Abstract
Premise of the Study
To investigate the population genetics and evolutionary history of wuyao (Lindera aggregata, Lauraceae) and other Lindera species, polymorphic chloroplast microsatellite (cpSSR) primers were developed.
Methods and Results
The complete chloroplast genome of L. glauca was used to design 74 primers for L. aggregata. Agarose gel electrophoresis and Sanger sequencing were used to select 20 polymorphic primers. These primers were then tested in 70 individuals from three populations of L. aggregata. The number of alleles ranged from two to four, and the unbiased haploid diversity index ranged from 0.457 to 0.685. Up to 17 primers successfully amplified in four other Lindera species: L. prattii, L. chunii, L. lungshengensis, and L. pulcherrima var. hemsleyana.
Conclusions
The 20 primers reported here can potentially be used for future genetic studies of L. aggregata and other Lindera species.
Keywords: chloroplast microsatellite, Lauraceae, Lindera aggregata, wuyao
Wuyao, Lindera aggregata (Sims) Kosterm. (Lauraceae), is a plant species whose use in traditional Chinese medicine can be traced back to the Zhou Dynasty (1046–256 BC). Wuyao has complex pharmacological effects, including anti‐inflammatory, antiviral, antibacterial, antioxidant, and anti‐fatigue effects (Chen and Yu, 2011). Since 2005, wuyao has been protected as a medicinal remedy in Tiantai County, Zhejiang Province, China (between 28.95–29.34°N and 120.69–121.26°E). Because L. aggregata is a dominant species in evergreen broad‐leaved forests and is widely distributed in subtropical China (Wang, 2006), its wild genetic diversity is an excellent source for genetic breeding.
DNA polymorphisms in the form of microsatellite (or simple sequence repeat [SSR]) markers are a powerful source for population genetic studies (Kalia et al., 2011). SSRs are present in both nuclear and organelle (such as chloroplast) genomes. Nuclear microsatellites (nSSRs) are codominant, biparentally inherited, and highly polymorphic, making them suitable to investigate distributions of genetic diversity and recent demographic histories. Chloroplast microsatellites (cpSSRs) also possess some unique characteristics, such as haploidy, nonrecombination, and uniparental inheritance (Ebert and Peakall, 2009). In particular, the chloroplast genome has a low nucleotide substitution rate, and therefore cpSSRs can provide unique insights into ancient evolutionary processes (Provan et al., 2001). Abundant nSSR primers have been developed in different Lindera Thunb. species, such as L. melissifolia (Walter) Blume (Echt et al., 2006), L. benzoin (L.) Blume (Edwards and Niesenbaum, 2007), and L. glauca (Siebold & Zucc.) Blume (Zhu et al., 2016), and these nSSRs have been used to investigate evolutionary histories of Lindera species (such as L. obtusiloba Blume [Ye et al., 2017]). However, no specific cpSSR primers have been developed in the Lindera genus. As complete chloroplast genomes have been widely used for cpSSR primer design (Deng et al., 2017), an existing chloroplast genome of L. glauca was used to develop novel cpSSR primers for L. aggregata.
METHODS AND RESULTS
We collected 70 L. aggregata individuals from three populations: Wuyunjie (WYJ) in Hunan Province, Tianmu Mountain (TMSH) in Zhejiang Province, and Nanning (NAN) in Guangxi Province (Appendix 1). Total genomic DNA was extracted from dried leaves using the Plant Genomic DNA Kit (DP305‐03; Tiangen, Beijing, China).
From the complete chloroplast genome of L. glauca (GenBank accession number MF188124.1), 74 cpSSR loci were identified using SSRHunter 1.3 (Li and Wan, 2005) with the repeat threshold settings of 10 repeat units for mononucleotide and five, four, three, or three repeats for di‐, tri‐, tetra‐, and pentanucleotide cpSSRs, respectively. Based on their flanking regions, we designed 74 cpSSR primers using Primer3Plus (Untergasser et al., 2007) with the following settings: primer size 18–27 bp, product length 150–300 bp, annealing temperature 57.0–63.0°C, and GC 20.0–80.0%.
Using the 74 cpSSR primers, PCR assays were performed in individual 40‐μL reaction mixes containing 10–20 ng of template DNA, 1× buffer, 10 mM Tris‐HCl (pH 8.3), 50 mM KCl, 200 mM each dNTP, 2.0 mM MgCl2, 0.1 mM each primer, and two units of Taq (TaKaRa Biotechnology Co., Dalian, China). PCR amplifications were performed as follows: an initial denaturation step at 94°C for 5 min; followed by 30 cycles of 50 s at 94°C, 50 s at the annealing temperature (Table 1), and 50 s at 72°C; with a final extension step at 72°C for 10 min. Agarose gel electrophoresis was used to select primers that generated a single clear band, and these primers were used to amplify cpSSRs in one individual each from the WYJ, TMSH, and NAN populations (Appendix 1). The amplicons were sequenced and then read in CodonCode Aligner 3.6.1 (CodonCode Corporation, Centerville, Massachusetts, USA) to screen for polymorphic loci.
Table 1.
Characteristics of 20 chloroplast microsatellite markers of Lindera aggregata and locus position in the L. glauca chloroplast genome
| Locus | Primer sequences (5′–3′) | Allele size range (bp) | T a (°C) | Repeat motif | Fluorescent labela | GenBank accession no. | Position |
|---|---|---|---|---|---|---|---|
| LAG20 | F: TGGCCGTTGTTCCTTATTTC | 203–205 | 60 | (A)10 | HEX | MH569843 | atpB/rbcL (57972–58176) |
| R: CAACCCAATCCTTGTTTTGC | |||||||
| LAG5 | F: GCAGAAGTCCCAACCCTATTG | 200–202 | 60 | (A)16 | 6‐FAM | MH569849 | ndhF/rpl32 (116030–116227) |
| R: TTGAAAAATGGTAACTTCTTCATTTG | |||||||
| LAG9 | F: GGAAGCGGCAGAAATCAAT | 226–227 | 60 | (A)14 | TAMRA | MH569848 | atpH/atpI (15049–15270) |
| R: CAAAGACTCCACGGATAGGAA | |||||||
| LAG11 | F: TAGTGGGAGTGACACGGATT | 201–205 | 60 | (A)13 | HEX | MH569847 | trnD‐GUC/trnY‐GUA (32657–32864) |
| R: GGCGATATGTCTACGCTGGT | |||||||
| LAG12 | F: ATTCTTCCCATCCCAAAACC | 161–162 | 60 | (A)16 | 6‐FAM | MH569846 | trnG‐UCC/trnfM‐CAU (38941–39103) |
| R: CGGGGTAGAGCAGTTTGGTA | |||||||
| LAG15 | F: TACCGGAAAGAGTGGAAAGG | 175–178 | 60 | (A)16 | TAMRA | MH569845 | trnS‐GGA/rps4 (47813–47983) |
| R: TTCCCGTCAGACTTGAACCT | |||||||
| LAG19 | F: TTCTCGATGAAGTCGGTTGA | 154–158 | 60 | (A)12 | HEX | MH569844 | clpP (74861–75018) |
| R: AAGAAAAAGCCCGCTACGA | |||||||
| LAG21 | F: CCGTGTGAGAGCAACAATGA | 165–166 | 60 | (C)11(T)11 | 6‐FAM | MH569842 | matK/rps16 (5095–5264) |
| R: ATTTCAAAGAAGGCGGAGGT | |||||||
| LAG23 | F: AAACGATTGATTCCCCTGTG | 214–215 | 60 | (T)13 | TAMRA | MH569841 | rps16 (5907–6117) |
| R: TGGAGCTCGAGCATAAAGAA | |||||||
| LAG24 | F: TGCATCATGTGAGAATCCAAA | 226–228 | 60 | (T)13 | HEX | MH569840 | rps16/trnQ‐UUG (7843–8067) |
| R: TCACAAACAAACGGATCGAG | |||||||
| LAG26 | F: AAGTCATTTGGGGTGCATTC | 178–180 | 60 | (T)17 | 6‐FAM | MH569839 | trnG‐UCC (10893–11071) |
| R: TTCATTCGGCTCCTTTATGG | |||||||
| LAG28 | F: GATTGGCTTAGAGCCCTTACA | 182–183 | 60 | (T)10 | TAMRA | MH569838 | atpH/atpI (15585–15764) |
| R: GTGAATCCATGGAGGGTCAT | |||||||
| LAG29 | F: ATGGCCAAAATGAACTCCTG | 159–164 | 60 | (T)10 | HEX | MH569837 | rps2/rpoC2 (17350–17507) |
| R: CGGTCAATCTCCGGTAGAAG | |||||||
| LAG31 | F: GGCTCCTGTAACCGTGTCAT | 227–231 | 60 | (T)13 | 6‐FAM | MH569836 | rpoC1 (23959–24184) |
| R: GATGCCCCTGACTCTGACAT | |||||||
| LAG32 | F: GTAACCCCGCCAAGAATGTA | 235–237 | 60 | (T)10 | TAMRA | MH569835 | trnC‐GCA/petN (29753–29989) |
| R: ATACACAGTTGCCCCTTGGA | |||||||
| LAG33 | F: AGGGATACACATGATGGGAAA | 165–167 | 60 | (T)12 | HEX | MH569834 | petN/psbM (30459–30623) |
| R: GGTTCCCTCTTTGAACAGCA | |||||||
| LAG38 | F: CGGGAGTCATTGGTTCAAA | 225–226 | 60 | (T)12 | 6‐FAM | MH569833 | trnM‐CAU/atpE (55474–55692) |
| R: CATATTTGGATTCCGCCAAT | |||||||
| LAG41 | F: TGTGATTCAGCAATCCCAAA | 168–170 | 60 | (T)12 | TAMRA | MH569832 | clpP (74203–74372) |
| R: ATGTATCGGGGTCCATTTCA | |||||||
| LAG48 | F: CACCCCCAGACCTCCTAATA | 245–248 | 60 | (T)10 | HEX | MH569831 | ndhG/ndhI (123356–123598) |
| R: GCGGGATTGATCCAATAACT | |||||||
| LAG49 | F: TGAAATTCAACAGACCCTTTG | 182–183 | 56 | (T)12 | 6‐FAM | MH569830 | rps15/ycf1 (128090–128268) |
| R: TCCAGATTATTGGGTGTATCAGA |
T a = annealing temperature.
Forward primers were modified at the 5′ end with fluorescent labels: HEX (green), 6‐FAM (blue), or TAMRA (yellow).
To determine the allelic size range of the polymorphic cpSSR loci, a fluorescent label was added to each forward primer (Table 1) and PCR was then performed in all 70 individuals following the procedure mentioned above (Appendix 1). The amplicons were resolved on an ABI 3500XL automated DNA sequencer with the GeneScan 500 ROX Size Standard (Applied Biosystems, Foster City, California, USA). The microsatellite marker profiles were analyzed using GeneMarker version 1.80 (Holland and Parson, 2011). To reduce score error, two people independently read all alleles, and any disputes were decided by a third person. For each locus, the number of alleles and unbiased haploid diversity index were calculated using GenAlEx 6.5 (Peakall and Smouse, 2012). The polymorphic cpSSR primers were further cross‐amplified in L. prattii Gamble, L. chunii Merr., and L. lungshengensis S. Lee using one individual in each species, and in L. pulcherrima (Nees) Benth. ex Hook. f. var. hemsleyana (Diels) H. P. Tsui using eight individuals (Appendix 1).
Among the 74 cpSSR primers developed in L. aggregata, five primers could not be successfully amplified, 49 primers were monomorphic, and the remaining 20 primers were polymorphic (Table 1). In all 70 individuals, the number of alleles ranged from two to four, and the unbiased haploid diversity index ranged from 0.457 to 0.685. In the three populations of L. aggregata, low genetic diversity was evident because most loci were fixed with one allele, and the TMSH population had relatively higher genetic diversity (Table 2). Up to 17 cpSSR primers were successfully amplified in L. prattii, L. chunii, and L. lungshengensis, and similar cpSSR range sizes were found in L. pulcherrima var. hemsleyana (Table 2).
Table 2.
Genetic diversity of 20 chloroplast microsatellites in three populations of Lindera aggregata and cross‐amplification in four other Lindera species.a
| Locus | Lindera aggregata | L. prattii (n = 1) | L. chunii (n = 1) | L. lungshengensis (n = 1) | L. pulcherrima var. hemsleyana (Allele size range) (n = 8) | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| WYJ (n = 22) | TMSH (n = 24) | NAN (n = 24) | All (n = 70) | |||||||||
| A | h | A | h | A | h | A | h | |||||
| LAG20 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | + | + | + | + (208) |
| LAG5 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 3 | 0.676 | + | + | + | + (202–205) |
| LAG9 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | — | — | — | + (235–237) |
| LAG11 | 1 | 0.000 | 2 | 0.344 | 2 | 0.083 | 4 | 0.552 | + | + | + | + (203–204) |
| LAG12 | 1 | 0.000 | 2 | 0.083 | 1 | 0.000 | 2 | 0.466 | + | + | + | + (160) |
| LAG15 | 1 | 0.000 | 2 | 0.344 | 1 | 0.000 | 3 | 0.542 | — | — | — | + (170–174) |
| LAG19 | 1 | 0.000 | 3 | 0.409 | 1 | 0.000 | 4 | 0.677 | + | + | + | + (154–155) |
| LAG21 | 1 | 0.000 | 2 | 0.344 | 1 | 0.000 | 2 | 0.492 | — | — | — | + (167–168) |
| LAG23 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | — | — | — | — |
| LAG24 | 1 | 0.000 | 2 | 0.344 | 1 | 0.000 | 3 | 0.670 | + | + | + | + (226–228) |
| LAG26 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 3 | 0.676 | + | + | + | + (181) |
| LAG28 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | — | — | — | — |
| LAG29 | 1 | 0.000 | 2 | 0.083 | 1 | 0.000 | 4 | 0.685 | + | + | + | + (156) |
| LAG31 | 1 | 0.000 | 2 | 0.083 | 1 | 0.000 | 4 | 0.685 | + | + | + | + (227) |
| LAG32 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 3 | 0.676 | + | + | + | + (234) |
| LAG33 | 2 | 0.519 | 1 | 0.000 | 1 | 0.000 | 3 | 0.626 | + | + | + | + (164–167) |
| LAG38 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | + | + | + | + (222–223) |
| LAG41 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 3 | 0.676 | + | + | + | + (168) |
| LAG48 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | + | + | + | + (242–243) |
| LAG49 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.457 | — | — | — | — |
+ = successful amplification; — = unsuccessful amplification; A = number of alleles; h = unbiased haploid diversity; n = number of individuals.
Voucher and locality information are provided in Appendix 1.
CONCLUSIONS
Using an existing chloroplast genome of L. glauca, we successfully developed and characterized 20 polymorphic L. aggregata chloroplast microsatellite markers. A limited number of alleles were found in all 20 loci, indicating a very low evolutionary rate in the chloroplast genome or a shallow history of L. aggregata. Low intrapopulation and high interpopulation diversity found in the three populations indicate these populations may have experienced long‐term isolation (Avise, 2000). Due to the high rate of cross‐amplification (70–85%), the 20 polymorphic cpSSR primers will likely be useful in intra‐ or interspecific genetic studies in Lindera.
ACKNOWLEDGMENTS
This work was supported by the National Natural Science Foundation of China (31600301).
Appendix 1. Location and voucher information for Lindera species used in this study.
| Taxon | Population | Location | n | Latitude | Longitude | Voucher no.a |
|---|---|---|---|---|---|---|
| Lindera aggregata (Sims) Kosterm. | TMSH | Mt. Tianmu, Zhejiang, China | 24 | 30.42 | 119.41 | SHM22266 |
| WYJ | Wuyunjie, Hunan, China | 22 | 28.62 | 111.49 | SHM23283 | |
| NAN | Nanning, Guangxi, China | 24 | 22.73 | 108.30 | SHM23287 | |
| L. prattii Gamble | EM | Mt. Emei, Sichuan, China | 1 | 29.55 | 103.37 | SHM23285 |
| L. pulcherrima (Nees) Benth. ex Hook. f. var. hemsleyana (Diels) H. P. Tsui | CHD | Mt. Jinfo, Chongqing, China | 8 | 29.08 | 107.16 | SHM23295 |
| L. chunii Merr. | DHS | Mt. Dinghu, Guangdong, China | 1 | 23.17 | 112.55 | SHM23299 |
| L. lungshengensis S. Lee | LSH | Longsheng County, Guangxi, China | 1 | 25.79 | 110.01 | SHM23280 |
n = number of individuals.
Voucher specimens were deposited in the Shanghai Museum of Natural History (SHM), Shanghai, China.
Ye, J.‐W. , and Li D.‐Z.. 2019. Development of 20 chloroplast microsatellite primers in wuyao (Lindera aggregata, Lauraceae). Applications in Plant Sciences 7(8): e1213.
DATA ACCESSIBILITY
All sequences have been deposited to the National Center for Biotechnology Information GenBank database, and accession numbers are provided in Table 1.
LITERATURE CITED
- Avise, J. C. 2000. Phylogeography: The history and formation of species. Harvard University Press, Cambridge, Massachusetts, USA. [Google Scholar]
- Chen, F.‐L. , and Yu C.‐Q.. 2011. The overview of the pharmacological research of Lindera aggregata (in Chinese). Strait Pharmaceutical Journal 23: 44–46. [Google Scholar]
- Deng, Q. , Zhang H.‐R., He Y.‐P., Wang T., and Su Y.‐J.. 2017. Chloroplast microsatellite markers for Pseudotaxus chienii developed from the whole chloroplast genome of Taxus chinensis var. mairei (Taxaceae). Applications in Plant Sciences 5: 1600153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ebert, D. , and Peakall R.. 2009. Chloroplast simple sequence repeats (cpSSRs): Technical resources and recommendations for expanding cpSSR discovery and applications to a wide array of plant species. Molecular Ecology Resources 9: 673–690. [DOI] [PubMed] [Google Scholar]
- Echt, C. S. , Deemer D., Kubisiak T., and Nelson C. D.. 2006. Microsatellites for Lindera species. Molecular Ecology Notes 6: 1171–1173. [Google Scholar]
- Edwards, M. J. , and Niesenbaum R. A.. 2007. Eleven polymorphic microsatellite loci in Lindera benzoin, Lauraceae. Molecular Ecology Notes 7: 1302–1304. [Google Scholar]
- Holland, M. M. , and Parson W.. 2011. GeneMarker HID: A reliable software tool for the analysis of forensic STR data. Journal of Forensic Sciences 56: 29–35. [DOI] [PubMed] [Google Scholar]
- Kalia, R. K. , Rai M. K., Kalia S., Singh R., and Dhawan A. K.. 2011. Microsatellite markers: An overview of the recent progress in plants. Euphytica 177: 309–334. [Google Scholar]
- Li, Q. , and Wan J.‐M.. 2005. SSRHunter: Development of a local searching software for SSR sites. Hereditas 27: 808–810. [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Provan, J. , Powell W., and Hollingsworth P. M.. 2001. Chloroplast microsatellites: New tools for studies in plant ecology and evolution. Trends in Ecology and Evolution 16: 142–147. [DOI] [PubMed] [Google Scholar]
- Untergasser, A. , Nijvee H., Rao X.‐Y., Bisseling T., Geurts R., and Leunissen J. A. M.. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35: W71–W74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, X. H. 2006. The phytogeography and species diversity of typical evergreen borad‐leaved forest in China. PhD dissertation, East China Normal University, Shanghai, China.
- Ye, J.‐W. , Bai W.‐N., Bao L., Wang H.‐F., and Ge J.‐P.. 2017. Sharp genetic discontinuity in the arid‐sensitive species Lindera obtusiloba (Lauraceae): Solid evidence supporting the Tertiary floral subdivision in East Asia. Journal of Biogeography 44: 2082–2095. [Google Scholar]
- Zhu, S.‐S. , Ding Y.‐Q., Yap Z.‐Y., and Qiu X.‐Y.. 2016. De novo assembly and characterization of the floral transcriptome of an economically important tree species, Lindera glauca (Lauraceae), including the development of EST‐SSR markers for population genetics. Molecular Biology Reports 43: 1243–1250. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All sequences have been deposited to the National Center for Biotechnology Information GenBank database, and accession numbers are provided in Table 1.