Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2019 Aug 26;13(8):e0007692. doi: 10.1371/journal.pntd.0007692

Loop-mediated Isothermal Amplification and nested PCR of the Internal Transcribed Spacer (ITS) for Histoplasma capsulatum detection

Matheus da Silva Zatti 1, Thales Domingos Arantes 1, José Alex Lourenço Fernandes 1, Mônica Baumgardt Bay 2, Eveline Pipolo Milan 2, Georggia Fatima Silva Naliato 1, Raquel Cordeiro Theodoro 1,*
Editor: Thuy Le3
PMCID: PMC6730939  PMID: 31449526

Abstract

Background

Histoplasmosis is a neglected disease that affects mainly immunocompromised patients, presenting a progressive dissemination pattern and a high mortality rate, mainly due to delayed diagnosis, caused by slow fungal growth in culture. Therefore, a fast, suitable and cost-effective assay is required for the diagnosis of histoplasmosis in resource-limited laboratories. This study aimed to develop and evaluate two new molecular approaches for a more cost-effective diagnosis of histoplasmosis.

Methodology

Seeking a fast, suitable, sensitive, specific and low-cost molecular detection technique, we developed a new Loop-mediated Isothermal Amplification (LAMP) assay and nested PCR, both targeting the Internal Transcribed Spacer (ITS) multicopy region of Histoplasma capsulatum. The sensitivity was evaluated using 26 bone marrow and 1 whole blood specimens from patients suspected to have histoplasmosis and 5 whole blood samples from healthy subjects. All specimens were evaluated in culture, as a reference standard test, and Hcp100 nPCR, as a molecular reference test. A heparin-containing whole blood sample from a heathy subject was spiked with H. capsulatum cells and directly assayed with no previous DNA extraction.

Results

Both assays were able to detect down to 1 fg/μL of H. capsulatum DNA, and ITS LAMP results could also be revealed to the naked-eye by adding SYBR green to the reaction tube. In addition, both assays were able to detect all clades of Histoplasma capsulatum cryptic species complex. No cross-reaction with other fungal pathogens was presented. In comparison with Hcp100 nPCR, both assays reached 83% sensitivity and 92% specificity. Furthermore, ITS LAMP assay showed no need for DNA extraction, since it could be directly applied to crude whole blood specimens, with a limit of detection of 10 yeasts/μL.

Conclusion

ITS LAMP and nPCR assays have the potential to be used in conjunction with culture for early diagnosis of progressive disseminated histoplasmosis, allowing earlier, appropriate treatment of the patient. The possibility of applying ITS LAMP, as a direct assay, with no DNA extraction and purification steps, makes it suitable for resource-limited laboratories. However, more studies are necessary to validate ITS LAMP and nPCR as direct assay in other types of clinical specimens.

Author summary

Histoplasmosis is a worldwide neglected disease with a high mortality rate associated with HIV/AIDS patients, killing more than tuberculosis in some endemic countries in Latin America. Part of this elevated mortality rate is due to delayed diagnosis and treatment. Here we present two novel methods, one based on Loop-mediated Isothermal Amplification (LAMP) and another on nested Polymerase Chain Reaction (nPCR), for fast, sensitive and specific diagnosis of histoplasmosis. Tests of blood samples spiked with Histoplasma capsulatum suggest the possibility of direct application of the LAMP assay proposed herein to clinical specimens without the need for previous DNA extraction and with the added advantage of naked-eye evaluation of the reaction results. Once the assay has been validated in different clinical specimens, it may be a promising tool for fast histoplasmosis screening.

Introduction

Histoplasmosis, a systemic mycosis distributed worldwide, is caused by Histoplasma capsulatum sensu lato, a species complex of pathogenic fungi, which includes at least eight clades distributed in Australian, the Netherlands, Eurasian, North American, Latin American and Africa, according to Kasuga et al (2003) [1]. Recently, six clades were added to this species complex, two from Central America, three from Latin America and one clade associated with the long-migratory bat species Tadarida brasiliensis and Mormoops megalophylla [2].

In the environment, H. capsulatum occurs saprobiotically in soils enriched with nitrogen compounds from bat guanos and bird feces [3,4]. In humans, infection occurs by inhalation of microconidia suspended in the air. Many outbreaks have been reported due to cave visits, soil survey or basement cleaning [3,5–9]. Immunocompetent individuals only develop a mild or asymptomatic form of the disease. On the other hand, immunocompromised patients may develop progressive disseminated histoplasmosis (PDH), which usually affects brain, bone marrow, lymph nodes and liver [10].

Despite the remarkable phylogenetic diversity of H. capsulatum, no clinical difference among the different cryptic species has been reported so far. Furthermore, the symptoms of disseminated histoplasmosis are nonspecific, such as fever, cough, weight loss, diarrhea, adynamia, hepatosplenomegaly, hypotension, chills, skin rashes and, in severe cases, altered mental status and respiratory failure [11,12]. Since other systemic diseases such as tuberculosis and other mycoses may also present some of these symptoms, clinical diagnosis is inconclusive [13–16].

The gold standard diagnosis of histoplasmosis is the isolation of its etiological agent in culture medium, followed by microscopic characterization of the mold and its thermal dimorphism. However, these methodologies may require many weeks or months for a conclusive diagnosis [17]. On the other hand, serological assays in urine or serum can be a powerful tool for the rapid diagnosis of histoplasmosis. Nevertheless, such assays are not affordable in developing countries. Also, these assays can vary in sensitivity according to sample source and clinical aspects of the disease [18,19] and may present low specificity due to cross-reactivity with Coccidioides spp, Paracoccidioides spp, Blastomyces spp and Penicillium marneffei [18,20,21].

In order to ensure both sensitivity and specificity, many Nucleic Acid Amplification Techniques (NAT) have been applied to the diagnosis of histoplasmosis, such as conventional PCR [22,23], nested PCR (nPCR) [24–26] and real time quantitative PCR (qPCR) [27–29]. Nevertheless, all NATs require specific equipment, well-trained experts and are not suitable for resource-limited laboratories. For these reasons, Isothermal Nucleic Acid Amplification Techniques (INAT) are more suitable alternatives for molecular diagnosis of infectious diseases. Heretofore, there are two INATs applied to the detection of H. capsulatum in clinical samples: a Loop-mediated Isothermal Amplification (LAMP) targeting the single-copy gene Hcp100 [30] and a Rolling Circle Amplification (RCA) of the Internal Transcribed Spacer (ITS) region [31]. The Hcp100 LAMP is specific for H. capsulatum sensu lato, although the use of a single-copy gene as a target may contribute to some discrepancies observed for detection of the pathogen in urine specimens [30]. Although the RCA technique targets the Internal Transcribed Spacer (ITS) which is a multicopy region, this method requires a previous PCR step for isolation of the target to be recognized by the padlock probes, which makes this technique as limiting as conventional NATs.

LAMP is a highly efficient, sensitive, specific and cost-effective isothermal amplification method that uses at least four primers, recognizing six different regions in the target sequence and results in a self-primed DNA. [32]. Forward Inner Primer (FIP) and Backward Inner Primer (BIP) have inverted sequences attached at the 5’ end, named F1c and B1c, which are complementary to an internal sequence from the amplified strand, forming a loop at each extremity of a single strand DNA. The outer primers (F3 and B3) anneal upstream to the FIP and BIP, acting as a binding site for DNA polymerase, which, in the LAMP reaction, also contains the strand displacement activity. In addition, LAMP results can be observed using several strategies with minimal ambiguity, including real-time turbidimetry (magnesium pyrophosphate formation) [33], fluorescent compounds (Sybr Green, Eva Green, SYTO, calcein) [34], magnesium colorimetric titration (hydroxynaphtol blue) [35], fluorescent-labeled probes/quencher-labeled primers [36], dye-labeled primers [37] and pH-sensitive dyes [38].

In this work, new LAMP primers were developed for H. capsulatum sensu lato detection in clinical samples. To increase the reaction sensitivity, the ITS region was used as target, since it is a multicopy sequence and also because it is considered an important barcoding sequence for fungal identification, being conserved among H. capsulatum strains and divergent from other fungi, ensuring high specificity [39–44]. In order to compare the efficiency of LAMP and NAT, we also designed two primer sets for nPCR targeting the same genomic region (ITS) of H. capsulatum. Our results indicate that LAMP targeting the ITS region is a powerful and reliable high-sensitivity tool for the diagnosis of histoplasmosis, mainly in resource-limited laboratories.

Methods

Ethics statement

The study protocol was approved by the Ethics Committee of Federal University of Rio Grande do Norte under protocol number CAAE:39640614.8.0000.5537. All specimens were collected for the routine diagnosis of subjects admitted at Giselda Trigueiro Hospital during this study. Written consent was obtained from all patients and healthy individuals. All samples were anonymized for use in this study.

Clinical specimens: Collection, culture and DNA extraction

Twenty-six bone marrow and one whole blood specimens were prospectively and consecutively obtained from HIV/AIDS patients, with symptoms of PDH, admitted at Giselda Trigueiro Hospital in Natal, Rio Grande do Norte state, Brazil, from July 2015 to July 2018. Additionally, 5 whole blood specimens were obtained from healthy subjects. Symptoms of PDH include: fever (≥ 38°C) and one or more of those following signs: adenomegaly, hepatosplenomegaly, pulmonary infiltrate, pancytopenia and splenic microabscesses. Samples were drawn at admission for Histoplasma culture on Sabouraud Dextrose Agar medium (SDA) with chloramphenicol (50 mg/L) and incubated at 25°C. All specimens were collected and immediately cultured before being transferred to EDTA tubes and sent to the Mycology Laboratory of the Institute of Tropical Medicine of RN, Brazil, where 100 μL of the sample was again cultivated on SDA medium with chloramphenicol (50 mg/L), under sterile conditions, and incubated at 25°C. The remaining specimen was stored at -80°C, until DNA extraction. Culture was maintained for 120 days or until fungal growth was observed. The diagnosis of histoplasmosis was confirmed only after morphological visualization of fungal micro and macro conidia.

The DNA was extracted from clinical specimens using 100 μL of the sample with the DNeasy Blood & Tissue kit (Qiagen, Inc., Hilden, Germany) according to the manufacturer's instructions. Briefly, the sample was incubated with 20 μL of proteinase K (100 mg/ml) and 200 μL Buffer AL at 56°C for 10 min. The lysate was precipitated with ethanol P.A. and placed into a DNeasy Mini Spin column, followed by two wash steps. DNA was eluted in nuclease-free water and stored at -20°C. All samples were renamed before molecular assays for blind evaluation to avoid confirmatory bias. Standards for Reporting of Diagnostic Accuracy (STARD) flow chart of subjects and checklist are provided in S1 Fig and S1 Checklist, respectively.

DNA extraction from fungal cultures

DNA was extracted from H. capsulatum strains isolated in this work and from negative fungal controls (Table 1), according to McCullough et al (2000) [45], with some modifications as follows: after 3–5 days of fungal growth on SDA medium, about 2 to 3 mold fragments, 1 cm2 each, were transferred to a sterile mortar and frozen with liquid nitrogen. The material was triturated and transferred to a 1.5 ml tube containing 500 μL of lysis buffer (50 mM Tris HCl, 50 mM EDTA, 2% SDS) and then incubated at 65°C for 60 min. After incubation, 500 μL of 5M potassium acetate were added to the mixture and the lysate was maintained at -20°C overnight. The material was centrifuged at 13,000 x g for 10 min and the supernatant transferred to a new 1.5 ml tube containing 600 μL of cold ethanol P.A. After centrifugation at 13,000 x g for 10 min, the supernatant was discarded, and the DNA was incubated at 65°C for 60 min to dry. Finally, DNA was solubilized in 60 μL of nuclease-free water and stored at -20°C.

Table 1. Fungi used as specificity controls in ITS LAMP and nPCR assays.

Fungal species DNA amount PCR panfungal ITS LAMP ITS nPCR
Aspergillus niger 20 ng + - -
Aspergillus flavus 20 ng + - -
Candida spp. 20 ng + - -
Cladophialophora carrionii 20 ng + - -
Cryptococcus gattii 20 ng + - -
Cryptococcus neoformans 20 ng + - -
Histoplasma capsulatum 20 ng + + +
Microsporum canis 20 ng + - -
Paracoccidioides brasiliensis 20 ng + - -
Sporothrix brasiliensis 20 ng + - -
Trichophyton mentagrophytes 20 ng + - -
Trichosporon spp. 20 ng + - -

LAMP primer set design and reaction

Ninety-eight H. capsulatum ribosomal RNA (18S - ITS1–5.8S - ITS2 - 28S) sequences were obtained from the GenBank (see Accession number section) database and aligned by ClustalW, available in MEGA (version 7.0) [46–48]. The consensus sequence was generated in BioEdit (version 7.0.2) considering 95% identity among all sequences. The LAMP primer set was manually designed within conserved regions of ITS1 (Table 2 and Fig 1) according to Notomi et al. (2000) [32] and following the guidelines of the "A Guide to LAMP Primer Designing (Primer Explorer V4)" (Eiken Chemical Co., Ltd., Tokyo, Japan) (https://primerexplorer.jp/e/v4_manual/index.html).

Table 2. Primers used in LAMP and nPCR assays for H. capsulatum detection.

Primer Sequence (position‡) Reference
Hc_F3 TACCCGGCCACCCTTGTC (62–79) This work
Hc_FIP GGAIAAGITCCCCCGGCAGTACCGGACCTGTTGCITCG (80–134)
Hc_B3 ATGTCGGAACCAAGAGATCC (236–255)
Hc_BIP CCGTCGGTGAAYGATTGGCGGTTGTTGAAAGTTTTGACTGGA (171–235)
ITS_HcI TGTCTACCGGACCTGTTGC (76–94) This work
ITS_HcII CCACCCATTTGGAGCTGCA (839–857)
ITS_HcIII AGAGCGATAATAATCCAGTC (201–220)
ITS_HcIV GATATGCTTAAGTTCAGCG (580–598)
Hc I GCGTTCCGAGCCTTCCACCTCAAC Reference [24]
Hc II ATGTCCCATCGGGCGCCGTGTAGT
Hc III GAGATCTAGTCGCGGCCAGGTTCA
Hc IV AGGAGAGAACTGTATCGGTGGCTTG

‡ according the accession number AF038353.1

Fig 1. Illustrative diagram showing the hybridization regions of ITS LAMP and nPCR primer sets.

Fig 1

SSU, small ribosomal subunit (18S); ITS, Internal Transcribed Spacer; LSU, large ribosomal subunit (28S).

LAMP reaction was carried out in a final volume of 12.5 μL, containing 1x Bsm reaction buffer [20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% (v/v) Tween 20], 4 U of Bsm polymerase (Thermo Fisher Scientific, Inc., Massachusetts, EUA), 1.6 μM of each inner primer (Hc_FIP and Hc_BIP), 0.4 μM of each outer primer (Hc_F3 and Hc_B3), 2.8 mM of each dNTP, 0.6 M of betaine, 10 mM of magnesium sulfate and 2 μL of DNA. The reaction mixture was heated at 95°C for 2 min, followed by cooling on ice, prior to the addition of the Bsm polymerase. The reaction was incubated at 60°C for 120 min. Bsm polymerase was inactivated at 80°C for 10 min. LAMP products were observed after electrophoresis on 1.5% agarose gel stained with ethidium bromide or by addition of 1 μL of 10-fold diluted Sybr Green I dye (Lonza, Inc., Basel, Switzerland) to the reactions. For positive amplification reactions the dye color changes from orange to green under white or UV light.

ITS nPCR primer set design and reaction

As for LAMP, the ITS nPCR primer set was designed within conserved regions, specific for H. capsulatum sensu lato. The outer primers (ITS_HcI and ITS_HcII) flank 781 bp of 5.8S-ITS2 and the inner primers (ITS_HcIII and ITS_HcIV) amplify a 397 bp fragment (Table 2 and Fig 1).

The first reaction was carried out in a final volume of 12.5 μL, containing 1x HF buffer (containing 1.5 mM MgCl2), 100 μM of each dNTP, 0.1 μM of each outer primer (ITS_HcI and ITS_HcII), 3% DMSO, 0.25 U of Phusion High-Fidelity DNA polymerase (New England BioLabs, Inc., Massachusetts, USA) and 2 μL of DNA. Thermal cycling was performed in a Veriti 96-well thermal cycler (Applied Biosystems, Inc, California, USA), as follows: 98°C for 30 sec; 40 cycles of 98°C for 10 sec, 64°C for 30 sec, 72°C for 30 sec; and a final extension at 72°C for 5 min. The second reaction mix was identical to the first, except for use of 0.2 μM of each inner primer (ITS_HcIII and ITS_HcIV), 50 μM of each dNTP, and 1 μL of the first reaction product as template. The thermal cycling conditions were: 98°C for 30 sec; 30 cycles of 98°C for 10 sec, 60°C for 30 sec, 72°C for 20 sec; and a final extension at 72°C for 5 min. Amplicons were observed after electrophoresis on 1.5% agarose gel stained with ethidium bromide.

Hcp100 nPCR reaction

In order to ensure the presence of Histoplasma DNA in clinical specimens, Hcp100 nPCR [24,25] was carried out with the modifications suggested by Taylor et al. (2005) [5]. The first reaction was performed in a final volume of 12.5 μL, containing 1x CG buffer (containing 1.5 mM MgCl2), 200 μM of each dNTP, 0.2 μM of each outer primer (Hc I and Hc II), 0.25 U of Phusion High-Fidelity DNA polymerase (New England BioLabs, Inc., Massachusetts, USA) and 2 μL of DNA. The thermal cycling conditions were: 98°C for 30 sec; 40 cycles of 98°C for 10 sec, 50°C for 30 sec, 72°C for 30 sec; and a final extension at 72°C for 5 min. The second reaction was identical to the first, except for use of 0.2 μM of each inner primer (Hc III and Hc IV), 50 μM of each dNTP and 1 μL of the first reaction product as template. The thermal cycling conditions were: 98°C for 30 sec; 40 cycles of 98°C for 10 sec, 68°C for 30 sec, 72°C for 30 sec; and a final extension at 72°C for 5 min. Amplicons were observed after electrophoresis on 1.5% agarose gel stained with ethidium bromide.

GAPDH PCR reaction

To ensure that DNA extracted from clinical specimens was intact and amplifiable, the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) gene was used as a housekeeping reference control. The reaction was performed in a final volume of 12.5 μL, containing 1x GoTaq Reaction Buffer (containing 1.5 mM MgCl2), 200 μM of each dNTP, 0.2 μM of forward GAPDH primer (5’–CAAGGTCATCCATGACAACTTTG–3’) and reverse GAPDH primer (5’–GTCCACCACCCTGTTGCTGTAG-3’) from the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific), 0.25 U of GoTaq DNA polymerase (Promega, Co., Wisconsin, USA) and 2 μL of DNA. The thermal cycling conditions were: 95°C for 3 min; 35 cycles of 95°C for 30 sec, 58°C for 30 sec, 72°C for 45 sec; and a final extension at 72°C for 10 min.

Limit of detection and reproducibility

To determine the limit of detection (LOD) of both ITS LAMP and nPCR, H. capsulatum DNA was diluted 10-fold (from 10 ng/μL to 0.1 fg/μL) and assayed. Four to six technical replicates were performed for dilutions from 10 pg/μL to 0.1 fg/μL in order to determine the assays reproducibility. DNA concentration was determined using the fluorometer Qubit 2.0 (Thermo Fisher Scientific, Inc., Massachusetts, USA) according to the manufacturer's instructions. Considering the genome length of H. capsulatum is 33.03 Mb (accession number: GCA_000149585.1) and one base pair equals 660 g/mol, the number of detected genomes of H. capsulatum was determined by using the following formula: Genome copies = (amount of DNA x 6.022 x 1023) / (genome length x 660 x 109).

Specificity assay

ITS nPCR and LAMP assays were conducted with 20 ng of DNA per reaction from clinical isolates and from reference strains of pathogenic fungi. All controls were also PCR-amplified with the panfungal primers ITS4 (5'-TCCTCCGCTTATTGATATGC-3') and ITS5 (5'-GGAAGTAAAAGTCGTAACAA-3'), described by White et al. (1990) [49] to ensure DNA quality. Table 1 shows the fungal species used as specificity controls for ITS LAMP and nPCR.

Direct ITS LAMP and ITS nPCR assays

To perform the ITS LAMP and nPCR as direct assays, yeast cells of H. capsulatum were serially diluted from 104 yeasts/μL to 1 yeast/μL in either PBS or heparin-containing whole blood from a healthy control. Stored bone marrow samples were not suitable for this assay, since freezing ruptures the cellular membranes. Yeasts in PBS were heat-treated at 100°C for 10 minutes before being assayed. One microliter of each dilution was directly assayed in ITS LAMP and nPCR without any previous DNA extraction or purification steps.

Statistical analysis

McNemar’s test exact p-value was used to evaluate the difference in sensitivity between diagnostic methods. P-value > 0.05 was assumed as not statistically significant. The kappa statistic was calculated to evaluate the agreement between the reference and herein proposed methods for H. capsulatum detection in clinical samples [50]. The interpretation for kappa values was as follow: 0.00–0.20, poor agreement; 0.21–0.40, fair agreement; 0.41–0.60, moderate agreement; 0.61–0.80, good agreement; 0.81–1.00, excellent agreement [50]. Clinical sensitivity, specificity and predictive values were inferred using culture or Hcp100 nPCR as reference.

Accession numbers

KF443065.1; JQ218359.1; JQ218358.1; JQ218357.1; JQ218356.1; JQ218355.1; JQ218354.1; JQ218353.1; JQ218352.1; JQ218351.1; JQ218350.1; JQ218349.1; JQ218348.1; JQ218347.1; JQ218345.1; JQ218344.1; JQ218343.1; JQ218342.1; JQ218341.1; JQ218340.1; JQ218339.1; JQ218338.1; JQ218337.1; JQ218336.1; JQ218335.1; HM439693.1; FJ011535.1; KC693555.1; KC693554.1; KC693553.1; KC693552.1; KC693551.1; KC693550.1; KC693549.1; KC693548.1; KC693547.1; KC693546.1; KC693545.1; KC693544.1; KC693540.1; KC693541.1; KC693542.1; KC693543.1; KC693539.1; KC693538.1; KC693537.1; KC693536.1; KC693535.1; KC693530.1; KC693531.1; KC693532.1; KC693533.1; KC693534.1; KC693529.1; KC693528.1; KC693527.1; KC693526.1; KC693525.1; KC693524.1; KC693523.1; KC693522.1; KC693521.1; KC693520.1; KC693519.1; KC693518.1; KC693517.1; KC693516.1; KC693515.1; KC693514.1; KC693513.1; KC693512.1; KC693511.1; KC693510.1; KC693507.1; KF724850.1; KF724849.1; KF724848.1; KF724847.1; KF724846.1; KF724845.1; KF724844.1; KF724843.1; KF724842.1; AF322387.1; AF322386.1; AB071831.1; AB071828.1; AF322385.1; AF322384.1; AF322383.1; AF322382.1; AF322381.1; AF322380.1; AF322379.1; AF322378.1; AF322377.1; AF038354.1; AF038353.1.

Results

LAMP primer set design

According to the alignment of 98 sequences of rDNA from H. capsulatum, the ITS 1 region was shown to be the most conserved for design of the LAMP primer set. However, due to some polymorphisms in this region, three inosines were inserted in the primer Hc_FIP and one degenerate base in the primer Hc_BIP (Table 2 and S2 Fig).

Limit of detection and reproducibility

As shown in Fig 2, both ITS LAMP and nPCR can detect down to 1 fg/μL of H. capsulatum DNA. However, reproducible detection only occurs down to 100 fg/μL (Table 3).

Fig 2. The LOD of ITS LAMP and nPCR for different concentrations (from 10 ng/μL to 0.1 fg/μL) of H. capsulatum DNA.

Fig 2

A: ITS LAMP products in 1.5% agarose gel stained with ethidium bromide; B: ITS LAMP product observed by addition of Sybr Green I in the reaction tube under white light and UV light, respectively; C: ITS nPCR product in 1.5% agarose gel stained with ethidium bromide; NT: No Template control.

Table 3. Reproducibility of the Limit of Detection for ITS LAMP and nPCR assays.

Dilution ITS LAMP ITS nPCR
1 pg/μL 100% (6/6) 100% (6/6)
100 fg/μL 100% (6/6) 100% (6/6)
10 fg/μL 83% (5/6) 83% (5/6)
1 fg/μL 33% (2/6) 33% (2/6)
0.1 fg/μL 0% (0/4) 0% (0/6)

Validation and assay specificity

The ITS LAMP and nPCR showed no cross-reactivity when assayed with DNA from other pathogenic or environmental fungi (Table 1). Therefore, these two methods specifically detect H. capsulatum DNA (Fig 3). Sequences from some fungi not available in our lab were accessed in the GenBank Data Base and aligned with each primer, ensuring that ITS LAMP and nPCR primers recognize only H. capsulatum DNA sequence, even when compared to evolutionarily closely-related fungi, such as P. brasiliensis, Blastomyces dermatitidis and Coccidioides spp (S3 Fig). Moreover, both methods were able to detect isolates from all geographical clades described by Kasuga et al. (2003), including Histoplasma capsulatum var. duboisii, from the African clade. However, the Eurasian and Australian clades were not available in our laboratory to test (S1 Table).

Fig 3.

Fig 3

Specificity assay for ITS LAMP (A) and ITS nPCR (B). NT, No Template; Af, Aspergillus flavus; An, Aspergillus niger; Ca, Candida spp; Cc, Cladophialophora carrionii; Cg, Cryptococcus gattii; Cn, Cryptococcus neoformans; Hc, Histoplasma capsulatum; Mc, Microsporum canis; Pb, Paracoccidioides brasiliensis; Sb, Sporothrix brasiliensis; Tm, Trichophyton mentagrophytes; Tri, Trichosporon spp.

Biological specimens

Twenty-six bone marrow and one whole blood specimens were obtained from patients with HIV/AIDS from Giselda Trigueiro Hospital (Table 4). Group A (n = 11) represents culture-positive histoplasmosis patients, whereas those patients who had symptoms of PDH, but negative culture for Histoplasma, were allocated to group B (n = 16). Heathy control patients were allocated to group C (n = 5).

Table 4. Results of molecular assays and culture of the clinical samples from patients suspected of PDH admitted at Giselda Trigueiro Hospital in Natal, Rio Grande do Norte State, Brazil.

Sample Group Sample type DNA amount Hcp100nPCR ITS nPCR ITS LAMP Fungal culture (strain) Coinfection
HGT028 A BM 88 ng - + - H. capsulatum (HC-2) HIV, DTB
HGT039 A BM 71 ng + - - H. capsulatum (HC-3) HIV, PTB
HGT056 A BM 100 ng + + + H. capsulatum (HC-4) HIV
HGT048 A BM 100 ng + + + H. capsulatum (HC-5) HIV
HGT068 A BM 100 ng - - - H. capsulatum (HC-6) HIV
HGT074 A BM 100 ng + + + H. capsulatum (HC-7) HIV
HGT075 A BM 56 ng - + + H. capsulatum (HC-8) HIV
HGT072 A BM 100 ng + + + H. capsulatum (HC-9) HIV
HGT079 A BM 111 ng - - - H. capsulatum (HC-10) HIV
HGT083 A BM 88 ng - - - H. capsulatum (HC-11) HIV
HGT087 A WB 128 ng + + + H. capsulatum (HC-12) HIV, DTB
HGT082 B BM 128 ng - - - - VLS
HGT032 B BM 100 ng - - - Cryptococcus spp. HIV
HGT038 B BM 66 ng - - - Cryptococcus spp. HIV
HGT061 B BM 109 ng - - + - HIV, TB
HGT052 B BM 107 ng - - - - HIV
HGT054 B BM 100 ng - - - - HIV
HGT055 B BM 100 ng - - - - HIV
HGT057 B BM 100 ng - - - - HIV
HGT058 B BM 59 ng - - - - HIV
HGT059 B BM 110 ng - - - - NA
HGT062 B BM 100 ng - - - - HIV, VLS
HGT063 B BM 32 ng - - - - NA
HGT069 B BM 74 ng - - - - HIV, VLS
HGT070 B BM 100 ng - - - - HIV, DTB
HGT071 B BM 54 ng - - - - HIV
HGT073 B BM 100 ng - - - - HIV
C1 C WB 91 ng - - - - NA
C2 C WB 26 ng - - - - NA
C3 C WB 120 ng - - - - NA
C4 C WB 105 ng - - - - NA
C5 C WB 106 ng - - - - NA

BM, bone marrow; WB, whole blood; HIV, human immunodeficiency virus; TB, tuberculosis; VLS, visceral leishmaniasis; PTB, pulmonary tuberculosis; DTB, disseminated tuberculosis; NA, not available; +, positive; -, negative.

The median time for growth and morphological identification of H. capsulatum in culture was 28 ± 34.2 days (median ± standard deviation; ranging from 16 to 119 days). Morphologically-characterized H. capsulatum isolated on culture was confirmed by Hcp100 PCR using the primers Hc III and Hc IV as previously described [24,25].

The ITS LAMP and ITS nPCR presented a sensitivity of 54% (6/11) and 64% (7/11) and a specificity of 95% (20/21) and 100%, respectively, when the culture results were used as reference. (Table 5). When the Hcp100 nPCR was used as reference, both ITS LAMP and nPCR reached 83% (5/6) and 92% (24/26) sensitivity and specificity, respectively (Table 6). The GAPDH gene, used as internal control, was amplified in all clinical specimens (S4 Fig).

Table 5. Comparison of sensitivity and specificity parameters of the molecular methods used in this work to detect H. capsulatum in biological samples using culture as reference.

ITS nPCR ITS LAMP
Sensitivity 0.64 0.54
Specificity 1.00 0.96
Positive Predictive Value (PPV) 1.00 0.86
Negative Predictive Value (NPV) 0.85 0.81
kappa statistic 0.88 0.82
MacNemar’s test Exact p-value 0.13 0.22

Table 6. Comparison of sensitivity and specificity parameters of culture, ITS LAMP and nPCR methods for detection of H. capsulatum in biological samples, using Hcp100 nPCR as reference.

ITS nPCR ITS LAMP
Sensitivity 0.83 0.83
Specificity 0.93 0.93
Positive Predictive Value (PPV) 0.71 0.71
Negative Predictive Value (NPV) 0.96 0.96
kappa statistic 0.91 0.91
MacNemar’s test Exact p-value 1.00 1.00

Direct assays

To evaluate the performance of ITS LAMP and nPCR as direct assays, without previous DNA extraction, heat-treated PBS and heparin-containing whole blood spiked with H. capsulatum yeasts were used. Both ITS LAMP and nPCR assays were able to detect as few as 10 yeast cells in either PBS and whole blood samples (Figs 4 and 5). Moreover, LAMP allowed immediate evaluation of the reaction results by addition of SYBR Green I after incubation (Fig 4B and 4D).

Fig 4. ITS LAMP on crude samples spiked with different concentrations of alive H. capsulatum yeasts.

Fig 4

In A and B, yeasts were diluted in PBS, heat-treated and assayed. In C and D, yeasts were diluted in heparin-containing whole blood and direct assayed. ITS LAMP products were visualized on an agarose gel stained with ethidium bromide (A and C) and by addition of Sybr Green I, under UV and white lights (B and D).

Fig 5. ITS nPCR on crude samples spiked with different concentrations of live H. capsulatum yeasts.

Fig 5

In A, yeasts were diluted in PBS, heat-treated and assayed. In B, yeasts were diluted in heparin-containing whole blood and direct assayed by ITS nPCR. The amplification of a fragment of 397 bp was considered a positive reaction.

Cost and time consumption

The cost expended by both techniques was very close, but the ITS LAMP assay was slightly less expensive than nPCR. For the entire procedure, nPCR cost was USD 8.03/sample, whereas LAMP cost was USD 7.82/sample, but with the great added advantage of not requiring a thermocycler or an electrophoresis apparatus (Fig 6). The DNA extraction step represents 90.4% and 88.2% of the LAMP and nPCR total cost, respectively. When LAMP and nPCR were applied as direct assays, without DNA extraction and purification steps, the total cost was USD 0.75 for LAMP and USD 0.95 for nPCR.

Fig 6.

Fig 6

Cost (A) and time (B) consumed for ITS LAMP and nPCR assays.

When analyzing the time required to perform each technique, LAMP was performed in less than 200 minutes whereas nPCR took at least 300 minutes (Fig 6). These results show that LAMP is faster and less expensive than nPCR to detect H. capsulatum.

Discussion

Recent estimates indicate there are approximately 100,000 annual cases of PDH in AIDS patients worldwide, from which 80% result in death [51]. This high mortality rate is mainly due to the lack of adequate treatment, which can only be achieved with a fast and efficient diagnosis. However, clinical symptoms, radiological and routine laboratory tests are nonspecific and histoplasmosis is often misdiagnosed as drug-resistant tuberculosis or pneumocystosis [52–55]. In fact, delayed diagnosis of PDH is an important cause of the high mortality rate in South America [55–57]. Among people living with HIV, histoplasmosis is an important AIDS-related infectious disease in endemic Latin American countries, killing even more than tuberculosis [58].

Here we observed that morphological identification of H. capsulatum in culture took a relatively long period (median ± SD; 28 ± 34.2 days) due to fastidious fungal growth and late production of asexual reproduction structures (micro and macro conidia). Molecular methods, on the other hand, allow more rapid detection and identification of H. capsulatum in biological specimens. However, PCR-based diagnostic methods are not available in resource-limited laboratories, because it demands specific apparatus, including a thermocycler, electrophoresis device and UV light source. LAMP seems to represent a suitable alternative to this problem, because it is an isothermal nucleic acid amplification technique which can be performed with a simple water bath, at 60°C for 2 hours, providing a cost-effective early diagnosis and contributing to the decrease of histoplasmosis mortality rate, since patients with PDH usually die in 10–14 days [51].

Scheel et al (2014) have proposed a specific LAMP assay targeting the gene Hcp100, a 100 kDa protein-encoding gene of H. capsulatum. The LOD for this assay ranged from 10 fg/μL to 10 pg/μL of H. capsulatum DNA, achieving 67% of sensitivity in culture-proven urine specimens [30]. Both ITS LAMP and nPCR, proposed here, presented a LOD of 1 fg/μL. However, 100% reproducibility of these two assays was only achieved at 100 fg/μL. This result was expected, because the whole genome of H. capsulatum has approximately 33 fg, therefore, 10 fg of H. capsulatum DNA represents less than one genome and thus the assay sensitivity might be decreased.

Despite this low LOD, the ITS LAMP and nPCR achieved 54% and 64% of sensitivity in clinical specimens, respectively, when compared to culture. Likely, the lack or minimal amount of fungal DNA dispersed among the relatively abundant host DNA may contribute to the low sensitivity. The excellent agreement between ITS LAMP and ITS nPCR with Hcp100 nPCR (0.91 for both assays; see Table 6), the molecular reference assay used, confirmed there was a lack or minimal amount of fungal DNA in some samples, producing false negative results in the molecular analyses.

In this study, we used the Hcp100 nPCR as a molecular reference, due to its high specificity (PPV) [59] and because this gene has been the main target sequence used in many other studies on molecular detection of H. capsulatum [25,60,61]. The lower specificity of the LAMP assay in comparison with culture was caused by a false positive (sample HGT061) result of the subject HGT061 from group B. Although all reactions were carefully carried out in a sterile environment and analyzed in a separate room to avoid cross-contamination with previous LAMP or nPCR products, opening the reaction tubes after the LAMP has run, to perform analysis in electrophoresis or addition of Sybr Green, may create a risk of contamination. This could be the reason for the false positive result in patient HGT061. On the other hand, the patient HGT061 was treated with sulfamethoxazole + trimethoprim (SMX-TMP) 800 mg + 160 mg/day for 21 days and fluconazole 150 mg/day for 7 days, and showed a favorable outcome. Since SMX-TMP is known to be efficient for histoplasmosis treatment, as demonstrated in vivo [62] and in vitro [63], we cannot completely rule out the possibility of histoplasmosis in this subject.

The samples HGT028, HGT039, HGT068, HGT079 and HGT083 provided inconsistent results among molecular assays and culture. To investigate, first we sequenced these isolates to verify the presence of any polymorphisms in ITS region. The sequences showed no polymorphisms in the annealing region of our primers. Further, to rule out the presence of an amplification inhibitor, 2 ng of H. capsulatum DNA was added in each sample and the reactions became positive. LAMP and nPCR are robust methods that may detect minimal amounts of DNA, but the difficulty of extracting high-quality fungal DNA from biological specimens is still a challenging step, as observed by Scheel et al (2014) analyzing urine specimens using LAMP assay. We speculate that loss of DNA during extraction caused such inconsistent results.

In order to test these two molecular methods as direct assays for fast screening of PDH, samples spiked with H. capsulatum cells were analyzed without any previous DNA extraction or purification steps. Amplification was not inhibited when approximately 5% of heparin-containing whole blood was added in the reaction. However, EDTA-containing whole blood completely inhibited the ITS LAMP reaction by quelling magnesium ions. In fact, magnesium sulfate concentrations below 10 mM provided no amplification, while concentrations above 14 mM increased the rate of false-positives. LAMP has been applied in some studies as a direct screening assay in crude samples [64–66]. We have used whole blood in a direct assay because it is a less invasive sampling method and could provide better results since there is less DNA from the patient. Although this assay does not represent a real clinical specimen, since H. capsulatum is an intracellular pathogen, it shows us whether sample inhibitors could interrupt the reaction as well as whether the assays could be used directly on heparin-containing specimens. Hayashida and coworkers (2017) described a direct LAMP assay to detect Plasmodium falciparum and non-falciparum in heparin-containing whole blood samples. Curiously, the direct assay was more sensitive than conventional methods using purified blood DNA [66]. Although heparin is a well-known PCR inhibitor, a dilution of 20-fold of collected specimen in LAMP reaction is sufficient to obtain reliable results in the LAMP assay [67].

This is the first application of LAMP and nPCR using the ITS multicopy region to detect H. capsulatum in biological specimens. The ITS LAMP and the ITS nPCR were both able to detect H. capsulatum DNA with a low LOD, even when crude heparin-containing whole blood was used. Despite the low LOD achieved, these methods should not substitute fungal culture isolation as the gold standard in PDH diagnosis, since false negative results may occur due to lack of, or minimal amount of, fungal DNA in the sample, yet ITS LAMP has the potential for use in conjunction with culture for early diagnosis of PDH. Moreover, our results point to the possibility of direct pathogen detection in biological specimens for the diagnosis of PDH in HIV patients and in general histoplasmosis clinical conditions. However, more clinical specimens should be evaluated by ITS LAMP and nPCR to analyze the sensitivity in a broader range of clinical samples and for validation of the direct assay. In addition, sensitivity and specificity may be improved by optimizing DNA extraction methods, which include appropriate fungal cell wall breakdown, and adopting closed-tube strategies to evaluate LAMP results to avoid cross-contamination, such as pH-sensitive dyes or turbidimeter. Outside of clinical applications, these primers set could also be used to improve our knowledge about the epidemiology of H. capsulatum by its environmental detection.

Supporting information

S1 Checklist. Standards for Reporting of Diagnostic Accuracy (STARD) checklist.

(PDF)

S1 Fig. Standards for Reporting of Diagnostic Accuracy (STARD) flow chart of the 27 suspected histoplasmosis cases enrolled in the study.

(PDF)

S2 Fig. Annealing sites of the ITS LAMP and nPCR primer sets.

Hc_F2 and Hc_F1 are different annealing regions of the Hc_FIP primer. Hc_B2 and Hc_B1 are annealing regions of the Hc_BIP primer. Gray letters represent ITS 1 and ITS 2 regions, respectively, and black letters represent 5.8S and LSU ribosomal RNA coding sequences, respectively, as showed in Fig 1.

(PDF)

S3 Fig. Alignment of the ITS LAMP and nPCR primers set with ribosomal DNA from pathogenic and environmental fungal species.

(PDF)

S4 Fig. Agarose gel of GAPDH PCR product from biological specimens.

(PDF)

S1 Table. Reference strains of H. capsulatum from different clades used for validation of ITS LAMP and nPCR assays.

(PDF)

Acknowledgments

We thank Dr. Lucymara Fassarella and Dr. Silvia Regina Batistuzzo for sharing their laboratory space and to Dr. Christina M. Scheel, Dr. Marcus de M. Teixeira and physician Hareton Teixeira Vechi for important advice. We also thank Dr. Breanna Scorza for reviewing the English grammar of the manuscript.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was funded by National Council for Scientific and Technological Development (CNPq No 401513/2016-5) project grant to RCT. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Kasuga T, White TJ, Koenig G, Mcewen J, Restrepo A, Castaneda E, et al. Phylogeography of the fungal pathogen Histoplasma capsulatum. Mol Ecol. 2003;12: 3383–3401. 10.1046/j.1365-294X.2003.01995.x [DOI] [PubMed] [Google Scholar]
  • 2.Teixeira M de M, Patané JS, Taylor ML, Gómez BL, Theodoro RC, de Hoog S, et al. Worldwide phylogenetic distributions and population dynamics of the genus Histoplasma. PLoS Negl Trop Dis. 2016;10: e0004732 10.1371/journal.pntd.0004732 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cury GC, Diniz Filho A, Cruz AG da C, Hobaika AB de S. Outbreak of histoplasmosis in Pedro Leopoldo, Minas Gerais, Brazil. Rev Soc Bras Med Trop. 2001;34: 483–486. [DOI] [PubMed] [Google Scholar]
  • 4.Colombo AL, Tobón A, Restrepo A, Queiroz-Telles F, Nucci M. Epidemiology of endemic systemic fungal infections in Latin America. Med Mycol. 2011; 1–14. 10.3109/13693786.2010.492482 [DOI] [PubMed] [Google Scholar]
  • 5.Taylor ML, Ruíz-Palacios GM, Rocí-o Reyes-Montes M, Rodrí-guez-Arellanes G, Carreto-Binaghi LE, Duarte-Escalante E, et al. Identification of the infectious source of an unusual outbreak of histoplasmosis, in a hotel in Acapulco, state of Guerrero, Mexico. FEMS Immunol Med Microbiol. 2005;45: 435–441. 10.1016/j.femsim.2005.05.017 [DOI] [PubMed] [Google Scholar]
  • 6.Peçanha Martins AC, Costa Neves ML, Lopes AA, Querino Santos NN, Araújo NN, Matos Pereira K. Histoplasmosis presenting as acute respiratory distress syndrome after exposure to bat feces in a home basement. Braz J Infect Dis Off Publ Braz Soc Infect Dis. 2000;4: 103–106. [PubMed] [Google Scholar]
  • 7.Martins EML, Marchiori E, Damato SD, Pozes AS, Silva ACG da, Dalston M. Acute pulmonary histoplasmosis: report of an outbreak. Radiol Bras. 2003;36: 147–151. 10.1590/S0100-39842003000300005 [DOI] [Google Scholar]
  • 8.Muñoz B, Martínez MÁ, Palma G, Ramírez A, Frías MG, Reyes MR, et al. Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters. BMC Infect Dis. 2010;10: 1 10.1186/1471-2334-10-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Rocha-silva F, Figueiredo SM, Silveira TTS, Assunção CB, Campolina SS, Pena-barbosa JPP, et al. Histoplasmosis outbreak in Tamboril cave—Minas Gerais state, Brazil. Med Mycol Case Rep. 2014;4: 1–4. 10.1016/j.mmcr.2013.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kauffman CA. Histoplasmosis: a Clinical and Laboratory Update. Clin Microbiol Rev. 2007;20: 115–132. 10.1128/CMR.00027-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hajjeh RA, Pappas PG, Henderson H, Lancaster D, Bamberger DM, Skahan KJ, et al. Multicenter case-control study of risk factors for histoplasmosis in human immunodeficiency virus-infected persons. Clin Infect Dis. 2001;32: 1215–1220. 10.1086/319756 [DOI] [PubMed] [Google Scholar]
  • 12.Daher EF, Silva GB, Barros FAS, Takeda CFV, Mota RMS, Ferreira MT, et al. Clinical and laboratory features of disseminated histoplasmosis in HIV patients from Brazil: HIV and disseminated histoplasmosis. Trop Med Int Health. 2007;12: 1108–1115. 10.1111/j.1365-3156.2007.01894.x [DOI] [PubMed] [Google Scholar]
  • 13.Unis G, Severo LC. Chronic pulmonary histoplasmosis mimicking tuberculosis. J Bras Pneumol. 2005;31: 318–324. 10.1590/S1806-37132005000400009 [DOI] [Google Scholar]
  • 14.Adenis A, Nacher M, Hanf M, Basurko C, Dufour J, Huber F, et al. Tuberculosis and Histoplasmosis among Human Immunodeficiency Virus-Infected Patients: A Comparative Study. Am J Trop Med Hyg. 2014;90: 216–223. 10.4269/ajtmh.13-0084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nacher M, Adenis A, Sambourg E, Huber F, Abboud P, Epelboin L, et al. Histoplasmosis or Tuberculosis in HIV-Infected Patients in the Amazon: What Should Be Treated First? PLoS Negl Trop Dis. 2014;8: e3290 10.1371/journal.pntd.0003290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Caceres DH, Tobón AM, Cleveland AA, Scheel CM, Berbesi DY, Ochoa J, et al. Clinical and Laboratory Profile of Persons Living with Human Immunodeficiency Virus/Acquired Immune Deficiency Syndrome and Histoplasmosis from a Colombian Hospital. Am J Trop Med Hyg. 2016;95: 918–924. 10.4269/ajtmh.15-0837 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Arango-Bustamante K, Restrepo A, Cano LE, de Bedout C, Tobon AM, Gonzalez A. Diagnostic Value of Culture and Serological Tests in the Diagnosis of Histoplasmosis in HIV and non-HIV Colombian Patients. Am J Trop Med Hyg. 2013;89: 937–942. 10.4269/ajtmh.13-0117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hage CA, Ribes JA, Wengenack NL, Baddour LM, Assi M, McKinsey DS, et al. A Multicenter Evaluation of Tests for Diagnosis of Histoplasmosis. Clin Infect Dis. 2011;53: 448–454. 10.1093/cid/cir435 [DOI] [PubMed] [Google Scholar]
  • 19.Hage CA, Kirsch EJ, Stump TE, Kauffman CA, Goldman M, Connolly P, et al. Histoplasma Antigen Clearance during Treatment of Histoplasmosis in Patients with AIDS Determined by a Quantitative Antigen Enzyme Immunoassay. Clin Vaccine Immunol CVI. 2011;18: 661–666. 10.1128/CVI.00389-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Durkin MM, Connolly PA, Wheat LJ. Comparison of radioimmunoassay and enzyme-linked immunoassay methods for detection of Histoplasma capsulatum var. capsulatum antigen. J Clin Microbiol. 1997;35: 2252–2255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Connolly PA, Durkin MM, LeMonte AM, Hackett EJ, Wheat LJ. Detection of Histoplasma Antigen by a Quantitative Enzyme Immunoassay. Clin Vaccine Immunol CVI. 2007;14: 1587–1591. 10.1128/CVI.00071-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Guedes HL de M, Guimarães AJ, Muniz M de M, Pizzini CV, Hamilton AJ, Peralta JM, et al. PCR Assay for Identification of Histoplasma capsulatum Based on the Nucleotide Sequence of the M Antigen. J Clin Microbiol. 2003;41: 535–539. 10.1128/JCM.41.2.535-539.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Brilhante RSN, Guedes GM de M, Riello GB, Ribeiro JF, Alencar LP, Bandeira SP, et al. RYP1 gene as a target for molecular diagnosis of histoplasmosis. J Microbiol Methods. 2016;130: 112–114. 10.1016/j.mimet.2016.09.006 [DOI] [PubMed] [Google Scholar]
  • 24.Bialek R, Fischer J, Feucht A, Najvar LK, Dietz K, Knobloch J, et al. Diagnosis and Monitoring of Murine Histoplasmosis by a Nested PCR Assay. J Clin Microbiol. 2001;39: 1506–1509. 10.1128/JCM.39.4.1506-1509.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bialek R, Feucht A, Aepinus C, Just-Nübling G, Robertson VJ, Knobloch J, et al. Evaluation of Two Nested PCR Assays for Detection of Histoplasma capsulatum DNA in Human Tissue. J Clin Microbiol. 2002;40: 1644–1647. 10.1128/JCM.40.5.1644-1647.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bracca A, Tosello ME, Girardini JE, Amigot SL, Gomez C, Serra E. Molecular Detection of Histoplasma capsulatum var. capsulatum in Human Clinical Samples. J Clin Microbiol. 2003;41: 1753–1755. 10.1128/JCM.41.4.1753-1755.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Martagon-Villamil J, Shrestha N, Sholtis M, Isada CM, Hall GS, Bryne T, et al. Identification of Histoplasma capsulatum from Culture Extracts by Real-Time PCR. J Clin Microbiol. 2003;41: 1295–1298. 10.1128/JCM.41.3.1295-1298.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Simon S, Veron V, Boukhari R, Blanchet D, Aznar C. Detection of Histoplasma capsulatum DNA in human samples by real-time polymerase chain reaction. Diagn Microbiol Infect Dis. 2010;66: 268–273. 10.1016/j.diagmicrobio.2009.10.010 [DOI] [PubMed] [Google Scholar]
  • 29.Babady NE, Buckwalter SP, Hall L, Le Febre KM, Binnicker MJ, Wengenack NL. Detection of Blastomyces dermatitidis and Histoplasma capsulatum from Culture Isolates and Clinical Specimens by Use of Real-Time PCR. J Clin Microbiol. 2011;49: 3204–3208. 10.1128/JCM.00673-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Scheel CM, Zhou Y, Theodoro RC, Abrams B, Balajee SA, Litvintseva AP. Development of a Loop-Mediated Isothermal Amplification Method for Detection of Histoplasma capsulatum DNA in Clinical Samples. J Clin Microbiol. 2014;52: 483–488. 10.1128/JCM.02739-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Furuie JL, Sun J, do Nascimento MMF, Gomes RR, Waculicz-Andrade CE, Sessegolo GC, et al. Molecular identification of Histoplasma capsulatum using rolling circle amplification. Mycoses. 2016;59: 12–19. 10.1111/myc.12426 [DOI] [PubMed] [Google Scholar]
  • 32.Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28: E63 10.1093/nar/28.12.e63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mori Y, Nagamine K, Tomita N, Notomi T. Detection of Loop-Mediated Isothermal Amplification Reaction by Turbidity Derived from Magnesium Pyrophosphate Formation. Biochem Biophys Res Commun. 2001;289: 150–154. 10.1006/bbrc.2001.5921 [DOI] [PubMed] [Google Scholar]
  • 34.Sun Y, Quyen TL, Hung TQ, Chin WH, Wolff A, Bang DD. A lab-on-a-chip system with integrated sample preparation and loop-mediated isothermal amplification for rapid and quantitative detection of Salmonella spp. in food samples. Lab Chip. 2015;15: 1898–1904. 10.1039/c4lc01459f [DOI] [PubMed] [Google Scholar]
  • 35.Goto M, Honda E, Ogura A, Nomoto A, Hanaki K-I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 2009;46: 167–172. 10.2144/000113072 [DOI] [PubMed] [Google Scholar]
  • 36.Tanner NA, Zhang Y, Evans TC Jr. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 2012;53: 81–89. 10.2144/0000113902 [DOI] [PubMed] [Google Scholar]
  • 37.Ball CS, Light YK, Koh C-Y, Wheeler SS, Coffey LL, Meagher RJ. Quenching of Unincorporated Amplification Signal Reporters in Reverse-Transcription Loop-Mediated Isothermal Amplification Enabling Bright, Single-Step, Closed-Tube, and Multiplexed Detection of RNA Viruses. Anal Chem. 2016;88: 3562–3568. 10.1021/acs.analchem.5b04054 [DOI] [PubMed] [Google Scholar]
  • 38.Tanner NA, Zhang Y, Evans TC. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques. 2015;58 10.2144/000114253 [DOI] [PubMed] [Google Scholar]
  • 39.Carr J, Shearer G. Genome size, complexity, and ploidy of the pathogenic fungus Histoplasma capsulatum. J Bacteriol. 1998;180: 6697–6703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Okeke CN, Kappe R, Zakikhani S, Nolte O, Sonntag H-G. Ribosomal genes of Histoplasma capsulatum var. duboisii and var. farciminosum. Mycoses. 1998;41: 355–362. [DOI] [PubMed] [Google Scholar]
  • 41.Brilhante RSN, Ribeiro JF, Lima RAC, Castelo-Branco DSCM, Soares RM, Mesquita JRL, et al. Evaluation of the genetic diversity of Histoplasma capsulatum var. capsulatum isolates from north-eastern Brazil. J Med Microbiol. 2012;61: 1688–1695. 10.1099/jmm.0.044073-0 [DOI] [PubMed] [Google Scholar]
  • 42.Estrada-Bárcenas DA, Vite-Garín T, Navarro-Barranco H, de la Torre-Arciniega R, Pérez-Mejía A, Rodríguez-Arellanes G, et al. Genetic diversity of Histoplasma and Sporothrix complexes based on sequences of their ITS1-5.8S-ITS2 regions from the BOLD System. Rev Iberoam Micol. 2014;31: 90–94. 10.1016/j.riam.2013.10.003 [DOI] [PubMed] [Google Scholar]
  • 43.Landaburu F, Cuestas ML, Rubio A, Elías NA, Daneri GL, Veciño C, et al. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA. Mycoses. 2014;57: 299–306. 10.1111/myc.12159 [DOI] [PubMed] [Google Scholar]
  • 44.Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci. 2012;109: 6241–6246. 10.1073/pnas.1117018109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.McCullough MJ, DiSalvo AF, Clemons KV, Park P, Stevens DA. Molecular epidemiology of Blastomyces dermatitidis. Clin Infect Dis Off Publ Infect Dis Soc Am. 2000;30: 328–335. 10.1086/313649 [DOI] [PubMed] [Google Scholar]
  • 46.Kumar S, Tamura K, Nei M. MEGA: Molecular Evolutionary Genetics Analysis software for microcomputers. Bioinformatics. 1994;10: 189–191. 10.1093/bioinformatics/10.2.189 [DOI] [PubMed] [Google Scholar]
  • 47.Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 2014;7: 539–539. 10.1038/msb.2011.75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33: 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.White TJ, Bruns T, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols, a guide to methods and applications. New York; 1990. pp. 315–322. [Google Scholar]
  • 50.Vieira S. Outras Estatísticas Bioestatística: tópicos avançados. 3a Rio de Janeiro: Elsevier; 2010. [Google Scholar]
  • 51.Denning DW. Minimizing fungal disease deaths will allow the UNAIDS target of reducing annual AIDS deaths below 500 000 by 2020 to be realized. Philos Trans R Soc B Biol Sci. 2016;371 10.1098/rstb.2015.0468 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Souza SLS de, Feitoza PVS, Araújo JR de, Andrade RV de, Ferreira LC de L. Causes of death among patients with acquired immunodeficiency syndrome autopsied at the Tropical Medicine Foundation of Amazonas. Rev Soc Bras Med Trop. 2008;41: 247–251. 10.1590/S0037-86822008000300005 [DOI] [PubMed] [Google Scholar]
  • 53.Unis G, Roesch EW, Severo LC. Histoplasmose pulmonar aguda no Rio Grande do Sul. J Bras Pneumol Brasília Vol 31 N 1 2005. P 52–59. 2005; [Google Scholar]
  • 54.Nacher M, Adenis A, Mc Donald S, Do Socorro Mendonca Gomes M, Singh S, Lopes Lima I, et al. Disseminated Histoplasmosis in HIV-Infected Patients in South America: A Neglected Killer Continues on Its Rampage. PLoS Negl Trop Dis. 2013;7: e2319 10.1371/journal.pntd.0002319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Silva TC, Treméa CM, Zara ALSA, Mendonça AF, Godoy CSM, Costa CR, et al. Prevalence and lethality among patients with histoplasmosis and AIDS in the Midwest Region of Brazil. Mycoses. 2017;60: 59–65. 10.1111/myc.12551 [DOI] [PubMed] [Google Scholar]
  • 56.Pontes LB, Leitão T do MJS, Lima GG, Gerhard ES, Fernandes TA. Clinical and evolutionary characteristics of 134 patients with disseminated histoplasmosis associated with AIDS in the State of Ceará. Rev Soc Bras Med Trop. 2010;43 Available: http://submission.scielo.br/index.php/rsbmt/article/view/20992 [DOI] [PubMed] [Google Scholar]
  • 57.Nacher M, Adenis A, Arathoon E, et al. Disseminated histoplasmosis in Central and South America, the invisible elephant: the lethal blind spot of international health organizations. AIDS. 2016;30: 167–170. 10.1097/QAD.0000000000000961 [DOI] [PubMed] [Google Scholar]
  • 58.Adenis AA, Valdes A, Cropet C, McCotter OZ, Derado G, Couppie P, et al. Burden of HIV-associated histoplasmosis compared with tuberculosis in Latin America: a modelling study. Lancet Infect Dis. 2018; 10.1016/S1473-3099(18)30354-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Dantas KC, Freitas RS de, da Silva MV, Criado PR, Luiz O do C, Vicentini AP. Comparison of diagnostic methods to detect Histoplasma capsulatum in serum and blood samples from AIDS patients. Ito E, editor. PLOS ONE. 2018;13: e0190408 10.1371/journal.pone.0190408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Maubon D, Simon S, Aznar C. Histoplasmosis diagnosis using a polymerase chain reaction method. Application on human samples in French Guiana, South America. Diagn Microbiol Infect Dis. 2007;58: 441–444. 10.1016/j.diagmicrobio.2007.03.008 [DOI] [PubMed] [Google Scholar]
  • 61.Muñoz C, Gómez BL, Tobón A, Arango K, Restrepo A, Correa MM, et al. Validation and Clinical Application of a Molecular Method for Identification of Histoplasma capsulatum in Human Specimens in Colombia, South America. Clin Vaccine Immunol CVI. 2010;17: 62–67. 10.1128/CVI.00332-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Bush LM, Palraj B, Chaparro-Rojas F, Perez MT. Disseminated Histoplasmosis Responsive to Trimethoprim-Sulfamethoxazole in an AIDS Patient. Infect Dis Clin Pract. 2010;18: 239 10.1097/IPC.0b013e3181d65653 [DOI] [Google Scholar]
  • 63.Brilhante RSN, Bezerra Fechine MA, de Aguiar Cordeiro R, Gadelha Rocha MF, Ribeiro JF, Jalles Monteiro A, et al. In Vitro Effect of Sulfamethoxazole-Trimethoprim against Histoplasma capsulatum var. capsulatum. Antimicrob Agents Chemother. 2010;54: 3978–3979. 10.1128/AAC.00793-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Inacio J, Flores O, Spencer-Martins I. Efficient Identification of Clinically Relevant Candida Yeast Species by Use of an Assay Combining Panfungal Loop-Mediated Isothermal DNA Amplification with Hybridization to Species-Specific Oligonucleotide Probes. J Clin Microbiol. 2008;46: 713–720. 10.1128/JCM.00514-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Tian X, Feng J, Wang Y. Direct loop-mediated isothermal amplification assay for on-site detection of Staphylococcus aureus. FEMS Microbiol Lett. 2018; 10.1093/femsle/fny092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Hayashida K, Kajino K, Simukoko H, Simuunza M, Ndebe J, Chota A, et al. Direct detection of falciparum and non-falciparum malaria DNA from a drop of blood with high sensitivity by the dried-LAMP system. Parasit Vectors. 2017;10 10.1186/s13071-016-1949-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Francois P, Tangomo M, Hibbs J, Bonetti E-J, Boehme CC, Notomi T, et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunol Med Microbiol. 2011;62: 41–48. 10.1111/j.1574-695X.2011.00785.x [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Checklist. Standards for Reporting of Diagnostic Accuracy (STARD) checklist.

(PDF)

S1 Fig. Standards for Reporting of Diagnostic Accuracy (STARD) flow chart of the 27 suspected histoplasmosis cases enrolled in the study.

(PDF)

S2 Fig. Annealing sites of the ITS LAMP and nPCR primer sets.

Hc_F2 and Hc_F1 are different annealing regions of the Hc_FIP primer. Hc_B2 and Hc_B1 are annealing regions of the Hc_BIP primer. Gray letters represent ITS 1 and ITS 2 regions, respectively, and black letters represent 5.8S and LSU ribosomal RNA coding sequences, respectively, as showed in Fig 1.

(PDF)

S3 Fig. Alignment of the ITS LAMP and nPCR primers set with ribosomal DNA from pathogenic and environmental fungal species.

(PDF)

S4 Fig. Agarose gel of GAPDH PCR product from biological specimens.

(PDF)

S1 Table. Reference strains of H. capsulatum from different clades used for validation of ITS LAMP and nPCR assays.

(PDF)

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.


Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES