Abstract
Disequilibrium of hemostasis is central to the pathogenesis of all thromboses, and platelets are essential for primary hemostasis. The platelet membrane glycoprotein receptor is involved in the clot formation in blood; therefore, the changes in related genes could impair platelet aggregation in patients with sticky platelet syndrome (SPS). Patients with SPS who experienced fetal loss were shown to harbor a risk haplotype at GP6 locus. The aim of the study was to examine the genetic linkage of this selected risk haplotype with single nucleotide variations (SNVs) in the coding sequence of the GP6 gene in order to identify possible functional SNVs in association with SPS and fetal loss. A total of 37 patients with SPS manifested fetal loss, and 42 healthy controls were enrolled in the study. The SPS was diagnosed with platelet aggregometry. The SNVs were determined by dideoxy sequencing and high-resolution melting analysis. The missense variations were detected in patients with risk haplotype only. The association analysis showed association of the minor alleles with the SPS manifested by fetal loss as follows—rs1671152 (odds ratio [OR]: 4.667, 95% confidence interval [CI]: 1.462-14.89, P = .006), rs2304167 (OR: 5.085, 95% CI: 1.605-16.10, P = .003), and rs1654416 (OR: 5.085, 95% CI: 1.605-16.10, P = .003). Using the Expectation-Maximization (EM) algorithm, the estimated minor haplotype with predicted protein residue PEAN was significantly associated with the given phenotype (OR: 4.746, 95% CI: 1.486-15.15, P = .005). We have shown that haplotype PEAN associated with SPS and manifested by fetal loss and suggest that the mechanism involved in the action of GPVI has significant effect on GPVI-mediated signal transduction through Syk-phosphorylation.
Keywords: sticky platelet syndrome, fetal loss, GP6, haplotype, missense variation
Introduction
Thrombotic disorders in humans are the most common causes of morbidity and mortality. Disequilibrium of hemostasis is central to the pathogenesis of all thromboses, and platelets are essential for primary hemostasis. Using platelet aggregometry, it was demonstrated that the enhanced maximal platelet aggregation is a contributing factor for arterial and venous thromboses, naming this condition sticky platelet syndrome (SPS). The in vitro platelet aggregation after activation by adenosine diphosphate (ADP) and/or epinephrine (EPI) is characteristic for SPS type I, hyperaggregation by EPI alone defined the SPS type II, and hyperaggregation by ADP alone triggers hyperaggregation in SPS type III.1–3 The SPS has been established as a factor playing a role in the development of angina pectoris, acute myocardial infarction, transient cerebral ischemic attacks, stroke, ischemic optic neuropathy, and venous thrombosis; however not all carriers of the syndrome experience clinical symptoms.1,4 Furthermore, this syndrome has been described also in women with recurrent fetal loss without a personal history of thrombosis. Although the association between inherited thrombophilia and venous thromboembolism is well established, a definitive link between inherited thrombophilia and adverse pregnancy outcomes has not been made yet.5,6 In a report of 351 women undergoing evaluation for recurrent fetal loss, SPS was identified in 64 of them and was the most prevalent hemostatic defect.7 It was shown that SPS segregates in families, although the genetic basis underlying this syndrome was not revealed yet.8 The etiology of SPS is still unknown, but the published epidemiological data and the results from segregation studies in families sustain suggestion that the glycoprotein (GP) receptors on the platelet surface membrane could play an important role in the pathogenesis of SPS. The membrane GPs are involved in the clot formation in blood; therefore, the changes in related genes could impair platelet aggregation in SPS. It was also reported that certain mutation can modulate the risk of thromboembolism, although all studies failed to prove that a single genetic defect is responsible for SPS.9,10 In a genome-wide meta-analysis, 2.5 million single-nucleotide polymorphism (SNPs) with platelet aggregation response to 3 agonists (ADP, EPI, and collagen) were tested in 2 European ancestry cohorts and identified 7 loci with platelet aggregation, 1 among them near/in the GP6 gene.11 Several studies including those of us have found out that single nucleotide polymorphisms of certain GPs such as GPIIIa, Gas6, or GPVI are in association with SPS.10,12–14 Moreover, the certain SNPs in the GP6 gene were shown to be associated with miscarriages in patients with SPS type I or II, and haplotypes were identified, which have higher occurrence in patients with SPS experiencing fetal loss. In our previous case–control study, we were able to identify the risk haplotype “CTGAG” consisting of rs1654410, rs1669150, rs1613662, rs12610286, and rs1654431 with odds ratio (OR) comprising 3.568 in patients with SPS experiencing fetal loss.15,16
In this study, we sequenced the whole protein coding region of the GP6 gene. The aim of this study was to examine the genetic linkage of the risk haplotypes “CTGAG” reported previously 15with SNVs in the coding sequence of the GP6 gene in order to identify possible functional SNVs in association with SPS and fetal loss.
Patients and Methods
Patients
Patients with verified miscarriage (at least 1) were enrolled in the study and were referred to undergo thrombophilia screening as a part of differential diagnosis for spontaneous abortion examined at the Department of Hematology and Transfusiology. In case of confirmation of SPS according the criteria of Mammen (see below), they were asked to participate in the study. The occurrence of other thromboembolic events such as venous thromboembolisms, myocardial infarction, and cerebrovascular thrombosis was not considered as a reason for the exclusion of the patients. A total of 37 patients with SPS and 42 female healthy blood donors with negative personal and family history and normal platelet aggregability were enrolled in the study. The study was approved by the ethical committee and each participant signed the informed consent to be able take a part in the study. We screened patients for thrombophilia after exclusion of anatomical, chromosomal, and endocrinological disorders. The test for thrombophilia was done at least 6 months after miscarriage. A total number of patients with 1 to 4 spontaneous abortions were 6 (16.2%), 23 (62.16%), 7 (18.91%), and 1 (2.70%), respectively. Detailed characteristics of patients, number and times, and gestational week of abortion are summarized in the table, which is attached to the manuscript as Supplemental Table 1. In addition, we performed subgroup analysis based on the number of miscarriage. We had excluded patients with only 1 spontaneous abortion. This reduced group of patients was called “cases 6.”
Table 1.
Sequencing and HRMA Primers Designed for the Needs of Our Study.
| Annealing Temperature, °C | ||
|---|---|---|
| Sequencing primers | ||
| GP6e1_F | GAGGAAGGGAGGAGAGCATT | 62 |
| GP6e1_R | TCCTTTGTCTGGCAGTCCAT | |
| GP6e2-3_F | AGCAGGCAGGAATGTCCATA | 62 |
| GP6e2-3_R | ATGTCCCCCGTATTTGTGTC | |
| GP6e4_F | GACCTCCCCAGTCTCAGC | 66 |
| GP6e4_R | CTTATGGCCCCTCCCTTG | |
| GP6e5_F | CGGAGATGTTTCGTTATTTGTTC | 62 |
| GP6e5_R | GAGAGAGAAGGGGTCCGTGT | |
| GP6e6_F | TCTCAAAAGGGGAATGGAGA | 62 |
| GP6e6_R | AGAGAGCTCCGTCCTCACAC | |
| GP6e7_F | CGGAGTAGGCACAGTGACAG | 62 |
| GP6e7_R | GGAGTTGGCTTTGGTGAAGA | |
| GP6e8_F | CCCAGATGTGGCTTGGAG | 66 |
| GP6e8_R | GTGCCATCCTTCTGTCTTTTC | |
| HRMA primers | ||
| rs1654416 | 58 | |
| GP6_E237K_F | GAGCATGAAATGCCTGGTTA | |
| GP6_E237K_R | CGCTGAACTGACCGTCTCAT | |
| rs2304167 | 58 | |
| GP6_A249T_F | GGGTCTGGAGAGGATGACTT | |
| GP6_A249T_R | TGTTTGGTTCCCAGAGACTT | |
| rs1671152 | 58 | |
| GP6_H322N_F | CGGCTGTGAACATCCTGTC | |
| GP6_H322N_R | CCGCTGACCCGGAAATC | |
| rs1613662 | 60 | |
| GP6_P219S_F | AGGGGTCCGTGTACCTCA | |
| GP6_P219S_R | AGGACCCACAGCGACAGA | |
Abbreviation: HRMA, high-resolution melting analysis.
The aggregometry testing was performed on patients without antiplatelet therapy. The administration of acetylsalicylic acid or ADP inhibitor treatment were interrupted for more than 7 days before testing, and the use of other drugs with possible effect on platelet activity was omitted. The patients were without the occurrence of acute thromboembolic events (≥3-5 months). All 9 patients with SPS having the risk haplotype “CTGAG” and 9 participants with SPS not having the risk haplotype who experienced fetal loss estimated in a previous study15 were selected for the dideoxy sequencing.
Diagnosis of SPS by the Aggregometry by Mammen
The antecubital venous blood was collected with sodium citrate to assess the platelet aggregation, and the samples were processed and analyzed within 2 hours after sampling according to Mammen as described by us previously.15 Briefly, each sample of platelet-rich plasma was tested with 3 low concentration of ADP (2.34 mmol/L, 1.17 mmol/L, and 0.58 mmol/L) and EPI (11.00 mmol/L, 1.1 mmol/L, and 0.55 mmol/L) on the PACKS-4 aggregometer (Helena Laboratories, Beaumont, Texas, USA) and the aggregation was assessed photometrically by light transmission aggregometry. Each measurement was repeated 5 times for each sample and the concentration with an intra-assay coefficient of variation in the range of 3.6% to 4.5%. The diagnosis of SPS was confirmed by 2 measurements; the measuring intervals were at least 1 month.
DNA Extraction
Genomic DNA was extracted from peripheral blood with EDTA by SiMax Genomic DNA Extraction kit (SBS Genetech Co, Ltd, Beijing, China) according the manufacturer’s instructions. The concentration was estimated by spectrophotometry at 260 nm, adjusted to 30 µg/mL and stored at −20°C for following analysis.
Assessment of the CTGAG Haplotype
The CTGAG haplotype was determined using 5-tagged SNPs (rs1654410, rs1669150, rs1613662, rs12610286, and rs1654431), which were selected by the algorithm implemented in Haploview 4.2 and tested as described by us previously.15
Dideoxy Sequencing
The primers used for dideoxy sequencing, designed from GenBank sequence NM_001083899.2 and annealing temperatures are showed in Table 1. Because of the size of the intron 2, only 1 pair of primers for the sequencing of the exons 2 and 3 was designed. The sequencing of the 1634 base pair (bp) fragment embracing the noncoding part of the exon 8 was not done. The polymerase chain reaction (PCR) for sequencing was performed with 100 ng extracted DNA in a final volume of 20 µL using FastStart Taq polymerase (F. Hoffmann-La Roche Ltd, Basel, Switzerland) with 1.5 mM Mg2+ concentration. The PCR conditions were 10 minutes for 95°C and 30 cycles at 95°C for 30 seconds, appropriate annealing temperature for 30 seconds and at 72°C for 30 seconds. The PCR products were purified with NucleoSpin Extract II kit (Machery-Nagel GmbH & Co. KG, Düren, Germany) and the sequencing reaction was performed using the BigDye Terminator kit v1.1 (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) at 95°C for 2 minutes and 35 times at 95°C for 15 seconds and at 60°C for 4 minutes. The fragments were run on AB 3500 and subsequently evaluated with DNA Sequencing Analysis Software v5.4 (Applied Biosystems, Foster City, Kalifornia, USA).
High-Resolution Melting Analysis
High-resolution melting analysis was performed in 15 µL reaction with primers designed from GenBank sequence NT_011109.16 as shown in Table 1 using 7.5 µL LighCycler 480 High Resolution Melting Master (F. Hoffmann-La Roche Ltd, Basel, Switzerland), 3 mM final concentration of Mg2+ and 0.25 µM of each forward and reverse primer, and 15 ng of template DNA. The annealing temperature is 58°C with the exception of rs1613662 whose annealing temperature was 60°C. There were amplified fragments with the sizes 45 bp (rs1613662), 56 bp (rs1654416), 91 bp (rs2304167), and 59 bp (rs1671152).
Statistical Evaluation
Association analysis was done using SNP and Variation Suite version 8.4 (Golden Helix, Inc, Bozeman, Montana; www.goldenhelix.com); Fisher exact test was selected for allele associations and χ2 test for haplotype associations. Omega ClustalW2, bioinformatics services on EMBL-EBI Web site17 was used for the purpose of multiple sequence alignment of sequenced data. The pathogenicity of amino acid changes was determined by 2 computation programs, SIFT and Polyphen2. Variants were considered to be pathogenic if they were predicted as “damaging” by both of these prediction tools.
Results
Patients
Thirty-seven patients with SPS and fetal loss and 42 female healthy control participants had an average age of 37.9 ± 5.2 and 42.2 ± 13.0 years, respectively. Eight (21.6%) patients were confirmed as SPS type I, 28 (75.7%) patients had SPS type II, and 1 (2.7%) was diagnosed as SPS type III, according to Mammen criteria.
SNPs in the Coding Region of GP6
The sequencing of the coding region of GP6 of 18 patients with SPS experiencing fetal loss (9 patients with the risk haplotype CTGAG and 9 patients without its presence) identified heterozygous or homozygous conditions in case of 7 common SNPs within the first 7 coding exons already present in NCBI database of Single Nucleotide Polymorphisms of the National Center for Biotechnology (dbSNP) (build 139). Four of them were synonymous variations, all in exon 4 (rs892090, rs892089, rs5030705, and rs1654425), 3 were nonsynonymous (NS) missense variations in exons 5 (rs1613662), 6 (rs1654416), and 7 (rs2304167), and the SNP rs2288905 was found in intron 2 (Table 2).
Table 2.
Results of Exon Sequencing of the GP6 Gene in 18 Patients With SPS and Fetal Loss.a
| No | H5 | rs2288905 | rs892090 | rs892089 | rs5030705 | rs1654425 | rs1613662 | rs1654416 | rs2304167 |
|---|---|---|---|---|---|---|---|---|---|
| c.67+40G>A | c.484A>C | c.495T>C | c.507G>A | c.576A>G | P219S | E237K | A249T | ||
| 55032466 | 55027704 | 55027693 | 55027681 | 55027612 | 55025227 | 55018667 | 55015713 | ||
| 1 | Absent | g_g | c_c | c_c | g_g | g_g | S_S | K_K | T_T |
| 2 | Present | g_g | c_a | c_t | g_g | g_a | S_P | K_E | T_A |
| 3 | Absent | g_a | c_c | c_c | g_g | g_g | S_S | K_K | T_T |
| 4 | Absent | g_g | c_c | c_c | g_a | g_g | S_S | K_K | T_T |
| 5 | Absent | g_g | c_c | c_c | g_a | g_g | S_S | K_K | T_T |
| 6 | Absent | g_g | c_c | c_c | g_a | g_g | S_S | K_K | T_T |
| 7 | Present | g_a | c_a | c_t | g_g | g_a | S_P | K_E | T_A |
| 8 | Present | g_g | c_a | c_t | g_a | g_a | S_P | K_E | T_A |
| 9 | Absent | g_a | c_c | c_c | g_a | g_g | S_S | K_K | T_T |
| 10 | Absent | g_g | c_c | c_c | g_a | g_g | S_S | K_K | T_T |
| 11 | Absent | g_g | c_c | c_c | a_a | g_g | S_S | K_K | T_T |
| 12 | Present | g_g | c_c | c_c | g_g | g_g | S_P | K_E | T_A |
| 13 | Absent | g_g | c_c | c_c | g_a | g_g | S_S | K_K | T_T |
| 14 | Present | g_g | c_a | c_t | g_a | g_a | S_P | K_E | T_A |
| 15 | Present | g_a | c_c | t_t | g_g | g_g | S_P | E_E | A_A |
| 16 | Present | g_g | a_a | t_t | g_g | a_a | P_P | E_E | A_A |
| 17 | Present | g_a | c_c | c_c | g_g | g_g | S_P | K_E | T_A |
| 18 | Present | g_g | c_a | c_t | g_g | g_a | S_P | K_E | T_A |
Abbreviations: H5, CTGAG risk haplotype; SPS, sticky platelet syndrome.
aHeads of columns contain rs numbers, Human Genome Variation Society (HGVS) names, and chromosomal positions of revealed SNPs.
Association of the Nonsynonymous Variations With SPS Accompanied by Fetal Loss
To the 3 above-mentioned NS variations, we have included an additional common SNP rs1671152 from exon 8 of the GP6 gene. All SNPs are tested for the deviation from Hardy-Weinberg equilibrium with no significant findings (P > .05), and all SNPs are in linkage disequilibrium with r 2 ranging from 0.832 to 1 (Figure 1). In total, correlations are rs2304167 and rs1654416. We have tested distribution of alleles between women with fetal loss along with SPS (37), and healthy control women (42) using Fisher exact test and have observed statistically significant results without and with Bonferroni correction. The minor allele ORs range from 3.033 to 5.085 for all 4 SNPs (Table 3). Two SNPs, rs1654416 and rs2304167, have the highest OR about 5.085 (95% confidence interval [CI]: 1.605-16.10) with P = .003 and after Bonferroni correction P = .013. Therefore, having minor allele and SPS there is about 5 times higher risk to fetal loss event for women. The minor alleles of rs2304167 cause the amino acid substitution of polar threonine to nonpolar alanine (amino acid position 249) with as “deleterious—low confidence” considered SIFT score of 0.01; however, the PolyPhen2 score comprises 0.093, which is the highest of all NS variations and considered as “benign.” However, rs1671152 minor allele shows OR: 4.667 (95% CI: 1.462-14.89) with the P value of .006 (after Bonferroni correction: 0.024). The lowest association has been shown by rs1613662 (OR: 3.033, 95% CI: 1.100-8.360, and P = .032; after Bonferroni correction, P = .127).
Figure 1.
linkage disequilibrium (LD) map of 4 nonsynonymous SNPs of the GP6 gene.
Table 3.
Results of Allele Association Analysis of 4 Nonsynonymous SNPs of the GP6 Gene.
| SNP | Minor Allele | Cases (37) | Controls (42) | OR | CI 95% | P (Fisher) | P (Bonferroni) |
|---|---|---|---|---|---|---|---|
| Cases-6 (31) | |||||||
| rs1613662 | P | 0.189 | 0.071 | 3.033 | 1.100-8.360 | .032 | .127 |
| Cases-6 | 0.161 | 2.500 | 0.856-7.297 | .110 | .438 | ||
| rs1654416 | E | 0.203 | 0.048 | 5.085 | 1.605-16.10 | .003 | .013 |
| Cases-6 | 0.177 | 4.314 | 1.303-14.28 | .013 | .054 | ||
| rs2304167 | A | 0.203 | 0.048 | 5.085 | 1.605-16.10 | .003 | .013 |
| Cases-6 | 0.177 | 4.314 | 1.303-14.28 | .013 | .054 | ||
| rs1671152 | N | 0.189 | 0.048 | 4.667 | 1.462-14.89 | .006 | .024 |
| Cases-6 | 0.161 | 3.846 | 1.146-12.91 | .025 | .102 |
Abbreviations: CI, confidence interval; OR, odds ratio.
Note. The p-values are bold where they are less than or equal to the significance level cut-off of 0.05.
Association Between NS Variations and Risk Haplotype
The NS variations are associated with the risk haplotypes as shown in Table 4. Almost the whole group without risk haplotype (24 from 25) and none from the sequenced group with risk haplotype have a major homozygous genotype for all 4 NS variations. All patients harboring the risk haplotypes (12 cases) are carriers of minor allele for all 4 NS SNPs. This finding was confirmed by the testing of 42 healthy control participants with known-risk haplotypes for genotypes on the loci of NS variants. For rs1654416, rs2304167, and rs1671152, all 37 women without risk haplotype and 1 from 5 risk haplotype carriers harbor a major homozygous genotype for all 3 NS variations. For rs1613662, all 5 women with risk haplotype are heterozygotes. One healthy women without risk haplotype is heterozygote for rs1613662 too. Using the EM algorithm, the estimated minor haplotype with predicted protein residues PEAN (rs1613662, rs1654416, rs2304167, rs1671152) was significantly associated with the given phenotype of SPS accompanied by fetal loss (OR: 4.74, 95% CI: 1.486-15.15; Table 5). After exclusion of patients with 1 abortion, the PEAN haplotype is still significantly associated with the fetal loss (OR: 3.922, 95%CI: 1.168-13.17; Table 5).
Table 4.
Association of Minor Alleles of the NS SNPs With Risk Haplotype GP6 Gene.a
| rs1613662 Pb | rs1654416 Eb | rs2304167 Ab | rs1671152 Nb | |||||
|---|---|---|---|---|---|---|---|---|
| H5 Absent | H5 Present | H5 Absent | H5 Present | H5 Absent | H5 Present | H5 Absent | H5 Present | |
| Fetal loss with SPS | ||||||||
| Minor allele absent | 24(21) | – | 24(21) | – | 24(21) | – | 24(21) | – |
| Minor allele present | 1(1) | 12(9) | 1(1) | 12(9) | 1(1) | 12(9) | 1(1) | 12(9) |
| Healthy | ||||||||
| Minor allele absent | 36 | – | 37 | 1 | 37 | 1 | 37 | 1 |
| Minor allele present | 1 | 5 | – | 4 | – | 4 | – | 4 |
Abbreviations: H5, CTGAG risk haplotype; NS, nonsynonymous; SPS, sticky platelet syndrome.
aNumbers in parentheses denote reduced size of the patients group.
bMinor allele mark of specified SNPs.
Table 5.
Results of NS Haplotype Association Analysis.a
| NS Haplotype | Cases (37) | Controls (42) | P | χ2 | OR | 95% CI |
|---|---|---|---|---|---|---|
| Cases-6 (31) | ||||||
| SKTH | 0.797 | 0.929 | .024 | 5.089 | 0.324 | 0.117-0.893 |
| Cases-6 | 0.823 | .079 | 3.080 | 0.392 | 0.134-1.146 | |
| PEAN | 0.189 | 0.048 | .005 | 7.997 | 4.746 | 1.486-15.15 |
| Cases-6 | 0.161 | .019 | 5.481 | 3.922 | 1.168-13.17 | |
| PKTH | 0.000 | 0.024 | .185 | 1.761 | – | – |
| Cases-6 | 0.000 | .225 | 1.473 | – | – |
Abbreviations: CI, confidence interval; NS, nonsynonymous; OR, odds ratio.
aOrder of NS SNPs in haplotypes: rs1613662, rs1654416, rs2304167, rs1671152.
Note. The bold values represent significant associations at p-value cut-off level less than or equal to 0.05.
Discussion
The GPVI is a platelet membrane GP, which is receptor for collagen and convulxin, and is important in collagen-induced platelet aggregation. Increased attention was devoted to the genetic association analysis of GPVI with SPS. Some reports have identified the prevalence of selected GP6 SNPs as independent risk factors for deep vein thrombosis (DVT) in patient with platelet hyperaggregability.14 Sokol et al15 has found that some haplotypes of GP6 such as CTGAG represent a risk factor in patients with SPS and fetal loss. Our report presents a pilot study regarding the analysis of NS changes in the coding region of the GP6 gene in association with SPS and fetal loss. We have shown that haplotype PEAN is associated with this condition (OR: 4.746 (95% CI: 1.486-15.15, P = .005).This finding extends the previously described association of SPS and fetal loss with 2 GP6 risk haplotypes CTGAG and CGATAG.15
Different mechanisms can be considered for the impairment of platelet function. Within the coding region of GP6, some pathogenic mutations leading to the platelet-type bleeding disorder type 11 (BDPLT11) are reported, resulting in defective binding to collagen.18,19 It was reported that these mutations resulted in decreased collagen-induced activation and aggregation of platelets in vitro mostly presented as incomplete deficiency of GPVI. Although an understanding of the rare disorders of platelet aggregation has emerged, the role of common genetic variations contributing to platelet aggregation is less known. However, some SNPs were found to be associated with thrombophilic conditions.14,20 In this study, we identified 4 NS variants within the coding region of the GP6 gene, which were significantly associated with the SPS phenotype accompanied by fetal loss. The authors and others showed independently that these variants are in linkage disequilibrium and create minor haplotypes at the protein level with protein residues PEAN (in successive order—rs1613662, rs1654416, rs2304167, and rs1671152), which was determined in this study, and PEALN (rs1613662, rs1654416, rs2304167, rs1654413, and rs1671152) as determined in a previous study.21 Using tools for annotation of coding NS SNPs, we found out that rs2304167 minor allele causes the amino acid substitution of polar threonine to nonpolar alanine (p. T249A) with as damaging considered SIFT score 0.01; however, the PolyPhen2 score comprises 0.093 assumed as benign. Three of these variants (rs1613662, rs1654416, and rs2304167) are localized in the extracellular topological protein domain, which is not involved in the interaction of GPVI with collagens or convulxin.22 In a functional study, PEALN haplotype revealed a significant difference in membrane expression of GPVI;21 however, a subsequent study has shown that this accounts for no more than 16% of the difference in expression level of GPVI.23 Transfection experiments were performed to evaluate molecular basis for qualitative differences in the function of these GPVI isoforms. The cytoplasmic variation in the codon 322 (rs1671152) causing missense substitution N322H was used in transfection experiments with the GPVI isoform carrying the haplotype PEALN. It was demonstrated that although L317 increases binding to calmodulin, N322 attenuates binding to Fyn/Lyn, resulting in the significant decrease in the tyrosine phosphorylation of Syk.24 This findings argue that the PEALN haplotype has a significant effect on GPVI-mediated signal transduction, which could be true for the PEAN haplotype as well. Particularly, the L317 can be responsible for increased binding to calmodulin, which is suggested to be responsible for decreased production of soluble GPVI.24 Because soluble GPVI has been shown in some cases to be an efficient inhibitor of thrombus formation in vitro and in vivo,25 this could be one of the explanations for the association of this allele with increased risk for thrombosis.26 On the contrary, the interaction of Fyn and Lyn with the proline-rich region of the GPVI is critical for maximal signaling by GPVI,27 and N322 results in decreased Syk phosphorylation. It is known that Syk inhibition can improve responses to vascular injury without affecting hemostasis. Specifically, lack of Syk attenuated shear-induced thrombus formation, which makes it an appropriate target for the therapy.28 Hypercoagulable state is associated with physiological pregnancy; however, genetic factors are considered to increase the severity of this condition. Therefore, the role of the decreased GPVI signaling in thrombosis caused by genotype and haplotype differences needs to be assessed in the subsequent studies on larger cohorts. Moreover, functional studies of ligands and pathways of GPVI, which are going to analyze different isoforms, have to be performed. Additionally, as mentioned above, some GP6 SNPs were associated with DVT in patients with SPS. Therefore, it needs to be evaluated if the general population of patients with DVT shows the association with the PEAN haplotype, or if this association is linked to the limited patient population with SPS.
Supplementary Material
Footnotes
Declaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by project BioMed Martin (ITMS 26220220187), which was cofinanced from EU sources, APVV 0-222-11 and VEGA 1/0102/15.
Supplemental Material: Supplementary material for this article is available online.
References
- 1. Mammen EF. Ten years’ experience with the “sticky platelet syndrome”. Clin Appl Thromb Hemost. 1995;1(1):66–72. [Google Scholar]
- 2. Bick RL. Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis. Clin Appl Thromb Hemost. 1998;4(2):77–81. [Google Scholar]
- 3. Kubisz P, Stasko J, Holly P. Sticky platelet syndrome. Semin Thromb Hemost. 2013;39(6):674–683. [DOI] [PubMed] [Google Scholar]
- 4. Gehoff A, Kluge JG, Gehoff P, et al. Recurrent strokes under anticoagulation therapy: sticky platelet syndrome combined with a patent foramen ovale. J Cardiovasc Dis Res. 2011;2(1):68–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Bick RL. Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: prevalence, treatment and outcome results. DRW Metroplex Recurrent Miscarriage Syndrome Cooperative Group. Clin Appl Thromb Hemost. 2000;6(3):115–125. [DOI] [PubMed] [Google Scholar]
- 6. Practice bulletin no. 113: inherited thrombophilias in pregnancy. Obstet Gynecol. 2010;116(1):212–222. [DOI] [PubMed] [Google Scholar]
- 7. Bick RL, Hoppensteadt D. Recurrent miscarriage syndrome and infertility due to blood coagulation protein/platelet defects: a review and update. Clin Appl Thromb Hemost. 2005;11(1):1–13. [DOI] [PubMed] [Google Scholar]
- 8. Šimonová R, Bartosová L, Chudy P, et al. Nine kindreds of familial sticky platelet syndrome phenotype. Clin Appl Thromb Hemost. 2013;19(4):395–401. [DOI] [PubMed] [Google Scholar]
- 9. Jandrot-Perrus M, Busfield S, Lagrue AH, et al. Cloning, characterization, and functional studies of human and mouse glycoprotein VI: a platelet-specific collagen receptor from the immunoglobulin superfamily. Blood. 2000;96(5):1798–1807. [PubMed] [Google Scholar]
- 10. Muñoz X, Sumoy L, Ramírez-Lorca R, Villar J, de Frutos PG, Sala N. Human vitamin K-dependent GAS6: gene structure, allelic variation, and association with stroke. Hum Mutat. 2004;23(5):506–512. [DOI] [PubMed] [Google Scholar]
- 11. Johnson AD, Yanek LR, Chen MH, et al. Genome-wide meta-analyses identifies seven loci associated with platelet aggregation in response to agonists. Nat Genet. 2010;42(7):608–613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kubisz P, Ivankova J, Holly P, Stasko JN, Musiał J. The glycoprotein IIIa PL(A1/A2) polymorphism—a defect responsible for the sticky platelet syndrome? Clin Appl Thromb Hemost. 2006;12(1):117–119. [DOI] [PubMed] [Google Scholar]
- 13. Kubisz P, Bartosová L, Ivanková J, et al. Is Gas6 protein associated with sticky platelet syndrome? Clin Appl Thromb Hemost. 2010;16(6):701–704. [DOI] [PubMed] [Google Scholar]
- 14. Kotuličová D, Chudý P, Škereňová M, et al. Variability of GP6 gene in patients with sticky platelet syndrome and deep venous thrombosis and/or pulmonary embolism. Blood Coagul Fibrinolysis. 2012;23:543–547. [DOI] [PubMed] [Google Scholar]
- 15. Sokol J, Biringer K, Skerenova M, et al. Platelet aggregation abnormalities in patients with fetal losses: the GP6 gene polymorphism. Fertil Steril. 2012;98(5):1170–1174. [DOI] [PubMed] [Google Scholar]
- 16. Sokol J, Skerenova M, Biringer K, Lasabova Z, Stasko J, Kubisz P. Genetic variations of the GP6 regulatory region in patients with sticky platelet syndrome and miscarriage. Expert Rev Hematol. 2015;8(6):863–868. [DOI] [PubMed] [Google Scholar]
- 17. Larkin MA, Blackshields G, Brown NP, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947–2948. [DOI] [PubMed] [Google Scholar]
- 18. Dumont B, Lasne D, Rothschild C, et al. Absence of collagen-induced platelet activation caused by compound heterozygous GPVI mutations. Blood. 2009;114(9):1900–1903. [DOI] [PubMed] [Google Scholar]
- 19. Hermans C, Wittevrongel C, Thys C, Smethurst PA, Van Geet C, Freson K. A compound heterozygous mutation in glycoprotein VI in a patient with a bleeding disorder. J Thromb Haemost. 2009;7(8):1356–1363. [DOI] [PubMed] [Google Scholar]
- 20. Bezemer ID, Bare LA, Doggen CJ, et al. Gene variants associated with deep vein thrombosis. JAMA. 2008;299(11):1306–1314. [DOI] [PubMed] [Google Scholar]
- 21. Joutsi-Korhonen L, Smethurst PA, Rankin A, et al. The low-frequency allele of the platelet collagen signaling receptor glycoprotein VI is associated with reduced functional responses and expression. Blood. 2003;101(11):4372–4379. [DOI] [PubMed] [Google Scholar]
- 22. Lecut C, Arocas V, Ulrichts H, et al. Identification of residues within human glycoprotein VI involved in the binding to collagen: evidence for the existence of distinct binding sites. J Biol Chem. 2004;279(50):52293–52299. [DOI] [PubMed] [Google Scholar]
- 23. Jones CI, Garner SF, Angenent W, et al. ; Bloodomics Consortium. Mapping the platelet profile for functional genomic studies and demonstration of the effect size of the GP6 locus. J Thromb Haemost. 2007;5(8):1756–1765. [DOI] [PubMed] [Google Scholar]
- 24. Trifiro E, Williams SA, Cheli Y, et al. The low-frequency isoform of platelet glycoprotein VIb attenuates ligand-mediated signal transduction but not receptor expression or ligand binding. Blood. 2009;114(9):1893–1899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Massberg S, Konrad I, Bültmann A, et al. Soluble glycoprotein VI dimer inhibits platelet adhesion and aggregation to the injured vessel wall in vivo. FASEB J. 2004;18(2):397–399. [DOI] [PubMed] [Google Scholar]
- 26. Ollikainen E, Mikkelsson J, Perola M, Penttilä A, Karhunen PJ. Platelet membrane collagen receptor glycoprotein VI polymorphism is associated with coronary thrombosis and fatal myocardial infarction in middle-aged men. Atherosclerosis. 2004;176(1):95–99. [DOI] [PubMed] [Google Scholar]
- 27. Suzuki-Inoue K, Tulasne D, Shen Y, et al. Association of Fyn and Lyn with the proline-rich domain of glycoprotein VI regulates intracellular signaling. J Biol Chem. 2002;277(24):21561–21566. [DOI] [PubMed] [Google Scholar]
- 28. Andre P, Morooka T, Sim D, et al. Critical role for Syk in responses to vascular injury. Blood. 2011;118(18):5000–5010. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.