Skip to main content
PeerJ logoLink to PeerJ
. 2019 Aug 26;7:e7541. doi: 10.7717/peerj.7541

Three new species, one new genus and subfamily of Dorylaimida (de Man, 1876) Pearse, 1942, and revisions on the families Tylencholaimellidae Jairajpuri, 1964 and Mydonomidae Thorne, 1964 (Nematoda: Dorylaimida)

Wen-Jia Wu 1,2, Chun-Ling Xu 1, Hui Xie 1,, Dong-Wei Wang 1
Editor: Jean-Lou Justine
PMCID: PMC6714964  PMID: 31523507

Abstract

Three new species of the order Dorylaimida (de Man, 1876) Pearse, 1942 were identified and described. Paratylencholaimus sanshaensis gen. nov. sp. nov. from Hainan is proposed as a new member of the family Tylencholaimellidae Jairajpuri, 1964. Paratylencholaimus gen. nov. is close to Phellonema Thorne, 1964 and Goferus Jairajpuri & Ahmad, 1992 but can be differentiated mainly by having basal part of odontophore rod-like and without knobs, and basal part of pharynx expanded gradually. Tylencholaimus zhongshanensis sp. nov. from Guangdong and Dorylaimoides shapotouensis sp. nov. from the Ningxia Hui Autonomous Region are also described herein. Phylogenetic analyses based on the 18S rDNA and the D2–D3 region of the 28S rDNA support that the three new species are valid. The classifications of the families Tylencholaimellidae and Mydonomidae Thorne, 1964 are revised mainly based on the analysis of the morphology of odontostyle and odontophore. After these revisions, Paratylencholaiminae subfam. nov. including Paratylencholaimus gen. nov. and Goferus is proposed. Athernema and Agmodorus of Tylencholaimellidae are transferred into Mydonomidae, and the subfamily Athernematinae of Tylencholaimellidae is dismissed. The main characteristics of the family Mydonomidae and Tylencholaimellidae are revised. Keys to the genera of Mydomonidae and Tylencholaimellidae are included.

Keywords: Paratylencholaimus sanshaensis gen. nov. sp. nov., Tylencholaimus zhongshanensis sp. nov., Dorylaimoides shapotouensis sp. nov., Paratylencholaiminae n. subfam., Key, Phylogenetic analysis, Revisions, Tylencholaimelliae, Mydonomidae

Introduction

In the classification proposed by Andrássy (2009), which is based on the classification created by Peña Santiago (2006), the superfamily Tylencholaimoidea contains a wide range of genera and species and includes six families: Leptonchidae Thorne, 1935, Tylencholaimidae Filipjev, 1934, Mydonomidae Thorne, 1964, Tylencholaimellidae Jairajpuri, 1964, Aulolaimoididae Jairajpuri, 1964 and Encholaimidae Golden & Murphy, 1967. Tylencholaimoidea can be differentiated from other superfamilies of Dorylaimida (de Man, 1876) Pearse, 1942 mainly by having tylencholaimoid or dorylaimoid cuticle, cap-like lip region, markedly short basal expansion of the pharynx, common occurrence of both pro- and opisthodelphy, and few male supplements. However, Andrássy (2009) stated that this classification of Tylencholaimoidea should be artificial as the species of this superfamily can ‘hardly represent a homogeneous trend in the evolution of this group’. Peña Santiago (2014) again stressed that the superfamilies classification of the suborder Dorylaimina Pearse, 1936 is not supported by morphology or molecular analyses (Holterman et al., 2008). Peña Santiago (2014) canceled the superfamilies of Dorylaimina and kept the families, and moved Encholaimidae under Nordiidae.

During nematode investigations in China, three new species of Dorylaimina were identified. One from Guangdong belongs to the genus Tylencholaimus de Man, 1876 (Tylencholaimidae), and the second one from the Ningxia Hui Autonomous Region is a new member of the genus Dorylaimoides Thorne & Swanger, 1936 (Mydonomidae). These species are herein described as Tylencholaimus zhongshanensis sp. nov. and Dorylaimoides shapotouensis sp. nov. The third one from Hainan is interesting. It equips with dorylaimoid cuticle that is different from Tylencholaimidae (equips with tylencholaimoid cuticle), but other characteristics are highly similar to those of Tylencholaimidae. And later, three more populations of this species from Guangdong were collected. With further examinations, this species was suggested to be a member of a new genus of the family Tylencholaimellidae, herein described as Paratylencholaimus sanshaensis gen. nov. sp. nov. Detailed descriptions based on microscopy and phylogenetic analysis based on the 18S rDNA and the D2–D3 region of the 28S rDNA of the three new species were presented. In addition, the classification of Tylencholaimellidae and Mydonomidae was discussed, one new subfamily of Tylencholaimellidae was proposed, and keys to the genera of the revised Tylencholaimellidae and Mydonomidae were provided.

Materials & Methods

Morphology and morphometrics

Soil samples were collected from the rhizosphere soil of some plants from Hainan, Guangdong and Ningxia, respectively. Nematode populations were extracted from samples using the modified Baermann funnel method (Whitehead & Hemming, 1965). Then, specimens were gently killed at 62 °C for 3 min, fixed in 4% FG fixative, dehydrated using the glycerol-ethanol method and then mounted on permanent slides for further examination (Xie, 2005). The specimens were observed, measured and photographed as described by Wu et al. (2017). Locations of the pharyngeal gland nuclei were measured as described previously (Andrássy, 1998). Measurements are given as mean (minimum-maximum) with SD indicated when n > 30. Nematodes were prepared for SEM observations as described by Abolafia & Peña Santiago (2005) and observed with a FEI XL-30-ESEM electron microscope at 10 KV.

DNA extraction, amplification and sequencing

A single nematode was placed into 10 µL mixed solution (distilled water: 2 ×buffer for KOD FX = 1:1) and cut using a sterilized needle. The genomic DNA was extracted by adding 1 µL 20 µg/mL proteinase K and then reacting at 65 °C for 1 h and 95 °C for 15 min. PCR reaction systems were performed in a 10 µL reaction mixture containing 5 µL of 2 ×buffer for KOD FX, 0.3 µL of each primer (10 µM), 2 µL of dNTPs (200 µM), 1 µL of DNA, 1.2 µL of distilled water and 0.2 µL of KOD FX (1 U/µL). Two overlapping fragments of the 18S rDNA were amplified using primer set 988F (5′–CTCAAAGATTAAGCCATGC–3′) and 1912R (5′–TTTACGGTCAGAACTAGGG–3′) for the first fragment, and 1813F (5′–CTGCGTGAGAGGTGAAAT–3′) and 2646R (5′–GCTACCTTGTTACGACTTTT–3′) for the second fragment (Holterman et al., 2006; Nedelchev et al., 2014). For the amplification of D2–D3 region of the 28S rDNA, the primer set D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (De Ley et al., 1999) were used. The PCR reactions were performed as described previously (Wu et al., 2017). The newly obtained sequences of the new species were deposited in GenBank.

Phylogenetic analysis

The sequences of the three new species were respectively compared with sequences in GenBank using BLAST. Sequences of species of Tylencholaimidae, Leptonchidae, Mydonomidae, Tylencholaimellidae, Mononchida Jairajpuri, 1969 and Nygolaimina Ahmad & Jairajpuri, 1979 were aligned along with the sequences of the three new species. The sequence alignments were performed, and conservative regions were selected using MEGA v6. For the Bayesian inference (BI) analysis, the substitution saturation was tested by DAMBE. The best-fit models were selected by AIC (Akaike Information Criterion) in MrModeltest v2.3. Bayesian trees were constructed by using MrBayes v3.1.2 running the chain for 1,000,000 generations with a sample frequency of 1,000 generations, and setting the ‘burnin’ at 2500. The topologies were used to generate a 50% majority rule consensus tree. Posterior probabilities (PP) were given for appropriate clades.

Nomenclatural acts

The electronic version of this article in Portable Document Format (PDF) will represent a published work according to the International Commission on Zoological Nomenclature (ICZN), and hence the new names contained in the electronic version are effectively published under that Code from the electronic edition alone. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix http://zoobank.org/. The LSID for this publication is: urn:lsid:zoobank.org:pub:427B5E52-23B0-4474-B179-4FA9FC5E7C9C. The online version of this work is archived and available from the following digital repositories: PeerJ, PubMed Central and CLOCKSS.

Results

Tylencholaimus zhongshanensissp. nov.
urn:lsid:zoobank.org:act:AFB00C8F-918E-422C-ABB6-71F4DFBCA3D5
Figs. 13; Table 1

Figure 1. Ink drawing of Tylencholaimus zhongshanensis sp. nov.

Figure 1

Female: (A, B) Entire body. (C) Amphidial fovea. (D) Anterior region. (E, F) Vulvas in lateral view. (G) Posterior region. (H) Pharynx. (I) Genital system (a: Boundary between the oviduct and uterus). Holotype: C. Paratypes: A, B, D–I.

Figure 3. Scanning electron micrographs of Tylencholaimus zhongshanensis sp. nov.

Figure 3

Female: (A, B) Lip region and amphid. (C) Posterior region. (D) Vulva. Scale bars: A, B = 5 µm; C, D = 10 µm. Paratypes: A–D.

Table 1. Morphometrics of Tylencholaimus zhongshanensis sp. nov.

Character Female
Holotype Paratypes
n 9
L 600.5 550 (472.5–604.5)
a 26.8 26.4 (25.3–27.1)
b 3.9 3.6 (3.2–3.9)
c 29.0 29.6 (26.2–33.3)
c′ 1.3 1.2 (1.1–1.4)
V 68.6 69.8 (68.8–71.3)
Lip region diam. 7 7 (6–7)
Lip region height 3 3 (2.6–2.9)
Amphid aperture 2 2.0 (1.9–2.3)
Odontostyle length 5 6 (5–6)
Odontophore length 7 6.0 (5–7)
Guiding ring from anterior end 4 4 ± 0.3 (4–5)
Nerve ring from anterior end 65 66 (62.5–70)
Pharyngeal length 153 152 (147–157)
Expanded part of pharynx 58 54 (49–57)
Cardia length 8 9 (6.5–11)
Body diameter at neck base 22 20 (18–23)
Body diameter at mid-body 22 21 (17–24)
Body diameter at anus 16 15 (12–17)
Anterior genital branch 133 106 (81–156)
Posterior genital branch
Vagina length 11 11.0 (10–12)
Vulva from anterior end 412 384.0 (333–417)
Prerectum length 73 62 (42–80)
Rectum length 11.5 11 (9–14)
Tail length 21 19 (16–21)

Notes.

All measurements are in m (except for ‘L in mm) and shown in the form: mean (minimum- maximum).

n
number of specimens observed
L
body length
a
L/ maximum width
b
L/ pharyngeal L
c
L/ tail length
c′
tail length/ body diameter at anus
V
distance of vulva from anterior end × 100/L
G1
anterior uterine sac × 100/L
G2
posterior genital branch × 100/L

Description

Female. Measurements are listed in Table 1. Body largely cylindrical, habitus straight to ventrally curved after fixation. Cuticle two layers, 0.6–1.1 µm thick in anterior region, 1.0–1.4 µm at mid-body, and 2.1–3.0 µm on tail; outer layer with fine transverse striations, the inner one loose and shrink after fixation. Lateral chord occupying 30% in average of the body diameter at mid-body, lateral pores indistinct. Lip region cap shaped, offset from the body by a constriction, 2.3–2.8 times as wide as high or 30–38% of the body diameter at posterior end of the neck region. Lips amalgamated, labial and cephalic papillae distinct. Amphidial foveae cup shaped, opening at the level of the constriction, apertures narrow, 30% in average of the lip region width. Odontostyle slender, 0.7–0.9 times the lip region width long, its aperture one-fourth to one-third of its length. Odontophore rod-like with small basal knobs, 0.8–1.3 times as long as the odontostyle. Guiding ring single, indistinct. Nerve ring situated at 41–45% of the pharyngeal length. Anterior part of pharynx slender, basal expansion occupying 33–38% of the total pharyngeal length. Pharyngeal gland nuclei located as follows: D = 68–74%, AS1 = 41–45%, AS2 = 40–50%, PS1 = 66–80%, PS2 = 72–83%. Cardia conoid to rounded. Genital system prodelphic, postvulval sac completely absent. Ovary 30–124.5 µm long. Oviduct slender, 58–95 µm long. Junction of oviduct and uterus indistinct. Uterus simple and slender, 24–44 µm long. Sperm not observed in the genital system. Vulva transverse in ventral view. Vagina approximately 46.5–57% of the corresponding body width long, anteriorly directed. Pars proximalis vaginae with conoid walls, 5–8 µm long and 6–7.5 µm wide, pars refringens lacking, pars distalis vaginae 3–4 µm long. Prerectum 3.2–4.8 times and rectum 0.6–0.9 times anal body diameter long. Tail hemispheroid to elongate-hemispheroid, 1.1–1.4 times the anal body diameter long.

Figure 2. Microphotographs of Tylencholaimus zhongshanensis sp. nov.

Figure 2

Female: (A, B) Entire body. (C–F) Anterior regions showing odontostyle and odontophore. (G, H) Amphidial aperture and fovea. (I, J) Vulvas in lateral view. (K) Cardia. (L) Posterior regions. (M–O) Genital branch (a: Boundary between the oviduct and uterus). (P, Q) Pharynx. Scale bars: A, B = 200 mm; L, P, Q = 20 µm; C–K, M–O = 10 µm. Holotype: G, K. Paratypes: A–F, H–J, L–Q.

Male. Unknown. All soil samples were processed, but no males were found.

Habitat and locality

Rhizosphere soil of Phalaenopsis sp. from Zhongshan, Guangdong, China.

Type material

Female holotype and six female paratype specimens (slide numbers: 0422627.A and 0422627.B) are deposited in the Lab of Plant Nematology/Research Center of Nematodes of Plant Quarantine, South China Agricultural University, Guangzhou, Guangdong, China, and three paratype specimens (slide numbers: 0422627.C) are deposited in the Key Laboratory of Vegetation Restoration and Management of Degraded Ecosystems, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, Guangdong, China.

Etymology

The new species is named after its type locality, Zhongshan City.

Diagnosis and relationships

Tylencholaimus zhongshanensis sp. nov. is characterized by having a body length of 473–605 µm; lip region offset and approximately one-third of the body diameter at posterior end of the neck region; amphid aperture 30% as wide as the lip region; odontostyle 5–6 µm, 0.7–0.9 times the lip region width long; odontophore rod-like with small basal knobs, 5–7 µm long, 0.8–1.3 times as long as the odontostyle; basal expansion of pharynx occupying 33–38% of the total pharyngeal length; female genital system prodelphic; postvulval sac completely absent; vulva transverse; prerectum 3.2–4.8 times anal body diameter long; tail 16–21 µm, hemispheroid to elongate-hemispheroid, 1.1–1.4 times the anal body diameter long.

All the prodelphic species of Tylencholaimus were compared with Tylencholaimus zhongshanensis sp. nov. mainly based on Vinciguerra (1986), Peña Santiago & Coomans (1994), Peña Santiago & Coomans (1996), Andrássy (2009) and Ahmad & Araki (2003). The new species is close to T. proximus Thorne, 1939 (Vinciguerra, 1986) with a body length approximately 0.6 mm or less, short hemispheroid tail (c = 24 or more), pharynx expanded behind middle, inner part of lips not offset sharply, but it can be differentiated from T. proximus (Peña Santiago & Coomans, 1996) mainly by having odontophore 5–7 µm (vs. 8–9.5 µm) long and 0.8–1.3 times (vs. 1.5 times) as long as the odontostyle, oviduct slender without specializations (vs. consists of a slender part and a moderately developed pars dilatata), posterior genital branch completely absent (vs. absent or reduced to a rudimentary sac less than one-third of the corresponding body width long) and vagina slightly directed forward (vs. transverse). The new species is close to T. ibericus Peña-Santiago & Coomans, 1994 (= T. japonicus Ahmad & Araki, 2003) in having perioral region not disc-shaped, basal part of pharynx expanded gradually, posterior genital completely absent, odontostyle less than 6 µm long and body length about 0.6 mm or less (Peña Santiago & Coomans, 1994; Andrássy, 2009), but differs by c = 26–33 (vs. 35–46, after Ahmad & Araki, 2003; 32–41, after Peña Santiago & Coomans, 1994), junction of oviduct and uterus indistinct (vs. sphincter present at the junction of oviduct and uterus, after Ahmad & Araki, 2003 and Peña Santiago & Coomans, 1994) and tail 16–21 µm (vs. 12–16 µm after Ahmad & Araki, 2003; 13–16 µm after Peña Santiago & Coomans, 1994) long without terminal caudal pore (vs. with distinct terminal caudal pore, after Ahmad & Araki, 2003).

Molecular characterization and phylogenetic analysis

The sequences of 18S rDNA and D2–D3 region of 28S rDNA of Tylencholaimus zhongshanensis sp. nov. were obtained, and interindividual variabilities were both observed. Four sequences for 18S rDNA (1,747 bp; accession numbers: MG921272 to MG921275) and three sequences for the D2–D3 region of 28S rDNA (829 bp; accession numbers: MG921305 to MG921207) were deposited in GenBank. The BLAST search for the 18S rDNA showed the highest similarity (96%) to the sequences of T. helanensis (KU992903 and KU992904). For the D2–D3 region of 28S rDNA, both sequences showed the highest similarity (86%) to the sequences of T. helanensis (KU992905 and KU992906). In Bayesian trees for both the 18S rDNA and D2–D3 region of 28S rDNA (Figs. 4 and 5), the sequences of Tylencholaimus zhongshanensis sp. nov. formed a clade with 88% and 100% supports, respectively, and clustered together with other Tylencholaimus species.

Figure 4. Bayesian tree of Tylencholaimellidae for 18S rDNA gene under GTR +I +G model.

Figure 4

Posterior probabilities higher than 50% are presented for appropriate clades. Newly obtained sequences are shown in bold.

Figure 5. Bayesian tree of Tylencholaimellidae for D2–D3 region of 28S rDNA gene under GTR +I +G model.

Figure 5

Posterior probabilities higher than 50% are presented for appropriate clades. Newly obtained sequences are shown in bold.

In the 18S rDNA Bayesian tree (Fig. 4), Tylencholaimus zhongshanensis sp. nov. showed a close relationship with another prodelphic species, T. proximus Thorne, 1939, with 100% support. These two species are also close to each other in morphology but can be separated mainly by the characteristics of odontostyle, odontophore and genital system structures as discussed above. In the 28S rDNA Bayesian tree (Fig. 5), Tylencholaimus zhongshanensis sp. nov. showed a close relationship with T. helanensis. However, Tylencholaimus zhongshanensis sp. nov. can be differentiated from T. helanensis mainly by body length and shorter odontostyle (473–605 µm vs. 0.93–1.07 mm; 5–6 µm vs. 8–9.5 µm), and female prodelphic (vs. didelphic-amphidelphic) (Wu et al., 2018) although the sequences showed the highest similarity to each other.

Dorylaimoides shapotouensissp. nov.
urn:lsid:zoobank.org:act:F6CB7E8A-0C6D-496F-9B98-2E151328E64F
Figs. 6 8; Table 2

Figure 6. Ink drawing of Dorylaimoides shapotouensis sp. nov.

Figure 6

Female: (A) Entire body. (B) Anterior region. (C) Amphidial fovea. (D) Vulva in lateral view. (E) Posterior region. (F) Pharynx. (G) Genital system. Holotype: E. Paratypes: A–D, F, G.

Figure 8. Scanning electron micrographs of Dorylaimoides shapotouensis sp. nov.

Figure 8

Female: (A) Lip region. (B) Anterior end showing amphidial aperture (arrowed). (C) Vulva. (D, F) Posterior region. (E) Cuticle and body pores (arrowed). Scale bars: A–C = 4 µm; D, E = 10 µm; F = 20 µm. Paratypes: A–F.

Table 2. Measurements of Dorylaimoides shapotouensis sp. nov. and eight populations of D. micoletzkyi.

Character Dorylaimoides shapotouensis sp. nov. D. micoletzkyi
Holotype Paratypes 6♀♀ Peralta & Peña Santiago (1995)5♀♀ Other seven populations (Peña Santiago & Peralta, 1997b) more than 34 ♀♀ + 11♂♂
L 1.10 1.08 (1.02–1.13) 1.20 (1.10–1.26) 0.9–1.7
a 33.7 34.9 (32.6–36.9) 40.3 (36.7–44.7) 30–44
b 5.3 5.6 (5.3–5.8) 6.50 (6.10–7.10)
c 16.0 16.9 (14.8–19.9) 18.5 (16.4–19.4) 12.5–29
c’ 3.6 3.3 (2.8–3.9) 3.60 (3.4–4.2) 2.2–4.5
V 38.0 40.3 (38.5–42.5) 40.3 (38.8–41.8) 39–44
Lip region diam. 8 8 (8–9) 8.5–9.5 8–10
Lip region height 4 3 (3–4) 3.5–4.0
Amphid aperture 4.5 5.5 (5.0–6) 7.0
Odontostyle length 11 11 (9–13) 7.10 (7.0–7.5) 6–10
Odontophore length 8 8.5 (8–9.5) 18.2 (17.5–19.0) 16–17
Guiding ring from anterior end 7 7 (6–7) 7.0–7.5
Nerve ring from anterior end 94 93 (88–99) 89.4 (87.0–94.0)
Pharyngeal length 207 193 (178–209) 183 (177–189)
Expanded part of pharynx 45 49 ± 4.0 (43–54) 53.7 (50–56) 50–65
Cardia length 8 8 (5–11) 6–8
Body diameter at neck base 28 27 (25–31) 26.7 (25.0–27.5)
Body diameter at mid-body 33 31.0 (29–34) 29.8 (28.0–32.5)
Body diameter at anus 19 20 (19–22.0) 18.2 (17.0–19.5)
Anterior genital branch 129 109 (89–133) 150 (134–169)
Posterior genital branch 135 108.0 (81–126) 160 (138–178)
Vagina length 17 17 (15–18) 13–15
Vulva from anterior end 419 436 (413–451) 483 (460–500)
Prerectum length 85 99 (62–118) 97.0 (78–112)
Rectum length 25 22 (19–28) 22.0 (20.0–25.0)
Tail length 69 65 (53–73) 65.0 (59.0–75.0) 47–84 (female)

Notes.

All measurements are in m (except for ‘L in mm) and shown in the form: mean (minimum- maximum).

n
number of specimens observed
L
body length
a
L/ maximum width
b
L/ pharyngeal L
c
L/ tail length
c′
tail length/ body diameter at anus
V
distance of vulvafrom anterior end × 100/L
G1
anterior uterine sac × 100/L
G2
posterior genital branch × 100/L

Description

Female. Measurements are listed in Table 2. Body slender, ventrally curved showing an open ‘C’ shaped after fixation. Cuticle with fine transverse striations, 0.6–1.6 µm thick in anterior region, 1.2–2.1 µm at mid-body, and 3.2–3.9 µm on tail. Lateral chord occupying 14–17% of the body diameter at mid-body. Lip region rounded, offset by a constriction, about 2.5 times as wide as high or about 0.3 times as wide as body diameter at posterior end of pharyngeal region. Lips practically amalgamated, labial papillae protruding and can be seen easily in SEM. Amphidial foveae cup shaped, opening at the level of the constriction, apertures about 0.6 times as wide as lip region width. Odontostyle asymmetrical, with a distinct lumen. Odontophore arcuated, narrowing posteriorly, about 0.8 times as long as the odontostyle. Guiding ring distinct and single. Nerve ring situated at 40–51% of the pharyngeal length. Pharynx three parts, including an anterior part slender, a much narrower isthmus-like portion and a cylindrical basal expansion, basal expansion occupying 21–28% of the total pharyngeal length. Pharyngeal gland nuclei located as follows: D = 69–82%, AS1 = 26–42%, AS2 = 34–49%, PS1 = 50–66%, PS2 = 58–74%. Cardia short, rounded. Genital system didelphic-amphidelphic. Ovary reflexed, usually reaching the junction of oviduct and uterus, anterior one 42.5–46 µm long and posterior one 31–59.5 µm long. Oviduct consists of a wider pars dilatata and a slender part, anterior one 32–63 µm long and posterior one 46–53 µm long. Sphincter present at the junction of oviduct and uterus. Uterus simple and with a wide lumen, anterior 53–65 µm long and posterior 45–75 µm long. A lot of sperm in the uterus and a few cells in the pars dilatate of oviduct serving as spermatheca. Vulva transverse. Vagina extending 45–56.5% inwards the corresponding body width. Pars proximalis vaginae with thick walls, 12–14 µm long and 11–13 µm wide, pars refringens lacking. Prerectum 3.3–5.9 times and rectum 0.9–1.5 times the body diameter at anus long. Tail elongate conoid with rounded terminus, posterior region bent dorsally, 2.8–3.9 times the anal body diameter long.

Figure 7. Microphotographs of Dorylaimoides shapotouensis sp. nov.

Figure 7

Female: (A) Entire body. (B) Anterior region. (C) Amphidial fovea. (D) Genital system. (E) Posterior region. (F–H) Vulvas in lateral view. (I) Pharynx (a, slender anterior part; b, isthmus-like portion; c, basal expansion). Scale bars: A = 200 µm; B, C, F–H = 10 µm; D, E, I = 20 µm. Holotype: E. Paratypes: A–D, F–I.

Male. Unknown. All soil samples were processed, but no males were found.

Habitat and locality

Rhizosphere soil of apple trees from Shapotou Region, Zhongwei City, the Ningxia Hui Autonomous Region, China; GPS coordinate 104°59.723′E, 37°28.153′N.

Type material

Female holotype and four female paratype specimens (slide numbers: M72.A and M72.B) are deposited in the Lab of Plant Nematology/Research Center of Nematodes of Plant Quarantine, South China Agricultural University, Guangzhou, Guangdong 510642, China, and two female paratype specimens (slide numbers: M72. C) are deposited in the Key Laboratory of Vegetation Restoration and Management of Degraded Ecosystems, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, Guangdong 510642, China.

Etymology

The new species is named after Shapotou Region, a successful soil restoration area in China.

Diagnosis and relationships

Dorylaimoides shapotouensis sp. nov. is characterized by having a body length of 1.02–1.13 mm; lip region rounded and offset by a constriction, lips practically amalgamated, labial papillae protruding; odontostyle 9–13 µm, asymmetrical with a distinct lumen, odontophore arcuated and narrowing posteriorly, 8–9.5 µm; basal expanded part of pharynx occupying 21–28% of the total pharyngeal length; genital system didelphic-amphidelphic; prerectum 3.3–5.9 times and rectum 0.9–1.5 times the body diameter at anus long; tail elongate conoid with rounded terminus and the posterior region bent dorsally, 53–73 µm, 2.8–3.9 times the anal body diameter long.

The new species is close to D. leptus Husain & Khan, 1968, D. siddiqii Baqri & Khera, 1979, D. micoletzkyi (de Man, 1921) Thorne & Swanger, 1936 and D. punctatus Khan & Park, 1999 in having a didelphic genital system and a conoid elongate tail dorsally bent at the end and longer than 45 µm based on the key provided by Pedram, Pourjam & Vinciguerra (2011). It differs from D. leptus (Husain & Khan, 1968) by odontostyle longer (9–13 µm vs. 8–9 µm), odontophore shorter (8–9.5 µm vs. 11–12 µm), vulva located more anterior (V= 38–42.5 vs. 45–48), prerectum longer (62–118 µm vs. 35 µm). It differs from D. siddiqii (Baqri & Khera, 1979) with longer odontostyle (9–13 µm vs. 8–9 µm), shorter odontophore (8–9.5 µm vs. 11–13µm), larger c’ value (c’ = 2.8–3.9 vs. 2.5–2.8), and males unknown (vs. present). From D. micoletzkyi (Peralta & Peña Santiago, 1995), the new species differs by amphid opening narrower (about 0.6 times vs. 0.7–0.8 times as wide as lip region width), odontophore shorter (8–9.5 µm vs. 16–17 µm, after (Jana & Baqri, 1981); vs. 17.5–19.0 µm; and about 0.8 vs. 2.3–2.7 times the odontostyle long, after (Peralta & Peña Santiago, 1995), pharynx consists of an anterior part slender, a much narrower isthmus-like portion, a cylindrical basal expansion (vs. pharynx consists of a slender anterior part and a cylindrical basal bulb), genital system shorter (anterior branch 89–133 µm vs. 134–169 µm; posterior branch 81–135 µm vs. 138–178 µm) and males unknown (vs. present). The new species differs from D. punctatus (Khan & Park, 1999) by having a shorter body length (L = 1.02–1.13 mm vs. 1.3–1.4 mm), lower ‘a’ value (a = 32.6–36.9 vs. 39.5–45.7), odontostyle longer (9–13 µm vs. 7.3–8.0 µm), tail shorter (53–73 µm vs. 77–83 µm) and cuticle with fine transverse striations (vs. cuticle marked with zig-zag lines throughout the body).

Molecular characterization and phylogenetic analysis

Each sequence of 18S rDNA and D2–D3 region of 28S rDNA of Dorylaimoides shapotouensis sp. nov. (1,743 bp and 825 bp, respectively) was obtained and deposited in GenBank (accession numbers: KU662325 for the 18S rDNA and KU662324 for the D2–D3 region of 28S rDNA). The BLAST search for the 18S rDNA showed the highest similarity (99%) to the sequence of D. micoletzkyi (AY284830) and showed 8 nucleotide differences. The D2–D3 region of 28S rDNA showed the highest similarity (95%) to the sequences of D. micoletzkyi (AY593004) with 40 nucleotide and 4 gaps differences. In the 18S rDNA phylogenetic reconstructions (Fig. 4), the new species clustered together with other species of Dorylaimoides with 84% support. In the D2–D3 region of 28S rDNA phylogenetic reconstructions (Fig. 5), the new species is located in a 100% supported clade with D. micoletzkyi and D. limnophilus (an opisthodelphic species).

Most measurements of Dorylaimoides shapotouensis sp. nov. overlap those of eight documentary populations of D. micoletzkyi (Table 2), but Dorylaimoides shapotouensis sp. nov. can be easily differentiated from D. micoletzkyi mainly by the pharynx morphology and the odontophore length. Peña Santiago & Peralta (1997a) and Peña Santiago & Peralta (1997b) published a series of papers on the genus Dorylaimoides, and comprehensively discussed the suitability of using the female genital system types and the tail to identify the species of Dorylaimoides and made a key to the species and groups based on the female genital system types (didelphic, opisthodelphic and pseudodidelphic). In the 28S rDNA Bayesian tree, Dorylaimoides shapotouensis sp. nov. showed a closer relationship with another didelphic species, D. micoletzkyi rather than with the opisthodelphic species D. limnophilus. However, the inner relationships of Dorylaimoides remain unclear in the 18S rDNA Bayesian tree. Thus, to clarify the evolutionary relationships among the three groups with different genital system types, more molecular data of Dorylaimoides are needed.

Paratylencholaimus gen. nov.
urn:lsid:zoobank.org:act:4BFCC48B-38E2-449C-B1F5-338E46E7B099

Diagnosis

Tylencholaimellidae. Paratylencholaiminae subfam. nov. Cuticle dorylaimoid with fine transverse striations. Lip region cap-shape, offset from the body. Amphidial fovea not sclerotized. Odontostyle straight, tubular with small aperture, without dorsal accessory pieces. Odontophore rod-like and basal part slightly expanded. Guiding ring simple. Pharynx slender in anterior part, the basal part expanded occupying one-third of the total pharyngeal length. Female genital system didelphic. Vulval lips not sclerotized. Tail short, rounded to conoid-round. Males unknown.

Relationships

Paratylencholaimus gen. nov. is close to Goferus (Jairajpuri & Ahmad, 1992) and Phellonema Thorne, 1964 in having simple amphidial fovea, odontostyle without stiffening pieces, female didelphic (Andrássy, 2009). From Goferus (Jairajpuri & Ahmad, 1992; Andrássy, 2009), the new genus can be differentiated by having lip region offset (vs. practically continuous), odontophore rod-like (vs. arcuate), posterior third of pharynx with a cylindrical basal expansion (vs. much short and pyriform) and tail rounded to conoid-round (vs. elongate-rounded). From Phellonema (Jairajpuri & Ahmad, 1992; Andrássy, 2009), the new genus differs by having lip region offset from body (vs. continuous), basal part of odontophore slightly expanded (vs. with strongly developed flanges), basal part of pharynx expanded gradually (vs. constricted) and anus not subterminal (vs. anus subterminal).

Etymology

The new genus is named as Paratylencholaimus (latin para- = similar), as its inner characteristics are similar to those of the genus Tylencholaimus, but it has a different type of cuticle which is dorylaimoid.

Type and only species

Paratylencholaimus sanshaensis gen. nov. sp. nov.
urn:lsid:zoobank.org:act:63A581ED-4755-481F-B7A9-F71C79946A9C
Figs. 912; Table 3

Figure 9. Ink drawing of Paratylencholaimus shanshaensis gen. nov. sp. nov.

Figure 9

Female: (A–C) Entire bodies. (D, E) Anterior regions. (F) Amphid. (G, H) Vulvas in lateral view. (I) Genital system. (J) Pharynx. (K–O) Posterior regions. Holotype: E, L. Paratypes: A–D, F–K, M–O.

Figure 12. Scanning electron micrographs of Paratylencholaimus shanshaensis gen. nov. sp. nov.

Figure 12

Female: (A–C) Lip regions. (D) Amphid. (E) Vulva. (F) Posterior region. Scale bars: A–D = 5 µm; E, F = 10 µm. Paratypes: A–F.

Table 3. Measurements of Paratylencholaimus sanshaensis gen. nov. sp. nov.

Character Type material (Sansha population) Huadu population Zhongshan population Boluo population Total range
Holotype Paratypes 12 ♀♀ 10 ♀♀ 34 ♀♀ 5 ♀♀ 62 ♀♀
L 650 690 (636–772) 678 (595.0–757) 662 ± 39.5 (581–745) 681.0 (633–746) 581–772
a 28.4 28.9 (27.6–30.7) 30.8 (27.6–32.6) 30.3 ± 2.1 (26.3–35.5) 30.1 (25.3–33.2) 25.3–35.5
b 3.4 3.8 (3.2–4.4) 3.9 (3.3–5.2) 3.9 ± 0.2 (3.6–4.2) 3.8 (3.6–3.9) 3.2–5.2
c 36.5 37.7 (33.4–42.3) 37.7 (34.8–41.6) 38.0 ± 2.4 (33.1–43.3) 38.5 (34.9–43.7) 33.1–43.7
c′ 1.1 1.1 (0.9–1.4) 1.1 (0.9–1.2) 1.0 ± 0.1 (0.8–1.2) 1.1 (0.9–1.2) 0.8–1.4
V 63.9 61.0 (59.1–63.1) 61.3 (60.0–63.1) 60.2 ± 1.0 (58.3–62.2) 61.2 (59.4–62.4) 58.3–63.9
Lip region diameter 9 8 (8–9) 8 (7–8.5) 8 ± 0.3 (7.0–8) 8 (7–8) 7–9
Lip region height 2.5 3 (2–3) 3.0 (2.5–3) 3 ± 0.2 (2–3.5) 3 (3–3.5) 2–3.5
Amphid aperture 2 2 (2–3) 2.0 (2–4) 2 ± 0.2 (2–2.5) 2.0 (1.5–2) 1.5–4
Odontostyle length 8 8 (7–9) 7.5 (7–8) 8 ± 0.7 (7–11) 8 (7–9) 7–11
Odontophore length 9 9 (8–9) 9 (8–11) 9 ± 0.7 (6–10) 9 (8–10) 6–11
Guiding ring from anterior end 6 6 (5–6) 5 (5–5.5) 5 ± 0.3 (5–6) 5 (4–6) 4–6
Nerve ring from anterior end 81 79 (68–97) 74 (70.5–83.0) 72.0 ± 4.5 (65–80) 74 (70–79) 65–97
Pharyngeal length 193 184 (163–223) 175 (141–194) 172 ± 7.0 (162–187) 177 (164.5–189) 141–223
Expanded part of pharynx 78 75 (69–83) 66.5 (49–75) 70 ± 3.2 (62–77) 72 (63–80) 49–83
Cardia length 8 7 (5.0–10) 6.5 (5–9) 7 ± 1.1 (5–10) 8 (6–9) 5–10
Body diameter at neck base 23 24 (22–26) 21 (19–23) 21.0 ± 1.4 (17–24) 22 (20–24) 17–26
Body diameter at mid-body 23 24 (22.5–27) 22.0 (20–24) 22 ± 1.9 (19–26) 23 (21–25) 19–27
Body diameter at anus 16 17 (14–19) 16.5 (15–18) 18 ± 2.0 (14–22.0) 17 (16–18) 14–22.0
Anterior genital branch 71 87 (66.0–137) 73 (57.5–95) 78 ± 9.3 (56–95) 78 (57–87) 56–137
Posterior genital branch 76 84 (58–115) 68 (48–93) 75 ± 10.1 (57–102.0) 69 (63–75.5) 48–115
Vagina length 11 11 (10–12) 10 (8–11) 10.0 ± 0.7 (8–11) 11 (9–11) 8–12
Vulva from anterior end 415 421 (387–460) 415.5 (368–454) 399 ± 21.6 (353–440) 417 (394–443) 353–460
Prerectum length 40 51 (36–73) 57 (44–68) 42 ± 9.6 (25–58) 52 (35–64.5) 25–73
Rectum length 16 22.5 (20.0–24) 20 (17–23) 20 ± 2.8 (15–25) 23 (20.0–27) 15–27
Tail length 18 18 (16–21) 18.0 (16–20) 17.5 ± 1.3 (15–20) 18 (16–19.5) 15–21

Notes.

All measurements are in µm (except for ‘L in mm) and are given as mean (minimum- maximum) with SD indicated when n > 30.

n
number of specimens observed
L
body length
a
L/maximum width
b
L/ pharyngeal L
c
L/tail length
c′
tail length/ body diameter at anus
V
distance of vulva from anterior end × 100/L
G1
anterior uterine sac × 100/L
G2
posterior genital branch × 100/L

Descriptions

Female. Measurements are listed in Table 3. Body cylindrical, habitus curved ventrally on different levels into an open ‘C’ shape after fixation. Cuticle with fine transverse striations, 0.8–1.4 µm thick in anterior region, 0.9–2.1 µm at mid-body and 1.9–3.1 µm on tail. Lateral chord occupying about one-third of the body diameter at mid-body, lateral pores indistinct. Lip region cap shaped, offset from the body, 2.1–3.5 times as wide as high or about one-third of the body diameter at posterior end of the neck region. Lips largely amalgamated, inner part of lips separated, labial and cephalic papillae distinct and labial papillae larger than the cephalic ones. Amphideal fovea goblet-shaped, its apertures quite small, about one-fourth as wide as the lip region. Odontostyle straight with distinct lumen and aperture, 0.8–1.2 times as long as the lip region width, its aperture about one-third of its length. Odontophore rod-like, 0.8–1.4 times as long as the odontostyle. Guiding ring single. Nerve ring situated at 37.5–51% of the pharyngeal length. Hemizonid occurs at the level of nerve ring. Anterior part of pharynx slender, basal part occupying 34–45% of the total pharyngeal length, expand gradually and its anterior end tend to tilt dorsally. Pharyngeal gland nuclei located as follows: D = 64–72.5%, AS1 = 22–45%, AS2 = 31–56%, PS1 = 55–79%, PS2 = 64–86%. Cardia conoid to elongate-conoid. Genital system didelphic-amphidelphic. Ovary reflexed, anterior one 19–64.5 µm and posterior one 26–79 µm long. Oviduct slender, anterior 35–83 µm and posterior one 23.5–67 µm long. Junction of oviduct and uterus indistinct. No sperm present. Uterus simple and slender, anterior 15–49 µm and the posterior one 17–55 µm long. Vulva transverse. Vagina extending 33.5–56% inwards the corresponding body width. Pars proximalis vaginae 5–8 µm long and 5–9 µm wide, pars refringens lacking, pars distalis vaginae 2–4 µm long. Prerectum 1.2–4.4 times and rectum 0.8–1.7 times anal body diameter long. Anal region ventrally flattened to distinctly bulge. Tail rounded to conoid-round, 0.8–1.4 times anal body diameter long.

Figure 10. Microphotographs of Paratylencholaimus shanshaensis gen. nov. sp. nov.

Figure 10

Female: (A–D) Entire bodies. (E–J) Anterior regions. (K, L) Pharynx (arrowed: hemizonid). (M, N) Amphids. (O–Q) Cardias. Scale bars: A–D = 100 µm; K, L = 20 µm; E–J, M–Q = 10 µm. Paratypes: A–Q.

Figure 11. Microphotographs of Paratylencholaimus shanshaensis gen. nov. sp. nov.

Figure 11

Female: (A–F) Vulvas in lanteral view. (G, H) Genital systems. (I–O) Posterior regions. (P) Lateral chord at mid-body. Scale bars: G, H = 20 µm; A–F, I–P = 1 µm. Paratypes: A–P.

Male. Unknown. All soil samples were processed, but no males were found.

Etymology

The new species is named after the Sansha City, which is its type locality.

Type material

Female holotype, twelve female paratype specimens (slide numbers: B1a.A, B1a.B, B1a.C, B1a.D and B1a.E) and 44 female from Huadu and Zhongshan (slide numbers: HuaDu.61.A–C, 0422627.D–I and 0624601.A–E) are deposited in the Lab of Plant Nematology/Research Center of Nematodes of Plant Quarantine, South China Agricultural University, Guangzhou, Guangdong 510642, China, and five female from Boluo (slide numbers: BoLuo.A and Boluo.B) are deposited in the Key Laboratory of Vegetation Restoration and Management of Degraded Ecosystems, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, Guangdong 510642, China.

Type habitat and locality

Rhizosphere soil of Euphorbia sp. from Yongxing Island, Sansha City, Hainan, China.

Other habitat and localities

Culture medium of Scindapsus sp. from Huadu District, Guangzhou, Guangdong, China; culture medium of Phalaenopsis sp. from Zhongshan, Guangdong, China; rhizosphere soil of Citrus sp. from Boluo County, Huizhou, Guangdong, China.

Diagnosis

Paratylencholaimus sanshaensis gen. nov. sp. nov. is characterized by having body 581–772 mm long; lip region cap-shaped and offset from the body; amphid apertures quite small; odontostyle straight, 7–11 µm long and 0.8–1.2 times the lip region width long; odontophore rod-like, 6–11 µm, 0.8–1.4 times as long as the odontostyle; hemizonid occurs at the level of nerve ring; pharyngeal basal bulb occupying 34–45% of the total pharyngeal length; oviduct and uterus slender without differentiations, junction of oviduct and uterus indistinct; vulva transverse; pars refringens lacking; prerectum 1.2–4.4 times and rectum 0.8–1.7 times anal body diameter long; tail rounded to conoid-round, 15–21 µm long, 0.8–1.4 times the anal body diameter long.

Feeding type

One noticed phenomenon was observed in the Zhongshan population of Paratylencholaimus sanshaensis gen. nov. sp. nov. The anus of this population showed morphological diversity: nematodes with normal color intestines have a flat anal region, while the nematodes with a black mass in intestines have bulge anus. The culture medium of Phalaenopsis sp., which this population is collected from, consists of three levels: sphagnum on the top, coco coir in the middle and barks at the bottom. It can be suggested that the nematodes with a black mass in intestines may feed on the barks. This finding indicates that the food source can influence the morphology of nematodes, and the feeding type of Paratylencholaimus sanshaensis gen. nov. sp. nov. is omnivorous.

Molecular characterization and phylogenetic analysis

The sequences of 18S rDNA and the D2–D3 region of 28S rDNA of Paratylencholaimus sanshaensis gen. nov. sp. nov. were obtained. The interindividual variabilities were observed both in the 18S rDNA and D2–D3 region of 28S rDNA. Seventeen sequences for 18S rDNA (1,743 bp) and fourteen sequences for 28S rDNA (827 bp) were deposited in GenBank (accession numbers: MG921276 to MG921292 for 18S rDNA, MG921293 to MG921309 for 28S rDNA). 1 bp interindividual variability was observed only in 18S rDNA. The BLAST search for the 18S rDNA sequences showed the highest similarity (98%) to the sequence of an unidentified species (EF024986). The D2–D3 region of 28S rDNA showed the highest similarity (85%) to the sequences of Dorylaimus sp. (KP954677). In both the 18S rDNA and D2–D3 region of 28S rDNA Bayesian trees (Figs. 4 and 5), the sequences of Paratylencholaimus sanshaensis gen. nov. sp. nov. clustered together and formed a clade with 100% support, and showed a close relationship with the species of Tylencholaimellidae.

Discussion on new genus classification

In Dorylaimida, there are two cuticle types: (a) dorylaimoid: inner layer not loose and without radial elements; (b) tylencholaimoid: inner layer loose with irregular radial elements. Among all the families, only Leptonchidae and Tylencholaimidae had tylencholaimoid cuticle, whereas the others had dorylaimoid cuticle. The morphology of the basal expansion of pharynx of the new genus is similar to Tylencholaimus of Tylencholamidae. However, Paratylencholaimus gen. nov. has dorylaimoid cuticle that is different from the tylencholaimoid cuticle of Tylencholaimus. Given the dorylaimoid cuticle, papiliform labial sensory organs, symmetrical odontostyle and odontophore and pharynx two parts, Paratylencholaimus gen. nov. is placed under the family Tylencholaimellidae, and it can be easily differentiated from the other genera of Tylencholaimellidae by having cylindrical basal expansion occupying one-third of the pharynx. Besides, the new genus showed a close relationship with the species of Tylencholaimellidae not Tylencholaimus spp. in both the 18S rDNA and D2–D3 region of 28S rDNA Bayesian trees. Thus, the present taxonomic status of the new genus is supported by both the morphological and phylogenetic results.

According to the latest classifications of Tylencholaimellidea (Peña Santiago, 2006; Peña Santiago, 2014), Paratylencholaimus gen. nov. should be placed under the subfamily Tylencholaimellinae due to its amphideal fovea that is not sclerotized. However, Paratylencolaimus gen. nov. and its close relative genus Goferus has odontophore without distinct basal knobs and basal expansion occupying greater than one-fifth of the total pharyngeal length. In contrast, the remainder genera of Tylencholaimellinae (Dorella Jairajpuri, 1964, Margollus Peña-Santiago, Peralta & Siddiqi, 1993, Tylencholaimellus Cobb in Cobb, 1915, Doryllium Cobb, 1920, Oostenbrinkella Jairajpuri, 1965 and Phellonema Thorne, 1964) except Agmodorus Thorne, 1964 (see further) have distinct basal knobs and basal expansion about or less than one-fifth of the total pharyngeal length. To adjust this, we propose to place the new genus and Goferus under a new subfamily, namely, Paratylencholaiminae subfam. nov.

Paratylencholaiminae subfam. nov.
urn:lsid:zoobank.org:act:F5D7E807-6CF2-48CE-B771-D48B3594806D

Diagnosis

Dorylaimida, Dorylaimina, Tylencholaimellidae. Cuticle dorylaimoid without radial refractive elements. Lip region continuous or offset from the body. Amphideal fovea not sclerotized. Odontostyle straight without pieces, odontophore without basal knobs. Expanded part of pharynx pyriform and unconstructed. Female genital system didelphic. Tail elongate to conoid-rounded. Two genera.

Type genus

Paratylencholaimus gen. nov.

Other genus

Goferus Jairajpuri & Ahmad, 1992

Remarks

According to Peña Santiago (2006) and Peña Santiago (2014), Tylencholaimellidae includes two subfamilies: (a) Athernematinae Ahmad & Jairajpuri, 1978: amphidial fovea bilobed and strongly sclerotized, odontostyle asymmetrical and arcuate without accessory pieces, odontophore simple, pharyngeal expansion pyriform, female mono-opisthodelphic and tail filiform in both sexes; (b) Tylencholaimellinae Jairajpuri, 1964: amphidial fovea not sclerotized, odontostyle tubular, occasionally more attenuated, and with or without accessory pieces, odontophore with or without basal knobs, basal expansion occupying about one-fifth of the total pharyngeal length, female didelphic or monodelphic and tail long and filiform to short and hemispheroid. Detailed characteristics of the genera of Tylencholaimellidae were listed and compared in Table 4. And the classifications according to Peña Santiago (2006); Peña Santiago (2014) are as follow:

Table 4. Comparisons of some morphology of the genera of the family Tylencholaimellidae Jairajpuri, 194 and Mydonomidae Thorne, 1964 (classification sensu Peña Santiago (2014)).

Family Subfamily Genus Amphid Odontostyle Odontophore Basal expansion of pharynx Genital system Tail
Tylencholaimellidae Athernematinae Athernema bilobed, sclerotized arcuate arcuate, not knobbed 1/5, not constricted opisthodelphic filiform
Tylencholaimellinae Agmodorus goblet short as if broken off at tip arcuate, not knobbed very short, pyfiform,constricted opisthodelphic elongate or clavate with long terminal hyaline portion
Doryllium goblet short, tubular knobbed or flange pyfiform, most constricted opisthodelphic short and rounded
Goferus goblet narrow, straight simple, not knobbed cylindrus, not constricted amphidelphic short, conoid-rounded
Oostenbrinkella goblet attenuated strongly knobbed very short, not constricted opisthodelphic filiform
Phellonema goblet short with basal knobs cylindrus, constricted didelphic short, anus subterminal
Dorella goblet with short ventral stiffening piece knobbed short, constricted mono-prodelphic short, conoid-rounded
Margollus goblet attenuated with dorsal stiffening piece knobbed cylindrical opisthodelphic convex-conoid to hemispherical
Tylencholaimellus goblet short, tubular with dorsal accessory piece with basal knobs bulb like or pyriform opisthodelphic rounded or conoid with rounded tip
Paratylencholaimus gen. nov. goblet straight with distinct lumen simple, not knobbed long, occupying 34–45% didelphic rounded to conoid-round
Mydonomidae Calolaiminae Calolaimus goblet irregularly straight, sclerotized cylindrical, up to one-third didelphic elongate-conoid to filiform
Timmus goblet irregular in outline simple, not knobbed short, cylindroid or bulb-like amphidelphic filiform
Mydonominae Dorylaimoides goblet asymmetrical arcuate or angular cylindrical, one-fourth to one-third amphidelphic or opisthodelphic short and rounded to elongate or filiform
Morasia goblet asymmertrical arcuate cylindroid, about one-third amphidelphic elongate-conoid in female, rounded in male
Mydonomus goblet asymmertrical arcuate weak bulb, enclosed in muscular sheath amphidelphic short, bluntly conoid
Tylencholaimellidae
Athernematinae Ahmad & Jairajpuri, 1978
Athernema Ahmad & Jairajpuri, 1978
Tylencholaimellinae Jairajpuri, 1964
Agmodorus Thorne, 1964
Dorella Jairajpuri, 1964
Doryllium Cobb, 1920
GoferusJairajpuri & Ahmad, 1992
Margollus Peña-Santiago, Peralta & Siddiqi, 1993
Oostenbrinkella Jairajpuri, 1965
Phellonema Thorne, 1964
Tylencholaimellus Cobb in Cobb, 1915

The odontostyle of Athernema and Agmodorus has not the typical tube shaped. We also found that these two genera with the arched odontophore, conoid to filiform tail and the opisthodelphic female genital system are more closely related to the family Mydonomidae Thorne, 1964 which is mainly characterized by having odontostyle asymmetry, odontophore straight or arched, basal expansion cylindrical and no longer than one-third of the pharynx length, female didelphic or opisthodelphic. Thus, we propose to transfer Athernema and Agmodorus into the family Mydonomidae Thorne, 1964 according to the morphology mentioned above, and under the subfamily Mydonominae Thorne, 1964 according to the body length less than three mm, and cancel the subfamily Athernematinae.

The main characteristics of the families Mydonomidae, Tylencholaimellidae and the subfamily Tylencholaimellinae should be revised as follow:

Mydonomidae: cuticle dorylaimoid; lip region continuous or slightly offset, occasionally cap like; lips rounded, usually amalgamated; odontostyle short, asymmetry or not typical tubular, with distinct lumen; odontophore straight or arched; basal expansion cylindrical and no longer than one-third of the pharynx length, occasionally offset; female genital system didelphic-amphidelphic or mono-opisthodelphic; spicula dorylaimoid; ventromedial supplements spaced, 1–20; tail variable, short and rounded to elongate or filiform, similar or dissimilar in sexes.

Tylencholaimellidae: cuticle dorylaimoid; lip region cap-like, more or less offset, lips amalgamated; odontostyle short, tubular, occasionally with accessory stiffening piece; odontophore with or without basal knobs or flanges; basal expansion short pyriform, usually offset, occupying one-fifth to one-third of the pharynx length; female amphidelphic or opisthodelphic, exceptionally prodelphic; vulva transverse; spicula dorylaimoid; ventromedial supplements none to two, spaced; tail short and rounded to filiform, similar in sexes.

Tylencholaimellinae: amphideal fovea not sclerotized; odontostyle straight without accessory stiffening piece; odontophore with distinct basal knobs or flanges, basal expansion occupying about one-fifth of the total pharyngeal length, female didelphic or monodelphic and tail long and filiform to short and hemispheroid.

The new classifications of Mydonomidae and Tylencholaimellidae are:

Mydonomidae Thorne, 1964
Calolaiminae Goseco, Ferris & Ferris, 1976
Calolaimus Timm, 1964
Timmus Goseco, Ferris & Ferris, 1976
Mydonominae Thorne, 1964
Athernema Ahmad & Jairajpuri, 1978
Agmodorus Thorne, 1964
Dorylaimoides Thorne & Swanger, 1936
Morasia Baqri & Jairajpuri, 1969
Mydonomus Thorne, 1964
Tylencholaimellidae Jairajpuri, 1964
Paratylencholaiminae subfam. nov.
GoferusJairajpuri & Ahmad, 1992
Paratylencholaimus gen. nov.
Tylencholaimellinae Jairajpuri, 1964Doryllium Cobb, 1920
Dorella Jairajpuri, 1964
Doryllium Cobb, 1920
Margollus Peña-Santiago, Peralta & Siddiqi, 1993
Oostenbrinkella Jairajpuri, 1965
Phellonema Thorne, 1964
Tylencholaimellus Cobb in Cobb, 1915

Key to the genera of Mydonomidae

1 Body length 3–7 mm 2
Body length under three mm 3
2 Adcloacal supplements two pairs Timmus Goseco, Ferris & Ferris, 1976
Adcloacal supplements one pair Calolaimus Timm, 1964
3 Amphidial fovea bilobed, sclerotized Athernema Ahmad & Jairajpuri, 1978
Amhpidial fovea simple, not sclerotized 4
4 Odontostyle very short with apparently broken tip Agmodorus Thorne, 1964
Odontostyle normal 5
5 Tails dissimilar in sexes Morasia Baqri & Jairajpuri, 1969
Tails similar in sexes 6
6 Basal expansion of pharynx surrounded by a muscle sheath Mydonomus Thorne, 1964
Basal expansion of pharynx without muscle sheath Dorylaimoides Thorne & Swanger, 1936

Key to the genera of Tylencholaimellidae

1 Odontostyle with a convex stiffening piece 2
Odontostyle without stiffening piece 4
2 Stiffening piece ventral; ovary prevulval Dorella Jairajpuri, 1964
Stiffening piece dorsal; ovary postvulval 3
3 Labial framework sclerotized Margollus Peña-Santiago, Peralta & Siddiqi, 1993
Labial framework not sclerotized Tylencholaimellus Cobb in Cobb, 1915
4 Odontophore simple without basal knobs 5
Odontophore with distinct basal knobs 6
5 Lip region offset; basal part of pharynx cylindrical, expanded at posterior one-third Paratylencholaimus gen. nov.
Lip region continuous; basal part of pharynx pyriform, much shorter GoferusJairajpuri & Ahmad, 1992
6 Female didelphic-amphidelphic Phellonema Thorne, 1964
Female monodelphic-opisthodelphic 7
7 Tail filiform Oostenbrinkella Jairajpuri, 1965
Tail short, rounded Doryllium Cobb, 1920

Conclusions

Both the morphology and phylogenetic analysis results support that the three new species and the new genus are valid. The classifications and the main characteristics of the families Tylencholaimellidae and Mydonomidae are revised due to the propositions of Paratylencholaiminae subfam. nov. and Paratylencholaimus gen. nov. In the new classifications, Athernema and Agmodorus of Tylencholaimellidae are transferred into Mydonomidae, and the subfamily Athernematinae of Tylencholaimellidae was canceled. Keys to the genera of these two families are also provided. However, deeper inner relationships of the genera of Tylencholaimellidae and Mydonomidae remain unclear and more information including morphology and phylogeny of these two families are needed.

Supplemental Information

File S1. Raw data of phylogenetic analysis based on the 18S rDNA.
DOI: 10.7717/peerj.7541/supp-1
File S2. Raw data of phylogenetic analysis based on the D2–D3 region of the 28S rDNA.
DOI: 10.7717/peerj.7541/supp-2

Funding Statement

This research was supported by the Science and Technology Basic Resources Investigation Program of China (Grant no. 2018FY100304), the Special Project of Scientific and Technological Basis of the Ministry of Science and Technology of the People’s Republic of China (Grant no. 2006FY120100), and the National Natural Science Foundation of China (Grant no. U1701246). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare there are no competing interests.

Author Contributions

Wen-Jia Wu conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft.

Chun-Ling Xu conceived and designed the experiments, contributed reagents/materials/analysis tools.

Hui Xie conceived and designed the experiments, contributed reagents/materials/analysis tools, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft.

Dong-Wei Wang help to collect the sample.

DNA Deposition

The following information was supplied regarding the deposition of DNA sequences:

The sequences described here are accessible via GenBank: MG921272MG921309, KU662324 and KU662325.

Data Availability

The following information was supplied regarding data availability:

The raw data for the phylogenetic analysis based on the 18S rDNA and the D2–D3 region of the 28S rDNA are available in the Supplemental Files.

New Species Registration

The following information was supplied regarding the registration of a newly described species:

Publication LSID: urn:lsid:zoobank.org:pub:427B5E52-23B0-4474-B179-4FA9FC5E7C9C.

Tylencholaimus zhongshanensis sp. nov.:

urn:lsid:zoobank.org:act:AFB00C8F-918E-422C-ABB6-71F4DFBCA3D5.

Dorylaimoides shapotouensis sp. nov.:

urn:lsid:zoobank.org:act:F6CB7E8A-0C6D-496F-9B98-2E151328E64F.

Paratylencholaiminae n. subfam.:

urn:lsid:zoobank.org:act:F5D7E807-6CF2-48CE-B771-D48B3594806D.

Paratylencholaimus gen. nov.:

urn:lsid:zoobank.org:act:4BFCC48B-38E2-449C-B1F5-338E46E7B099.

Paratylencholaimus sanshaensis sp. nov.:

urn:lsid:zoobank.org:act:63A581ED-4755-481F-B7A9-F71C79946A9C.

References

  • Abolafia & Peña Santiago (2005).Abolafia J, Peña Santiago R. Nematodes of the order Rhabditida from Andalucía Oriental, Spain. Pseudacrobeles elongatus (de Man, 1880) comb. n. Nematology. 2005;7:917–926. doi: 10.1163/156854105776186415. [DOI] [Google Scholar]
  • Ahmad & Araki (2003).Ahmad W, Araki M. New and known species of the family Tylencholaimidae (Nematoda: Dorylaimida) from Japan. Journal of Nematode Morphology and Systematics. 2003;6:1–26. [Google Scholar]
  • Andrássy (1998).Andrássy I. Once more: the oesophageal gland nuclei in the dorylaimoid nematodes. Opuscula Zoologica Budanest. 1998;31:165–171. [Google Scholar]
  • Andrássy (2009).Andrássy I. Free-living nematodes of Hungary (Nematoda errantia) III. Pedozoologica Hungarica 5. Hungarian Natural History Museum and Systematic Research Group of the Hungarian Academy of Sciences; Budapest: 2009. [Google Scholar]
  • Baqri & Khera (1979).Baqri QH, Khera S. Nematodes from West Bengal (India) IV. Three known and two new species of the genus Dorylaimoides Thorne & Swanger, 1936 (Leptonchidae: Dorylaimida) Records of the Zoological Survey of India. 1979;75:247–254. [Google Scholar]
  • De Ley et al. (1999).De Ley P, Félix MA, Frisse LM, Nadler SA, Sternberg PW, Thomas WK. Molecular and morphological characterisation of two reproductively isolated species with mirror-image anatomy (Nematoda: Cephalobidae) Nematology. 1999;1:591–612. [Google Scholar]
  • Holterman et al. (2008).Holterman M, Holovachov O, Elsen SVD, Van Megen H, Bongers T, Bakker J, Helder J. Small subunit ribosomal DNA-based phylogeny of basal Chromadoria (Nematoda) suggests that transitions from marine to terrestrial habitats (and vice versa) require relatively simple adaptations. Molecular Phylogenetics and Evolution. 2008;48:758–763. doi: 10.1016/j.ympev.2008.04.033. [DOI] [PubMed] [Google Scholar]
  • Holterman et al. (2006).Holterman M, Van der Wurff A, Van den Elsen S, Van Megen H, Bongers T, Holovachov O, Bakker J, Helder J. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution. 2006;23:1792–1800. doi: 10.1093/molbev/msl044. [DOI] [PubMed] [Google Scholar]
  • Husain & Khan (1968).Husain SI, Khan AM. Basirotyleptus modestus n. sp. and two new species of Dorylaimoides Thorne & Swanger, 1936 from India. Nematologica. 1968;14:362–368. doi: 10.1163/187529268X00039. [DOI] [Google Scholar]
  • Jairajpuri & Ahmad (1992).Jairajpuri MS, Ahmad W. Dorylaimida, free-living, predaceous and plant-parasitic nematodes. Oxford & IBH Publishing Co. Pvt. Ltd; New Delhi: 1992. [Google Scholar]
  • Jana & Baqri (1981).Jana A, Baqri QH. Nematodes from west Bengal (India) XI. Studies on the species of the superfamily Leptonchoidea (Dorylaimida) Journal of the Zoological Society of India. 1981;33:1–24. [Google Scholar]
  • Khan & Park (1999).Khan Z, Park SD. Description of Dorylaimoides punctatus n. sp. and Paractinolaimus acutus n. sp. (Nematoda: Dorylaimida) from Korea. Journal of Asia-Pacific Entomology. 1999;2:45–50. [Google Scholar]
  • Nedelchev et al. (2014).Nedelchev S, Elshishka M, Lazarova S, Radoslavov G, Hristov P, Peneva V. Calcaridorylaimus castaneae sp. n. (Nematoda, Dorylaimidae) from Bulgaria with an identification key to the species of the genus. ZooKeys. 2014;410:41–61. doi: 10.3897/zookeys.410.6955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Pedram, Pourjam & Vinciguerra (2011).Pedram M, Pourjam E, Vinciguerra MT. Description of Dorylaimoides alborzicus sp. n. (Dorylaimida: Nematoda) from Iran, with updated compendium and key to the species of Dorylaimoides. Zootaxa. 2011;3022:58–68. doi: 10.11646/zootaxa.3022.1.4. [DOI] [Google Scholar]
  • Peralta & Peña Santiago (1995).Peralta M, Peña Santiago R. Nematodes of the order Dorylaimida from Andalucía Oriental, Spain. The genus Dorylaimoides Thorne & Swanger, 1936. 1. Didelphic species. Fundamental and Applied Nematology. 1995;18:35–53. [Google Scholar]
  • Peña Santiago (2006).Peña Santiago R. Dorylaimida Part I: superfaimilies Belondiroidea, Nygolaimoidea and Tylencholaimoidea. In: Eyualem-Abebe, Traunspurger W, Andrássy I, editors. Freshwater nematodes: ecology and taxonomy. CABI publishing; UK: 2006. pp. 326–391. [Google Scholar]
  • Peña Santiago (2014).Peña Santiago R. Order Dorylaimida Pearse, 1942. In: Schmidt-Rhaesa A, editor. Gastrotricha, Cycloneuralia and Gnathifera. De Gruyter; Germany: 2014. pp. 277–297. (Vol 2: Nematoda). [Google Scholar]
  • Peña Santiago & Coomans (1994).Peña Santiago R, Coomans A. Revision of the genus Tylencholaimus de Man, 1876. Prodelphic species: Part III. Nematologica. 1994;40:348–368. doi: 10.1163/003525994X00256. [DOI] [Google Scholar]
  • Peña Santiago & Coomans (1996).Peña Santiago R, Coomans A. Revision of the genus Tylencholaimus de Man, 1876. Prodelphic species: part IV. Nematologica. 1996;42:282–310. doi: 10.1163/004425996X00038. [DOI] [Google Scholar]
  • Peña Santiago & Peralta (1997a).Peña Santiago R, Peralta M. The genus Dorylaimoides Thorne & Swanger, 1939 (Nematoda: Dorylaimida). 1. Taxonomy and variability. Fundamental and Applied Nematology. 1997a;20(3):243–251. [Google Scholar]
  • Peña Santiago & Peralta (1997b).Peña Santiago R, Peralta M. The genus Dorylaimoides Thorne & Swanger, 1939 (Nematoda: Dorylaimida). 2. A compendium and key to the species. Fundamental and Applied Nematology. 1997b;20(3):253–259. [Google Scholar]
  • Vinciguerra (1986).Vinciguerra MT. New and known species of Tylencholaimus de Man, 1876 (Dorylaimida, Nematoda) from Italian beech forests with a key to the species. Nematologia mediterranea. 1986;14:107–116. [Google Scholar]
  • Whitehead & Hemming (1965).Whitehead AG, Hemming JR. A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Annals of Applied Biology. 1965;55:25–38. doi: 10.1111/j.1744-7348.1965.tb07864.x. [DOI] [Google Scholar]
  • Wu et al. (2017).Wu WJ, Huang X, Xie H, Wang K, Xu CL. Morphometrics and molecular analysis of the free-living nematode, Belondira bagongshanensis n. sp. (Dorylaimida, Belondiridae) from China. Journal of Helminthology. 2017;91:7–13. doi: 10.1017/S0022149X15001091. [DOI] [PubMed] [Google Scholar]
  • Wu et al. (2018).Wu WJ, Yu L, Xie H, Xu CL, Yu J, Wang DW. Description and molecular analysis of Tylencholaimus helanensis sp. n. from China (Dorylaimida, Tylencholaimidea) ZooKeys. 2018;792:1–14. doi: 10.3897/zookeys.792.27255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Xie (2005).Xie H. Taxonomy of plant nematodes. 2nd edition Higher Education Press; China: 2005. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

File S1. Raw data of phylogenetic analysis based on the 18S rDNA.
DOI: 10.7717/peerj.7541/supp-1
File S2. Raw data of phylogenetic analysis based on the D2–D3 region of the 28S rDNA.
DOI: 10.7717/peerj.7541/supp-2

Data Availability Statement

The following information was supplied regarding data availability:

The raw data for the phylogenetic analysis based on the 18S rDNA and the D2–D3 region of the 28S rDNA are available in the Supplemental Files.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES