Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2019 Aug 26;57(9):e00604-19. doi: 10.1128/JCM.00604-19

A Novel Broad Allele-Specific TaqMan Real-Time PCR Method To Detect Triazole-Resistant Strains of Aspergillus fumigatus, Even with a Very Low Percentage of Triazole-Resistant Cells Mixed with Triazole-Susceptible Cells

Qian Wang a,b,c, Dimitrios P Kontoyiannis d, Ruoyu Li a,b,c, Wei Chen a,b,c, Dingfang Bu a, Wei Liu a,b,c,
Editor: David W Warnock
PMCID: PMC6711921  PMID: 31315952

Invasive aspergillosis caused by triazole-resistant strains of Aspergillus fumigatus is a growing public health concern, as is the occurrence of mixed infections with triazole-resistant and -susceptible A. fumigatus strains. Therefore, it is crucial to develop robust methods to identify triazole-resistant strains of A. fumigatus, even in mixtures of triazole-resistant and -susceptible strains of A. fumigatus.

KEYWORDS: A. fumigatus, allele-specific real-time PCR, cyp51A mutations, mixed infection, triazole resistance

ABSTRACT

Invasive aspergillosis caused by triazole-resistant strains of Aspergillus fumigatus is a growing public health concern, as is the occurrence of mixed infections with triazole-resistant and -susceptible A. fumigatus strains. Therefore, it is crucial to develop robust methods to identify triazole-resistant strains of A. fumigatus, even in mixtures of triazole-resistant and -susceptible strains of A. fumigatus. In this work, we developed a robust, highly selective, and broad-range allele-specific TaqMan real-time PCR platform consisting of 7 simultaneous assays that detect TR34 (a 34-bp tandem repeat in the promoter region), TR46, G54W (a change of G to W at position 54), G54R, L98H, Y121F, and M220I mutations in the cyp51A gene of A. fumigatus. The method is based on the widely used TaqMan real-time PCR technology and combines allele-specific PCR with a blocking reagent (minor groove binder [MGB] oligonucleotide blocker) to suppress amplification of the wild-type cyp51A alleles. We used this method to detect triazole-resistant clinical strains of A. fumigatus with a variety of cyp51A gene mutations, as well as the triazole-resistant strains in mixtures of triazole-resistant and -susceptible strains of A. fumigatus. The method had high efficiency and sensitivity (300 fg/well, corresponding to about 100 CFU per reaction mixture volume). It could promptly detect triazole resistance in a panel of 30 clinical strains of A. fumigatus within about 6 h. It could also detect cyp51A-associated resistance alleles, even in mixtures containing only 1% triazole-resistant A. fumigatus strains. These results suggest that this method is robustly able to detect cyp51A-associated resistance alleles even in mixtures of triazole-resistant and -susceptible strains of A. fumigatus and that it should have important clinical applications.

INTRODUCTION

Invasive aspergillosis (IA), chronic aspergillosis, and allergic aspergillosis are mainly caused by Aspergillus fumigatus (1). Triazole antifungal agents, including itraconazole, voriconazole, posaconazole, and isavuconazole, are the backbone of the prevention and treatment of aspergillosis (2). However, triazole resistance in A. fumigatus has been reported with increasing frequency in the last decades, with the overall prevalence of triazole resistance ranging from 4.6% to 30%, which varies dramatically both by geographical region and patient population (3). Importantly, the mortality rates in patients with triazole-resistant IA are very high, ranging from 86% to 100% (4). Due to the low culturability of the fungus in patients with aspergillosis, triazole resistance may be missed when traditional culture-based diagnosis methods are used (5). Therefore, more sensitive and rapid detection methods for triazole resistance in A. fumigatus, especially in the clinical setting, where triazole-resistant A. fumigatus strains coexist with triazole-susceptible A. fumigatus strains, remain an important priority (6).

As traditional culture-based in vitro antifungal susceptibility testing is cumbersome and takes up to a week for results, molecular-based methods have been developed to detect mutations in cyp51A, the target gene whose mutations are the major mechanism of triazole resistance in A. fumigatus (3). Several strategies have been employed. PCR assays followed by DNA sequence analysis to detect the most frequent mutations in the A. fumigatus cyp51A gene may be used even in primary clinical samples (7). Specifically, real-time PCR, including allelic discrimination of cyp51A with the TaqMan probe (8), single-nucleotide polymorphism (SNP) genotyping of cyp51A with allele-specific molecular beacons (9, 10), and high-resolution melting (HRM) curve analysis for cyp51A (11, 12), have been the most promising tools to identify clinical samples. In addition, coinfections with both triazole-resistant and -susceptible strains of A. fumigatus have been described (6), and their detection by culture is problematic, posing additional challenges in management. Specifically, conventional antifungal susceptibility testing of a single colony often fails to identify both triazole-resistant and -susceptible strains in mixed cultures (6). Therefore, molecular assays which can simultaneously detect wild-type and mutant cyp51A DNA should be more optimal to identify triazole-resistant and -susceptible strains. So far, only the PathoNostics AsperGenius assay, which is based on the HRM method, has been successfully applied to detect mixed infections by triazole-susceptible and -resistant A. fumigatus strains (13). However, the method has limited sensitivity, as it fails to detect triazole resistance when the proportion of the triazole-resistant subpopulation in the mixture is less than 16% (13).

At present, more than 20 resistance-conferring amino acid substitutions in Cyp51A have been reported (14). TR34 (a 34-bp tandem repeat in the promoter region)/L98H (change of L to H at position 98), TR46/T289A/Y121F mutations, and mutations at codons 54 and 220 in cyp51A are the most common resistance mutations, described globally (15) and also reported in China (1619). In prior work that preceded the discovery of A. fumigatus harboring TR46/Y121F/T289A in China (19), our team developed a real-time PCR method targeting the TR34/L98H, G54W, G54R, and M220I mutations (8).

Here, we describe a robust, highly selective, and broad-range allele-specific TaqMan real-time PCR platform consisting of 7 simultaneous assays that detects all the aforementioned alleles (TR34, TR46, G54W, G54R, L98H, Y121F, and M220I) implicated in triazole resistance in strains of A. fumigatus. In addition, we also show that this new method is more sensitive than the PathoNostics AsperGenius assay in detecting triazole-resistant A. fumigatus in mixture of triazole-resistant and -susceptible A. fumigatus strains and has a broader range of allele detection, as the latter only detects TR34/L98H and TR46/Y121F/T289A mutations (13).

MATERIALS AND METHODS

A. fumigatus strains.

A. fumigatus reference strain Af293 and 5 clinical strains of A. fumigatus (Table 1) with triazole-resistance resulting from different mutations in the cyp51A gene, including TR34/L98H, TR46/Y121F/T289A, G54W, G54R, and M220I (3), were selected to establish the triazole antifungal resistance detection assays. Thirty clinical strains of A. fumigatus (15 triazole-resistant strains and 15 triazole-susceptible strains) were used for the validation of this method (Table 1). All A. fumigatus strains were stored at the Research Center for Medical Mycology, Peking University. Identification of A. fumigatus was performed on the basis of macroscopic and microscopic morphological features, as well as molecular data, including sequence analysis of an internal transcribed spacer (ITS) region and the β-tubulin and calmodulin genes if necessary (20). In vitro antifungal susceptibility was determined according to CLSI methods (2123). The coding sequence and promoter region of the cyp51A gene in triazole-resistant strains were amplified by PCR and sequenced to verify any mutations (16).

TABLE 1.

Phenotypic and genotypic characteristics of the strains used in this study

Strain (n = 30) MIC (μg/ml) ofa :
cyp51A genotype Applicationb
ITC VRC POS
BMU 07945 0.5 >16 0.5 TR46/Y121F/T289A Establish detection assays and validate method
BMU 08181 >16 2 0.5 TR34/L98H
BMU 03908 16 0.5 16 G54W
BMU 02810 16 0.5 0.5 G54R
BMU 02731 16 1 0.25 M220I
BMU 07946 0.5 >16 0.5 TR46/Y121F/T289A Validate method
BMU 07160 >16 2 1 TR34/L98H
BMU 04835 >16 8 1 TR34/L98H
BMU 04836 >16 2 1 TR34/L98H
BMU 02816 16 0.5 0.5 G54R
BMU 02998 16 0.5 0.5 G54R
BMU 03941 16 1 16 G54W
BMU 03942 16 1 16 G54W
BMU 04053 16 0.5 16 G54W
BMU 04758 16 1 16 G54W
BMU 01028 1 0.5 0.25 None
BMU 02491 0.5 0.5 0.125 None
BMU 02732 1 1 0.125 None
BMU 02961 0.5 0.5 0.25 None
BMU 03968 0.5 0.5 0.03 None
BMU 04626 1 0.5 0.06 None
BMU 07722 0.5 0.5 0.125 None
BMU 07427 0.5 0.25 0.125 None
BMU 07442 0.5 1 0.125 None
BMU 07543 1 0.5 0.03 None
BMU 07544 0.5 1 0.125 None
BMU 07545 0.5 0.5 0.06 None
BMU 07446 0.25 0.5 0.125 None
BMU 07891 1 0.5 0.125 None
BMU 08016 0.5 1 0.125 None
a

ITC, itraconazole; VRC, voriconazole; POS, posaconazole.

b

All 30 strains were used to validate the efficacy of this method in distinguishing triazole-resistant and -susceptible strains, and the first 5 triazole-resistant strains were additionally used to establish the detection assays.

Establishment of a novel allele-specific real-time PCR method.

(i) Assay design. In order to identify triazole-resistant A. fumigatus strains harboring the 5 cyp51A-associated resistance mechanisms described above, mutant allele assays targeting cyp51A mutations, including TR34, TR46, G54R, G54W, L98H, Y121F, and M220I, were designed (Table 2 and Fig. 1). Each mutant allele assay contained (Fig. 2) (i) an allele-specific primer (ASP) matching the specific mutant allele and specifically amplifying the mutant allele, (ii) a locus-specific primer (LSP) located 50 to 100 bases downstream from the forward primer in the promoter and coding sequence of the cyp51A gene, (iii) a locus-specific TaqMan probe (LST) that is annealed to the DNA region amplified by this primer pair, and (iv) a minor groove binder (MGB) oligonucleotide allele-specific blocker (ASB) binding to the wild-type allele that was added to each of these assays to detect the SNPs G54W, G54R, L98H, Y121F, and M220I to further suppress the amplification of the wild-type allele and allow specific amplification of mutant alleles. To quantify the total DNA of A. fumigatus in the mixture of triazole-susceptible and -resistant A. fumigatus isolates, a cyp51A gene reference assay known as CYP51A_rf targeting a mutation-free region of cyp51A was developed (Table 2 and Fig. 1). Primers and probes (Table 3) were designed by using Primer Express software (Applied Biosystems).

TABLE 2.

Allele-specific real-time PCR assays developed in this study

Assay name Nucleotide change Amino acid substitution
CYP51A_rfa NAb NA
CYP51A_TR34_mu −322 to −288 insertion NA
CYP51A_TR46_mu −331 to −285 insertion NA
CYP51A_G54R_mu G160C G54R
CYP51A_G54W_mu G160T G54W
CYP51A_L98H_mu T293A L98H
CYP51A_Y121F_mu A362T Y121F
CYP51A_M220I_mu G731T M220I
a

CYP51A_rf is a real-time quantitative PCR assay targeting a mutation-free region of cyp51A to further quantify the total DNA of A. fumigatus in the mixture of triazole-susceptible and -resistant strains.

b

NA, not applicable.

FIG 1.

FIG 1

Schematic diagram of allele-specific TaqMan real-time PCR assays involved in this study. (Top) Seven mutations, including TR34, TR46, G54R, G54W, L98H, Y121F, and M220I, as well as a mutation-free region shown as a blue box, were included in this study. (Middle) Seven mutant allele assays targeting cyp51A mutations, including TR34, TR46, G54R, G54W, L98H, Y121F, and M220I, as well as CYP51A_rf, targeting the mutation-free region, were designed. (Bottom) The corresponding phenotype of an isolate can be deduced from the particular mutations that can be detected in the above-described assays. ITC, itraconazole; POS, posaconazole; VRC, voriconazole; R, resistance.

FIG 2.

FIG 2

Schematic diagram of the principle of the allele-specific real-time PCR. ASP, allele-specific primer; LSP, locus-specific primer; LST, locus-specific TaqMan probe; ASB, allele-specific blocker.

TABLE 3.

Primers, probes, and blockers used in this study

Assay Primer/probe/blockera Sequence (5′–3′)
CYP51A_rf cyp51_F CGGCCGGATGGACATCT
cyp51_R GCTCGAGCAGCGGTAAAAAT
cyp51_LST Fam-CAATGGCTGAGATTAC-MGB
CYP51A_TR34_mu TR34_ASP GAGCCGAATGAATCAC
TR_LST Fam-TTCCAGCATACCATACAC-MGB
TR_LSP ACCAATATAGGTTCATAGGTAAGTAGATCTACC
CYP51A_TR46_mu TR46_ASP CCGAATGAAAGTTGTCTAGAA
TR_LST Fam-TTCCAGCATACCATACAC-MGB
TR_LSP ACCAATATAGGTTCATAGGTAAGTAGATCTACC
CYP51A_G54R_mu G54R_ASP CTGGGTAGTACCATCAGTTACC
G54_ASB GGTAGTACCATCAGTTACGGG-MGB
G54_LST Fam-TTGATCCCTACAAGTTCTT-MGB
G54_LSP GTCAAACTACAATCTTGAGACTTGCCT
CYP51A_G54W_mu G54W_ASP CTGGGTAGTACCATCAGTTACT
G54_ASB GGTAGTACCATCAGTTACGGG-MGB
G54_LST Fam-TTGATCCCTACAAGTTCTT-MGB
G54_LSP GTCAAACTACAATCTTGAGACTTGCCT
CYP51A_L98H_mu L98H_ASP CTCAACGGCAAGCA
L98H_ASB AACGGCAAGCTCA-MGB
L98H_LST Fam-TAGTCCATTGACGACCC-MGB
L98H_LSP ACGTCCGATCCGAAAACG
CYP51A_Y121F_mu Y121F_ASP CGGATCGGACGTGGTGTT
Y121F_ASB ATCGGACGTGGTGTATG-MGB
Y121F_LST Fam-CAGAAAAAGTTCATCAAGTAC-MGB
Y121F_LSP GCAGATAGTCCAAAACCTCCTTCT
CYP51A_M220I_mu M220I_ASP TGGGGCCCACGGTAGA
M220I_ASB GGCCCACGGTAGCAT-MGB
M220I_LST Fam-AAGCCCTTGTCCAGGTC-MGB
M220I_LSP CAAGGCCAGGAAGTTCGTTC
a

ASP, allele-specific primer; ASB, allele-specific blocker; LST, locus-specific TaqMan probe; LSP, locus-specific primer.

(ii) Reaction mixture and cycling conditions. Real-time PCRs were run on an Applied Biosystems ViiA7 real-time PCR system. Each reaction mixture volume (20 μl) contained 1× TaqPath ProAmp master mix (Applied Biosystems, Foster City, CA, USA), 500 nM each primer, 250 nM probe, 500 nM MGB oligonucleotide (just for the 5 SNP assays), DNA (2 μl), and nuclease-free water. The cycling conditions were as follows: 1 cycle of 95°C for 10 min, 5 cycles of 92°C for 15 s and 58°C for 1 min, and 40 cycles of 92°C for 15 s and 60°C for 1 min (data collection). The cycle threshold (CT) is defined as the number of cycles required for the fluorescence signal to cross the threshold, which is inversely proportional to the amount of target nucleic acid in the sample. CT values were obtained using ViiA 7 software version 1.2 based on the automatic baseline and automatic threshold. PCRs of all samples were performed in duplicate or triplicate.

(iii) Amplification efficiency and sensitivity. Real-time PCR efficiency (E) is defined as the increase in the amplicon per cycle (24) and calculated from the gradient of the slope using the following equation: E = 10(−1/slope) − 1 (25). Sensitivity refers to the minimum number of CFU in a sample that can be detected in one assay. Standard curves were generated by plotting the CT values for a 10-fold dilution series of genomic DNA (gDNA), ranging from 30 fg to 30 ng (26), against the logarithm of the corresponding amount of DNA. The yield for A. fumigatus gDNA following extraction from 1 × 108 spores, corresponding to 1 × 108 CFU of A. fumigatus, was 300 ng (data not shown). Thus, 3 fg gDNA is equivalent to about 1 CFU of A. fumigatus. Therefore, the sensitivity of this method was tested by using the amount of gDNA and interpreted as the number of CFU according to the equation above. Specificity was measured by using 100 ng human gDNA and 100 pg gDNA extracted from single isolates of Aspergillus flavus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida parapsilosis, Candida krusei, Candida tropicalis, Cryptococcus neoformans, and Fusarium solani.

Detection of A. fumigatus triazole resistance in clinical strains.

We used a panel of 30 strains of A. fumigatus, including 15 triazole-resistant and 15 triazole-susceptible strains, in order to evaluate the efficiency of allele-specific real-time PCR assays in detecting triazole-resistant alleles. The CT value of each strain for each assay was recorded, and the cutoff value was defined as the CT value corresponding to the smallest amount of A. fumigatus gDNA that could be detected. When the CT value of a strain was lower than the cutoff value in a certain assay, we determined that this strain carried the corresponding mutation. Finally, we deduced the genotype of a specific strain by combining all 7 assays’ results, and the genotype was further analyzed to determine whether it was consistent with the sequence of cyp51A.

Detection of A. fumigatus triazole resistance in mixtures of triazole-resistant and -susceptible A. fumigatus strains.

To simulate the detection of triazole-resistant and -susceptible A. fumigatus coinfection, A. fumigatus gDNA of triazole-resistant strains was mixed with gDNA of the triazole-susceptible strain Af293. The total amount of A. fumigatus gDNA was 300 pg/well, and gDNA from triazole-resistant strains, including strains with the TR34/L98H, TR46/Y121F/T289A, G54W, G54R, M220I, and Af293 mutations, was mixed with gDNA of the susceptible strain in different ratios (resistant-strain gDNA/total gDNA) as follows: 100%, 50%, 25%, 10%, 5%, 1%, and 0%. These mixed DNA samples plus 100 ng human gDNA were used as samples in the PCR assays to detect specific triazole-resistant alleles.

RESULTS

Establishment of a novel allele-specific TaqMan real-time PCR method.

(i) Construction of a standard curve for each assay. By plotting the logarithms of a serial dilution standard with a range of 30 fg, 300 fg, 3 pg, 30 pg, 300 pg, 3 ng, and 30 ng A. fumigatus gDNA on the x axis and the CT values of the serially diluted standard on the y axis, we established standard curves (Fig. 3). According to the slope and y intercept of the standard curve, we were able to obtain the equation for each assay (Fig. 3). Using the equation for the standard curve, we were able to calculate the quantity of A. fumigatus gDNA and the corresponding A. fumigatus CFU count in a sample.

FIG 3.

FIG 3

Standard curves for the allele-specific real-time PCR assays. Shown are the standard curves of the assays, including CYP51A_TR34_mu (a), CYP51A_TR46_mu (b), CYP51A_G54R_mu (c), CYP51A_G54W_mu (d), CYP51A _L98H_mu (e), CYP51A_Y121F_mu (f), and CYP51A_M220I_mu (g). Values on the x axis are the logarithms of serially diluted standard gDNA of A. fumigatus. Values on the y axis are the CT values of the corresponding A. fumigatus gDNA.

(ii) Efficiency and sensitivity. The efficiency and sensitivity of each assay were determined using the standard curves as described in Materials and Methods. As shown by the results in Fig. 3, the slopes of these assays were between −3.513 and −3.244 (93% to 103% efficiency), with a correlation coefficient of 0.99. The sensitivity of all the assays was 300 fg/well, corresponding to about 100 CFU per reaction mixture volume (1 CFU of A. fumigatus corresponds to about 3 fg gDNA). There was no cross-reaction with 100 ng human gDNA or 100 pg gDNA from A. flavus, A. nidulans, A. niger, A. terreus, C. albicans, C. glabrata, C. parapsilosis, C. krusei, C. tropicalis, C. neoformans, or F. solani, indicating excellent specificity.

Assays on clinical strains.

Seven mutant detection assays were tested simultaneously with each of the 30 strains to reveal the genotypes of these strains and further assess their triazole resistance phenotypes. The results for the 30 strains showed that all 15 triazole-susceptible strains were classified as wild type, and the other 15 triazole-resistant strains were identified as TR34/L98H (n = 4), TR46/Y121F/T289A (n = 2), G54R (n = 3), G54W (n = 5), or M220I (n = 1), consistent with their cyp51A sequences. As shown by the results in Fig. 4, the cutoff value was defined as the CT value corresponding to the smallest amount of gDNA that could be detected (300 fg gDNA). If the CT value of a strain was lower than the cutoff value in a certain assay, we determined that that strain carried the corresponding mutation. Taking the assay CYP51A_TR34_mu as an example, the CT values of strains BMU04835, BMU04836, BMU08181, and BMU07160 were lower than the cutoff value, identifying these four strains as carrying the TR34 mutation. All six of the other mutant detection assays were also analyzed in this way.

FIG 4.

FIG 4

Amplification plot for allele-specific real-time PCR assays tested on clinical strains. Seven mutant allele assays, including CYP51A_TR34_mu (a), CYP51A_TR46_mu (b), CYP51A_G54R_mu (c), CYP51A_G54W_mu (d), CYP51A_L98H_mu (e), CYP51A_Y121F_mu (f), and CYP51A_M220I_mu (g), were performed on 30 clinical strains of A. fumigatus. In a particular assay targeting a specific mutation, if the CT value of a strain is lower than the cutoff value, the strain carries the corresponding mutation. The curves on the left of the 300-fg gDNA curve are the amplication curves of the strains carrying the corresponding mutation. The curves on the right of the 300-fg gDNA curve are the amplication curves of the strains not carrying the corresponding mutation.

Assays of mixtures of triazole-resistant and -susceptible A. fumigatus strains.

A. fumigatus gDNA mixtures comprising one of the triazole-resistant strains carrying the TR34, TR46, G54R, G54W, L98H, Y121F, and M220I mutations and the triazole-susceptible strain Af293 were prepared in different ratios as follows: 100%, 50%, 25%, 10%, 5%, 1%, 0% (resistant-strain gDNA/total gDNA). We tested all 7 mutant allele detection assays on the various mixtures. As shown by the results in Fig. 5, all the mutant allele assays were able to identify the corresponding mutation at a dilution of 1% (resistant-strain gDNA/total gDNA) with a CT value lower than the CT cutoff value, indicating that a ratio of resistant-strain gDNA/total gDNA of 1% remains detectable in these mutant assays.

FIG 5.

FIG 5

Amplification plot for allele-specific real-time PCR assays tested on mixtures of triazole-resistant and -susceptible strains of A. fumigatus. Seven mutant allele assays, including CYP51A_TR34_mu (a), CYP51A_TR46_mu (b), CYP51A_G54R_mu (c), CYP51A_G54W_mu (d), CYP51A_L98H_mu (e), CYP51A_Y121F_mu (f), and CYP51A_M220I_mu (g), were performed on mixtures of A. fumigatus gDNA from a triazole-resistant strain and the triazole-susceptible strain Af293. The cutoff value was defined as the CT value of 300 fg gDNA from the corresponding triazole-resistant strain. From the left red curve to the right blue curve are the amplication curves of the dilutions of 100%, 50%, 25%, 10%, 5%, and 1% (resistant-strain gDNA/total gDNA), respectively. All the mutant allele assays can detect the corresponding mutation at a dilution of 1% with a CT value lower than the CT cutoff value, indicating that a ratio of resistant-strain gDNA/total gDNA of 1% remains detectable in these mutant assays.

DISCUSSION

Outcomes are poor when triazoles are used as frontline therapy in triazole-resistant aspergillosis (4), an entity that has been increasingly recognized in the last decades (3). Therefore, laboratory methods for rapid and reliable detection of resistance are paramount (14). Because of the very low organism burdens of aspergilli in clinical samples, the sensitivity of culture for detection of IA is low, typically 30% or less (27). Culture-independent ultrasensitive PCR-based assays for Aspergillus spp. are more robust than culturing (27, 28). The recent development of the real-time PCR technique named the PathoNostics AsperGenius assay using the high-resolution melting (HRM) method allows the development of multiplex assays for the simultaneous detection of Aspergillus species and identification of the most common mutations in the A. fumigatus cyp51A gene conferring triazole resistance, such as TR34/L98H and TR46/Y121F/T289A (11). However, the aforementioned method lacks detection of other described mutations (G54R, G54W, and M220I) conferring resistance to triazoles.

The real-time PCR assays currently available, including the TaqMan allelic discrimination assay developed by our laboratory (8) and the allele-specific molecular beacon assay established by Balashov et al. (9, 10), lack evaluation of their sensitivity. This limits the reliability of these real-time PCR assays for identifying clinical samples. In this study, we developed a new allele-specific TaqMan real-time PCR method to identify triazole-resistant isolates of A. fumigatus carrying all of the described mutations associated with triazole resistance in China. We based our method on the widely used TaqMan real-time PCR technology. It combines allele-specific PCR with a blocking reagent (MGB oligonucleotide blocker) to suppress amplification of the wild-type cyp51A alleles (29). This technique has been widely used for the molecular diagnosis of rare subpopulations of tumor cells carrying somatic mutations (29) and HIV isolates harboring the D30N mutation (30). Thus, the 0.1% of tumors carrying KRAS mutations and 1% of HIV isolates harboring the D30N mutation are successfully identified by this method (29, 30). In this work, for the first time, we applied this approach to detect triazole-resistant A. fumigatus strains. Our PCR method reliably detected a variety of mutations associated with triazole resistance (TR34, TR46, G54R, G54W, L98H, Y121F, and M220I) and no false positive in triazole-susceptible strains of A. fumigatus in a panel of 30 clinical strains, and it only took about 6 h, which included about 2 h for DNA extraction, 3 h for allele-specific real-time PCR detection, and 1 h for data analysis. Our assay had favorable sensitivity (300 fg/well, corresponding to about 100 CFU per reaction mixture volume) for all mutations tested compared to the sensitivity of currently established PCR assays detecting triazole resistance (600 fg of A. fumigatus DNA for the TR34 mutation, 4 pg for the M220 mutation, and 300 fg for L98H mutation) (7, 31). Moreover, we interpreted the sensitivity of our allele-specific real-time PCR method by using CFU counts, which are widely used in evaluating the number of viable cells of microbes (32). This makes the method a reliable technique to identify clinical samples in the future.

In addition to the difficulties of diagnosis of triazole-resistant aspergillosis, the challenge to detection of triazole-resistant strains of A. fumigatus from mixed infections by conventional antifungal susceptibility testing is significant (6). In the case of in vitro antifungal susceptibility, testing typically relies on a single colony, which often fails to allow detection of the triazole-resistant strains in mixed cultures. Although screening all A. fumigatus colonies available or subculturing (pooled) colonies on agar supplemented with triazoles is optimal, these procedures are both cumbersome and time consuming. In addition, the aforementioned methods, including the TaqMan allelic discrimination assay (8) and allele-specific molecular beacon assay (9, 10), have not been applied to identify triazole-resistant and -susceptible strains from mixed cultures.

In this work, we conducted in vitro simulation experiments to detect the mutations in cyp51A contributing to triazole resistance in mixtures of A. fumigatus gDNA (at different ratios) from triazole-resistant strains and the triazole-susceptible Af293. We found that our allele-specific real-time PCR method developed here could detect amounts of as little as 1% of triazole-resistant strains of A. fumigatus in the mixtures of triazole-resistant and -susceptible strains, suggesting that this allele-specific real-time PCR method could have potential clinical application value in mixed Aspergillus infections, as our method is more sensitive than the PathoNostics AsperGenius assay in the detection of triazole-resistant A. fumigatus strains in mixtures of triazole-resistant and -susceptible populations (13).

However, the method described in this study has not yet been applied to clinical samples, and further studies are needed to evaluate its usefulness in clinical samples like sputum, bronchoalveolar lavage fluid, and blood samples.

In summary, we describe an ultrasensitive, allele-specific real-time PCR method that can effectively detect a broad range of triazole-resistant strains of A. fumigatus carrying TR34/L98H, TR46/Y121F/T289A, G54W, G54R, and M220I mutations in the cyp51A gene, even in the setting of a very low percentage of triazole-resistant cells mixed with triazole-susceptible A. fumigatus cells.

ACKNOWLEDGMENTS

This work was supported by the National Science and Technology Major Project for “Major Infectious Diseases Such as AIDS and Viral Hepatitis Prevention and Control Technology Major Projects” (grant 2018ZX10712-001) and “Major New Drugs Innovation and Development” (grant 2017ZX09304028009) and by the National Natural Science Foundation of China (grants 81671990 and 81861148028).

REFERENCES

  • 1.Kosmidis C, Denning DW. 2015. The clinical spectrum of pulmonary aspergillosis. Thorax 70:270–277. doi: 10.1136/thoraxjnl-2014-206291. [DOI] [PubMed] [Google Scholar]
  • 2.Patterson TF, Thompson GR III, Denning DW, Fishman JA, Hadley S, Herbrecht R, Kontoyiannis DP, Marr KA, Morrison VA, Nguyen MH, Segal BH, Steinbach WJ, Stevens DA, Walsh TJ, Wingard JR, Young JA, Bennett JE. 2016. Practice guidelines for the diagnosis and management of aspergillosis: 2016 update by the Infectious Diseases Society of America. Clin Infect Dis 63:e1–e60. doi: 10.1093/cid/ciw326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rybak JM, Fortwendel JR, Rogers PD. 2019. Emerging threat of triazole-resistant Aspergillus fumigatus. J Antimicrob Chemother 74:835–842. doi: 10.1093/jac/dky517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Verweij PE, Chowdhary A, Melchers WJ, Meis JF. 2016. Azole resistance in Aspergillus fumigatus: can we retain the clinical use of mold-active antifungal azoles? Clin Infect Dis 62:362–368. doi: 10.1093/cid/civ885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Georgiadou SP, Kontoyiannis DP. 2012. The impact of azole resistance on aspergillosis guidelines. Ann N Y Acad Sci 1272:15–22. doi: 10.1111/j.1749-6632.2012.06795.x. [DOI] [PubMed] [Google Scholar]
  • 6.Kolwijck E, van der Hoeven H, de Sevaux RG, ten Oever J, Rijstenberg LL, van der Lee HA, Zoll J, Melchers WJ, Verweij PE. 2016. Voriconazole-susceptible and voriconazole-resistant Aspergillus fumigatus coinfection. Am J Respir Crit Care Med 193:927–929. doi: 10.1164/rccm.201510-2104LE. [DOI] [PubMed] [Google Scholar]
  • 7.Spiess B, Postina P, Reinwald M, Cornely OA, Hamprecht A, Hoenigl M, Lass-Florl C, Rath PM, Steinmann J, Miethke T, Lauten M, Will S, Merker N, Hofmann WK, Buchheidt D. 2014. Incidence of Cyp51 A key mutations in Aspergillus fumigatus—a study on primary clinical samples of immunocompromised patients in the period of 1995–2013. PLoS One 9:e103113. doi: 10.1371/journal.pone.0103113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xu H, Chen W, Li L, Wan Z, Li R, Liu W. 2010. Clinical itraconazole-resistant strains of Aspergillus fumigatus, isolated serially from a lung aspergilloma patient with pulmonary tuberculosis, can be detected with real-time PCR method. Mycopathologia 169:193–199. doi: 10.1007/s11046-009-9249-x. [DOI] [PubMed] [Google Scholar]
  • 9.Balashov SV, Gardiner R, Park S, Perlin DS. 2005. Rapid, high-throughput, multiplex, real-time PCR for identification of mutations in the cyp51A gene of Aspergillus fumigatus that confer resistance to itraconazole. J Clin Microbiol 43:214–222. doi: 10.1128/JCM.43.1.214-222.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Garcia-Effron G, Dilger A, Alcazar-Fuoli L, Park S, Mellado E, Perlin DS. 2008. Rapid detection of triazole antifungal resistance in Aspergillus fumigatus. J Clin Microbiol 46:1200–1206. doi: 10.1128/JCM.02330-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.White PL, Posso RB, Barnes RA. 2015. Analytical and clinical evaluation of the PathoNostics AsperGenius assay for detection of invasive aspergillosis and resistance to azole antifungal drugs during testing of serum samples. J Clin Microbiol 53:2115–2121. doi: 10.1128/JCM.00667-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.White PL, Posso RB, Barnes RA. 2017. Analytical and clinical evaluation of the PathoNostics AsperGenius assay for detection of invasive aspergillosis and resistance to azole antifungal drugs directly from plasma samples. J Clin Microbiol 55:2356–2366. doi: 10.1128/JCM.00411-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schauwvlieghe A, Vonk AG, Buddingh EP, Hoek RAS, Dalm VA, Klaassen CHW, Rijnders B. 2017. Detection of azole-susceptible and azole-resistant Aspergillus coinfection by cyp51A PCR amplicon melting curve analysis. J Antimicrob Chemother 72:3047–3050. doi: 10.1093/jac/dkx262. [DOI] [PubMed] [Google Scholar]
  • 14.Dudakova A, Spiess B, Tangwattanachuleeporn M, Sasse C, Buchheidt D, Weig M, Groß U, Bader O. 2017. Molecular tools for the detection and deduction of azole antifungal drug resistance phenotypes in Aspergillus species. Clin Microbiol Rev 30:1065–1091. doi: 10.1128/CMR.00095-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.van der Linden JW, Arendrup MC, Warris A, Lagrou K, Pelloux H, Hauser PM, Chryssanthou E, Mellado E, Kidd SE, Tortorano AM, Dannaoui E, Gaustad P, Baddley JW, Uekotter A, Lass-Florl C, Klimko N, Moore CB, Denning DW, Pasqualotto AC, Kibbler C, Arikan-Akdagli S, Andes D, Meletiadis J, Naumiuk L, Nucci M, Melchers WJ, Verweij PE. 2015. Prospective multicenter international surveillance of azole resistance in Aspergillus fumigatus. Emerg Infect Dis 21:1041–1044. doi: 10.3201/eid2106.140717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chen J, Li H, Li R, Bu D, Wan Z. 2005. Mutations in the cyp51A gene and susceptibility to itraconazole in Aspergillus fumigatus serially isolated from a patient with lung aspergilloma. J Antimicrob Chemother 55:31–37. doi: 10.1093/jac/dkh507. [DOI] [PubMed] [Google Scholar]
  • 17.Lockhart SR, Frade JP, Etienne KA, Pfaller MA, Diekema DJ, Balajee SA. 2011. Azole resistance in Aspergillus fumigatus isolates from the ARTEMIS global surveillance study is primarily due to the TR/L98H mutation in the cyp51A gene. Antimicrob Agents Chemother 55:4465–4468. doi: 10.1128/AAC.00185-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Liu M, Zeng R, Zhang L, Li D, Lv G, Shen Y, Zheng H, Zhang Q, Zhao J, Zheng N, Liu W. 2015. Multiple cyp51A-based mechanisms identified in azole-resistant isolates of Aspergillus fumigatus from China. Antimicrob Agents Chemother 59:4321–4325. doi: 10.1128/AAC.00003-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chen Y, Lu Z, Zhao J, Zou Z, Gong Y, Qu F, Bao Z, Qiu G, Song M, Zhang Q, Liu L, Hu M, Han X, Tian S, Zhao J, Chen F, Zhang C, Sun Y, Verweij PE, Huang L, Han L. 2016. Epidemiology and molecular characterizations of azole resistance in clinical and environmental Aspergillus fumigatus isolates from China. Antimicrob Agents Chemother 60:5878–5884. doi: 10.1128/AAC.01005-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Samson RA, Visagie CM, Houbraken J, Hong SB, Hubka V, Klaassen CH, Perrone G, Seifert KA, Susca A, Tanney JB, Varga J, Kocsube S, Szigeti G, Yaguchi T, Frisvad JC. 2014. Phylogeny, identification and nomenclature of the genus Aspergillus. Stud Mycol 78:141–173. doi: 10.1016/j.simyco.2014.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Clinical and Laboratory Standards Institute. 2008. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi: approved standard, 2nd ed. CLSI document M38-A2 CLSI, Wayne, PA. [Google Scholar]
  • 22.Hope WW, Cuenca-Estrella M, Lass-Flörl C, Arendrup MC. 2013. EUCAST technical note on voriconazole and Aspergillus spp. Clin Microbiol Infect 19:E278–E280. doi: 10.1111/1469-0691.12148. [DOI] [PubMed] [Google Scholar]
  • 23.Arendrup MC, Cuenca-Estrella M, Lass-Flörl C, Hope WW. 2012. EUCAST technical note on Aspergillus and amphotericin B, itraconazole, and posaconazole. Clin Microbiol Infect 18:E248–E250. doi: 10.1111/j.1469-0691.2012.03890.x. [DOI] [PubMed] [Google Scholar]
  • 24.Ruijter JM, Ramakers C, Hoogaars WM, Karlen Y, Bakker O, van den Hoff MJ, Moorman AF. 2009. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res 37:e45. doi: 10.1093/nar/gkp045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Johnson GL, Bibby DF, Wong S, Agrawal SG, Bustin SA. 2012. A MIQE-compliant real-time PCR assay for Aspergillus detection. PLoS One 7:e40022. doi: 10.1371/journal.pone.0040022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Denning DW, Park S, Lass-Florl C, Fraczek MG, Kirwan M, Gore R, Smith J, Bueid A, Moore CB, Bowyer P, Perlin DS. 2011. High-frequency triazole resistance found in nonculturable Aspergillus fumigatus from lungs of patients with chronic fungal disease. Clin Infect Dis 52:1123–1129. doi: 10.1093/cid/cir179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhao Y, Stensvold CR, Perlin DS, Arendrup MC. 2013. Azole resistance in Aspergillus fumigatus from bronchoalveolar lavage fluid samples of patients with chronic diseases. J Antimicrob Chemother 68:1497–1504. doi: 10.1093/jac/dkt071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Morlan J, Baker J, Sinicropi D. 2009. Mutation detection by real-time PCR: a simple, robust and highly selective method. PLoS One 4:e4584. doi: 10.1371/journal.pone.0004584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Detsika MG, Chandler B, Khoo SH, Winstanley C, Cane P, Back DJ, Owen A. 2007. Detection and quantification of minority HIV isolates harbouring the D30N mutation by real-time PCR amplification. J Antimicrob Chemother 60:881–884. doi: 10.1093/jac/dkm281. [DOI] [PubMed] [Google Scholar]
  • 31.Postina P, Skladny J, Boch T, Cornely OA, Hamprecht A, Rath PM, Steinmann J, Bader O, Miethke T, Dietz A, Merker N, Hofmann WK, Buchheidt D, Spiess B. 2018. Comparison of two molecular assays for detection and characterization of Aspergillus fumigatus triazole resistance and Cyp51A mutations in clinical isolates and primary clinical samples of immunocompromised patients. Front Microbiol 9:555. doi: 10.3389/fmicb.2018.00555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Helb D, Jones M, Story E, Boehme C, Wallace E, Ho K, Kop J, Owens MR, Rodgers R, Banada P, Safi H, Blakemore R, Lan NT, Jones-Lopez EC, Levi M, Burday M, Ayakaka I, Mugerwa RD, McMillan B, Winn-Deen E, Christel L, Dailey P, Perkins MD, Persing DH, Alland D. 2010. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. J Clin Microbiol 48:229–237. doi: 10.1128/JCM.01463-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES