and A. P. Auger, 2011; Hashimoto et al., 2007; Kigar et al., 2015). Briefly, 240 ng of DNA from each rat was divided equally into two tubes and digested with either AciI (New England Biolabs; catalog #R0551) or ClaI (New England Biolabs; catalog #R0197) in the same buffer conditions at 37°C for 90 min. Enzymes were subsequently inactivated by heating to 65°C for 20 min. A no-DNA control was added to ensure purity of the restriction enzyme reaction. Primers were designed such that Acil but not Clal cut sites were contained within the region of interest. To assess relative amounts of DNA methylation, RT-qPCR was performed as described above. Primers used in this experiment are found in Table 2.

Table 2:

Methylation primers used to examine the Gadd45b promoter
G45b ERE AciI (CCGC) CTCGATTCGCTGGCAGTC GATTGGCTGGAGGTAGGAAAG
Open in a new tab

Statistical analysis

PCR data were analyzed using a two-tailed Student’s t test for sex difference data and one-way ANOVA with Tukey’s posthoc for pairwise comparison was used for the hormone-treated data set (Prism 5; GraphPad Software, Inc.). To eliminate any technical error for the PCR data, outliers were screened for using the Grubbs test with a significance level of alpha = 0.05. All reported measures are listed as mean ± SEM. Significance was defined as a p value of <0.05.

Highlights.

  • Females express higher levels of Gadd45b within the developing amygdala

  • Juvenile males have more DNA methylation in the Gadd45b promoter

  • Steroid hormones decrease Gadd45b levels in the female amygdala

Acknowledgments

Funding: Grants T32-GM008688 to SLK and IOS-1122074 to APA

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abdolmaleky HM, Cheng K-H, Faraone SV, Wilcox M, Glatt SJ, Gao F, Smith CL, Shafa R, Aeali B, Camevale J, Pan H, Papageorgis P, Ponte JF, Sivaraman V, Tsuang MT, Thiagalingam S, 2006. Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder. Human Molecular Genetics 15, 3132–3145. doi: 10.1093/hmg/ddl253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amateau SK, Alt JJ, Stamps CL, McCarthy MM, 2004. Brain Estradiol Content in Newborn Rats: Sex Differences, Regional Heterogeneity, and Possible de NovoSynthesis by the Female Telencephalon. Endocrinology 145, 2906–2917. doi: 10.1210/en.2003-1363 [DOI] [PubMed] [Google Scholar]
  3. Auger AP, Jessen HM, 2009. Corepressors, nuclear receptors, and epigenetic factors on DNA: A tail of repression. Psychoneuroendocrinology 34, S39–S47. doi: 10.1016/j.psyneuen.2009.05.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Auger AP, Jessen HM, Edelmann MN, 2011. Epigenetic organization of brain sex differences and juvenile social play behavior. Hormones and Behavior 59, 358–363. doi: 10.1016/j.yhbeh.2010.06.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Auger AP, Perrot-Sinal TS, Auger CI, Ekas LA, Tetel MI, McCarthy MM, 2002. Expression of the Nuclear Receptor Coactivator, cAMP Response Element-Binding Protein, Is Sexually Dimorphic and Modulates Sexual Differentiation of Neonatal Rat Brain. Endocrinology. doi: 10.1210/endo.2002.143.issue-8;website:website:endo;pageGroup:string:Publication [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Auger AP, Tetel MI, McCarthy MM, 2000. Steroid receptor coactivator-1 (SRC-1) mediates the development of sex-specific brain morphology and behavior. Proceedings of the National Academy of Sciences 97, 7551–7555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Auger CJ, Coss D, Auger AP, 2011. Epigenetic control of vasopressin expression is maintained by steroid hormones in the adult male rat brain, in:. Proceedings of the National Academy of Sciences USA, pp. 4242–4247. doi: 10.1073/pnas.1100314108/-/DCSupplemental [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bagot RC, Labonté B, Peña CJ, Nestler EJ, 2014. Epigenetic signaling in psychiatric disorders: stress and depression. Dialogues Clin Neurosci 16, 281–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Blaze J, Roth TL, 2013. Exposure to caregiver maltreatment alters expression levels of epigenetic regulators in the medial prefrontal cortex. International Journal of Developmental Neuroscience 31, 804–810. doi: 10.1016/j.ijdevneu.2013.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bonefeld BE, Elfving B, Wegener G, 2008. Reference genes for normalization: A study of rat brain tissue. Synapse 62, 302–309. doi: 10.1002/syn.20496 [DOI] [PubMed] [Google Scholar]
  11. Champagne FA, Weaver ICG, Diorio J, Dymov S, Szyf M, Meaney MJ, 2006. Maternal care associated with methylation of the estrogen receptor-alpha lb promoter and estrogen receptor-alpha expression in the medial preoptic area of female offspring. Endocrinology 147, 2909–2915. doi: 10.1210/en.2005-1119 [DOI] [PubMed] [Google Scholar]
  12. Chase KA, Rosen C, Rubin LH, Feiner B, Bodapati AS, Gin H, Hu E, Sharma RP, 2015. Evidence of a sex-dependent restrictive epigenome in schizophrenia. Journal of Psychiatric Research 65, 87–94. doi: 10.1016/j.jpsychires.2015.04.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chen Z, Clark S, Birkeland M, Sung CM, Lago A, Liu R, Kirkpatrick R, Johanson K, Winkler JD, Hu E, 2002. Induction and superinduction of growth arrest and DNA damage gene 45 (GADD45) alpha and beta messenger RNAs by histone deacetylase inhibitors trichostatin A (TSA) and butyrate in SW620 human colon carcinoma cells. Cancer Lett. 188, 127–140. [DOI] [PubMed] [Google Scholar]
  14. Cooke BM, Breedlove SM, Jordan CL, 2003. Both estrogen receptors and androgen receptors contribute to testosterone-induced changes in the morphology of the medial amygdala and sexual arousal in male rats. Hormones and Behavior. doi: 10.1016/S0018-506X(02)00047-8 [DOI] [PubMed] [Google Scholar]
  15. Edelmann MN, Auger AP, 2011. Epigenetic impact of simulated maternal grooming on estrogen receptor alpha within the developing amygdala. Brain Behavior and Immunity 25, 1299–1304. doi: 10.1016/j.bbi.2011.02.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Engelmann A, Speidel D, Bomkamm GW, Deppert W, Stocking C, 2007. Gadd45β is a pro-survival factor associated with stress-resistant tumors. Oncogene 27, 1429–1438. doi: 10.1038/sj.one.1210772 [DOI] [PubMed] [Google Scholar]
  17. Feng J, Zhou Y, Campbell SL, Le T, Li E, Sweatt JD, Silva AJ, Fan G, 2010. Dnmtl and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nature Neuroscience 13, 423–430. doi: 10.1038/nn.2514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gavin DP, Rosen C, Chase K, Grayson DR, Tun N, Sharma RP, 2009. Dimethylated lysine 9 of histone 3 is elevated in schizophrenia and exhibits a divergent response to histone deacetylase inhibitors in lymphocyte cultures. J Psychiatry Neurosci 34, 232–237. [PMC free article] [PubMed] [Google Scholar]
  19. Gavin DP, Sharma RP, Chase KA, Matrisciano F, Dong E, Guidotti A, 2012. Growth Arrest and DNA-Damage-Inducible, Beta (GADD45b)-Mediated DNA Demethylation in Major Psychosis. Neuropsychopharmacology 37, 531–542. doi: 10.1038/npp.2011.221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Grayson DR, Guidotti A, 2012. The Dynamics of DNA Methylation in Schizophrenia and Related Psychiatric Disorders. Neuropsychopharmacology 38, 138–166. doi: 10.1038/npp.2012.125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Grayson DR, Jia X, Chen Y, Sharma RP, Mitchell CP, Guidotti A, Costa E, 2005. Reelin promoter hypermethylation in schizophrenia. Proceedings of the National Academy of Sciences 102, 9341–9346. doi: 10.1073/pnas.0503736102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gubern C, Hurtado O, Rodréguez R, Morales JR, Romera VG, Moro MA, Lizasoain I, Serena J, Mallolas J, 2009. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia. BMC Mol Biol 10, 57. doi: 10.1186/1471-2199-10-57 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gupta M, Gupta SK, Hoffman B, Liebermann DA, 2006. Gadd45a and Gadd45b Protect Hematopoietic Cells from UV-induced Apoptosis via Distinct Signaling Pathways, including p38 Activation and JNK Inhibition. Journal of Biological Chemistry 281, 17552–17558. doi: 10.1074/jbc.M600950200 [DOI] [PubMed] [Google Scholar]
  24. Hashimoto K, Kokubun S, Itoi E, Roach HI, 2007. Improved quantification of DNA methylation using methylation-sensitive restriction enzymes and real-time PCR. Epigenetics 2, 86–91. [DOI] [PubMed] [Google Scholar]
  25. Huang H-S, Akbarian S, 2007. GAD1 mRNA expression and DNA methylation in prefrontal cortex of subjects with schizophrenia. PLoS ONE 2, e809. doi: 10.1371/journal.pone.0000809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Huang H-S, Matevossian A, Whittle C, Kim SY, Schumacher A, Baker SP, Akbarian S, 2007. Prefrontal dysfunction in schizophrenia involves mixed-lineage leukemia 1-regulated histone methylation at GABAergic gene promoters. J. Neurosci. 27, 11254–11262. doi: 10.1523/JNEUROSCI.3272-07.2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jessen HM, Kolodkin MH, Bychowski ME, Auger CJ, Auger AP, 2010. The nuclear receptor corepressor has organizational effects within the developing amygdala on juvenile social play and anxiety-like behavior. Endocrinology 151, 1212–1220. doi: 10.1210/en.2009-0594 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Keeley MB, Wood MA, Isiegas C, Stein J, Heilman K, Hannenhalli S, Abel T, 2006. Differential transcriptional response to nonassociative and associative components of classical fear conditioning in the amygdala and hippocampus. Learning & Memory 13, 135–142. doi: 10.1101/lm.86906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kigar SL, Auger AP, 2013. Epigenetic Mechanisms may Underlie the Aetiology of Sex Differences in Mental Health Risk and Resilience. Journal of Neuroendocrinology 25, 1141–1150. doi: 10.1111/jne.12074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kigar SL, Chang L, Auger AP, 2015. Gadd45b is an epigenetic regulator of juvenile social behavior and alters local pro-inflammatory cytokine production in the rodent amygdala. Brain Behavior and Immunity 46, 60–69. doi: 10.1016/j.bbi.2015.02.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kolodkin MH, Auger AP, 2011. Sex Difference in the Expression of DNA Methyltransferase 3a in the Rat Amygdala During Development. Journal of Neuroendocrinology 23, 577–583. doi: 10.1111/j.1365-2826.2011.02147.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Korosi A, Naninck EFG, Oomen CA, Schouten M, Krugers H, Fitzsimons C, Lucassen PJ, 2012. Early-life stress mediated modulation of adult neurogenesis and behavior. Behavioural Brain Research 227, 400–409. doi: 10.1016/j.bbr.2011.07.037 [DOI] [PubMed] [Google Scholar]
  33. Kurian JR, Bychowski ME, Forbes-Lorman RM, Auger CJ, Auger AP, 2008. Mecp2 organizes juvenile social behavior in a sex-specific manner. J. Neurosci. 28, 7137–7142. doi: 10.1523/JNEUROSCI.1345-08.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kurian JR, Forbes-Lorman RM, Auger AP, 2007. Sex difference in mecp2 expression during a critical period of rat brain development. Epigenetics 2, 173–178. [DOI] [PubMed] [Google Scholar]
  35. Kurian JR, Olesen KM, Auger AP, 2010. Sex Differences in Epigenetic Regulation of the Estrogen Receptor-α Promoter within the Developing Preoptic Area. Endocrinology 151, 2297–2305. doi: 10.1210/en.2009-0649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Labonté B, Suderman M, Maussion G, Lopez JP, Navarro-Sanchez L, Yerko V, Mechawar N, Szyf M, Meaney MJ, Turecki G, 2013. Genome-wide methylation changes in the brains of suicide completers. Am J Psychiatry 170, 511–520. doi: 10.1176/appi.ajp.2012.12050627 [DOI] [PubMed] [Google Scholar]
  37. LeDoux J, 2007. The amygdala. Current Biology 17, R868–R874. doi: 10.1016/j.cub.2007.08.005 [DOI] [PubMed] [Google Scholar]
  38. Ma DK, Jang MH, Guo JU, Kitabatake Y, Chang ML, Pow-anpongkul N, Flavell RA, Lu B, Ming GL, Song H, 2009. Neuronal Activity-Induced Gadd45b Promotes Epigenetic DNA Demethylation and Adult Neurogenesis. Science 323, 1074–1077. doi: 10.1126/science.1166859 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Massart R, Bamea R, Dikshtein Y, Suderman M, Meir O, Hallett M, Kennedy P, Nestler EJ, Szyf M, Yadid G, 2015. Role of DNA Methylation in the Nucleus Accumbens in Incubation of Cocaine Craving. Journal of Neuroscience 35, 8042–8058. doi: 10.1523/JNEUROSCI.3053-14.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Matsuda KI, Mori H, Nugent BM, Pfaff DW, McCarthy MM, Kawata M, 2011. Histone Deacetylation during Brain Development Is Essential for Permanent Masculinization of Sexual Behavior. Endocrinology 152, 2760–2767. doi: 10.1210/en.2011-0193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. McGowan PO, Sasaki A, D’Alessio AC, Dymov S, Labonte B, Szyf M, Turecki G, Meaney MJ, 2009. Epigenetic regulation of the glucocorticoid receptor in human brain associates with childhood abuse. Nature Neuroscience 12, 342–348. doi: 10.1038/nn.2270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Meaney MJ, Stewart J, 1981. Neonatal-androgens influence the social play of prepubescent rats. Hormones and Behavior 15, 197–213. doi: 10.1016/0018-506X(81)90028-3 [DOI] [PubMed] [Google Scholar]
  43. Niehrs C, Schäfer A, 2012. Active DNA demethylation by Gadd45 and DNA repair. Trends in Cell Biology 22, 220–227. doi: 10.1016/j.tcb.2012.01.002 [DOI] [PubMed] [Google Scholar]
  44. Nugent BM, Wright CL, Shetty AC, Hodes GE, Lenz KM, Mahurkar A, Russo SJ, Devine SE, McCarthy MM, 2015. Brain feminization requires active repression of masculinization via DNA methylation. Nature Publishing Group 1–11. doi: 10.1038/nn.3988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Phelps EA, LeDoux JE, 2005. Contributions of the Amygdala to Emotion Processing: From Animal Models to Human Behavior. Neuron 48, 175–187. doi: 10.1016/j.neuron.2005.09.025 [DOI] [PubMed] [Google Scholar]
  46. Porterfield VM, Piontkivska H, Mintz EM, 2007. Identification of novel light-induced genes in the suprachiasmatic nucleus. BMC Neurosci 8, 98. doi: 10.1186/1471-2202-8-98 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Roth TL, David Sweatt J, 2010. Annual Research Review: Epigenetic mechanisms and environmental shaping of the brain during sensitive periods of development. Journal of Child Psychology and Psychiatry 52, 398–408. doi: 10.1111/j.1469-7610.2010.02282.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ruzicka WB, Zhubi A, Veldic M, Grayson DR, Costa E, Guidotti A, 2007. Selective epigenetic alteration of layer I GABAergic neurons isolated from prefrontal cortex of schizophrenia patients using laser-assisted microdissection. Molecular Psychiatry 12, 385–397. doi: 10.1038/sj.mp.4001954 [DOI] [PubMed] [Google Scholar]
  49. Shaw P, Lawrence EJ, Radboume C, Bramham J, Polkey CE, David AS, 2004. The impact of early and late damage to the human amygdala on “theory of mind” reasoning. Brain 127, 1535–1548. doi: 10.1093/brain/awhl68 [DOI] [PubMed] [Google Scholar]
  50. Sultan FA, Wang J, Tront J, Liebermann DA, Sweatt JD, 2012. Genetic deletion of Gadd45b, a regulator of active DNA demethylation, enhances long-term memory and synaptic plasticity. J. Neurosci. 32, 17059–17066. doi: 10.1523/JNEUROSCI.1747-12.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Szyf M, 2015. Prospects for the development of epigenetic drugs for CNS conditions. Nature Publishing Group 1–14. doi: 10.1038/nrd4580 [DOI] [PubMed] [Google Scholar]
  52. Tsai H-W, Grant PA, Rissman EF, 2009. Sex differences in histone modifications in the neonatal mouse brain. Epigenetics 4, 47–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Veldic M, Caruncho HJ, Liu WS, Davis J, Satta R, Grayson DR, Guidotti A, Costa E, 2004. DNA-methyltransferase 1 mRNA is selectively overexpressed in telencephalic GABAergic interneurons of schizophrenia brains. Proceedings of the National Academy of Sciences 101, 348–353. doi: 10.1073/pnas.2637013100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Veldic M, Guidotti A, Maloku E, Davis JM, Costa E, 2005. In psychosis, cortical intemeurons overexpress DNA-methyltransferase 1. Proceedings of the National Academy of Sciences 102, 2152–2157. doi: 10.1073/pnas.0409665102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Veldic M, Kadriu B, Maloku E, Agis-Balboa RC, Guidotti A, Davis JM, Costa E, 2007. Epigenetic mechanisms expressed in basal ganglia GABAergic neurons differentiate schizophrenia from bipolar disorder. Schizophrenia Research 91, 51–61. doi: 10.1016/j.schres.2006.11.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Weaver ICG, Cervoni N, Champagne FA, D’Alessio AC, Sharma S, Seckl JR, Dymov S, Szyf M, Meaney MJ, 2004. Epigenetic programming by maternal behavior. Nature Neuroscience 7, 847–854. doi: 10.1038/nnl276 [DOI] [PubMed] [Google Scholar]
  57. Wilson EM, French FS, 1976. Binding properties of androgen receptors. Evidence for identical receptors in rat testis, epididymis, and prostate. Journal of Biological Chemistry 251, 5620–5629. [PubMed] [Google Scholar]
  58. Wu SC, Zhang Y, 2010. Active DNA demethylation: many roads lead to Rome. Nature Publishing Group 11, 607–620. doi: 10.1038/nrm2950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Xu J, Deng X, Disteche CM, 2008a. Sex-Specific Expression of the X-Linked Histone Demethylase Gene Jaridlc in Brain. PLoS ONE 3, e2553. doi: 10.1371/journal.pone.0002553 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Xu J, Deng X, Watkins R, Disteche CM, 2008b. Sex-Specific Differences in Expression of Histone Demethylases Utx and Uty in Mouse Brain and Neurons. Journal of Neuroscience 28, 4521–4527. doi: 10.1523/JNEUROSCI.5382-07.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES