Skip to main content
NCBI home page
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2019 Aug 8;7(9):e920. doi: 10.1002/mgg3.920

Novel IFT140 variants cause spermatogenic dysfunction in humans

Xiong Wang 1, Yan‐wei Sha 2, Wen‐ting Wang 3, Yuan‐qing Cui 1, Jie Chen 1, Wei Yan 1, Xiao‐tao Hou 4, Li‐bin Mei 2,✉, Cui‐cui Yu 5,✉, Jiahui Wang 3,✉
PMCID: PMC6732298  PMID: 31397098

Abstract

Background

The intraflagellar transport protein 140 homolog (IFT140) is involved in the process of intraflagellar transport (IFT), a process that is essential for the formation and maintenance of most eukaryotic cilia and flagella. Variants IFT140 have been reported to account for ciliopathy but association with male fertility has never been described in humans. Here we report the identification of two novel variants of IFT140 which caused spermatogenic dysfunction and male infertility.

Methods

Whole‐exome sequencing was performed in a 27‐year‐old infertile man presented with severe oligozoospermia, asthenozoospermia, and teratozoospermia (OAT) without other physical abnormality. Sanger sequencing was used to verify gene variants in the patient, his healthy brother, and their parents. Morphology and protein expression in the patient's sperm were examined by transmission electron microscopy (TEM) and immunofluorescence staining. Function of gene variants was predicted by online databases.

Results

Compound heterozygous variants of IFT140: exon16: c.1837G > A: p.Asp613Asn and exon31: c.4247G > A: p.Ser1416Asn were identified in the patient, both of which showed autosomal recessive inheritance in his family, and had extremely low allele frequency in the population. Morphological abnormalities of the head, nucleus, and tails and the absence of IFT140 from the neck and mid‐piece of the patient's spermatozoa were observed. Mutation Taster database predicted a high probability of damage‐causing by both variations.

Conclusion

This study for the first time reported IFT140 variants that cause infertility in humans.

Keywords: genetic variation, IFT140, intraflagellar transport, male infertility, spermatogenic dysfunction

1. INTRODUCTION

Studies have shown that 8% of reproductive male population suffers fertility disorders. It is estimated that there are at least 20 million infertile men worldwide (Boivin, Bunting, Collins, & Nygren, 2007; Esteves, 2013). With the in‐depth study of the mechanism of gene‐regulated spermatogenesis, the value of genetic variation in etiological diagnosis of male infertility has been increasingly emphasized (Krausz, Escamilla, & Chianese, 2015).

Intraflagellar transport (IFT) is a bidirectional motility along axonemal microtubules that is essential for the formation (ciliogenesis) and maintenance of most eukaryotic cilia and flagella. The process of IFT involves movement of large protein complexes called IFT particles, which are composed of about 20 proteins that could be divided into two complexes: the anterograde IFT complex A and the retrograde IFT complex B (Cole et al., 1998). Intraflagellar transport protein 140 homolog (IFT140) is one component of the IFT complex A. The humans IFT140 (OMIM accession number: 614,620), located on chromosome 16p13.3, has 40 exons. IFT140 is expressed in a variety of organs, with high RNA expression level in the testis, some endocrine tissues (e.g., pituitary gland, thyroid gland, and adrenal gland), and central nervous tissues (e.g., cerebellum, caudate, and hippocampus) as reported by the Bgee database (https://bgee.org/). IFT140 protein was composed of 1,462 amino acids, containing five WD repeat domains and nine tetratricopeptide repeat (TPR) domains. Intracellularly, IFT140 protein was reported to locate on the cilium basal body (Hull et al., 2016; Perrault et al., 2012) and centrosome (Schmidts et al., 2013).

This study reported a male patient who suffered primary infertility due to severe oligozoospermia, asthenozoospermia, and teratozoospermia (OAT). Through combined use of high‐throughput whole‐exome sequencing and Sanger sequencing, we identified compound heterozygous variants in his IFT140. This is the first reporting case of IFT140 mutation causing infertility in humans.

2. MATERIAL AND METHODS

2.1. Ethical compliance

This study was approved by the Ethics Committee of the Yantai Yuhuangding Hospital. Written informed consent was obtained from all participants.

2.2. Semen sample preparation

Fresh semen was collected from the patient and his brother after 3–7 days of sexual abstinence and tested at least twice in accordance with the WHO guidelines (World Health Organization, 2010). Liquefied samples were washed with mHTF (Irvine Scientific, Santa Ana) at 37°C and processed as previously described (Wang et al., 2017).

2.3. Peripheral whole blood DNA extraction

DNA was extracted from peripheral whole blood samples using the QiAmp Blood DNA mini Kit according to the manufacturer's instructions (Qiagen, Hilden, Germany).

2.4. Whole‐exome sequencing and data analysis

Whole‐exome sequencing was performed by Annoroad Gene Technology (Beijing, China) using the AgilentV6 60M Exon Targeting Sequence Enrichment System (Agilent, USA). Data were analyzed for variations in the IFT140 (Genbank accession No. NM_014714.4). Frequency of the observed mutations in the general population was assessed using 1,000 Genomes project (http://www.1000genomes.org/data), Exome Variant Server/ NHLBI Exome Sequencing Project (ESP6500) (http://evs.gs.washington.edu/EVS/), and Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org/). Analysis of mutations for their probable impact on protein function was carried out using SIFT (http://sift.jcvi.org/), Polyphen‐2 (http://genetics.bwh.harvard.edu/pph2/), Mutation Taster (http://www.mutationtaster.org/), and SNPs&Go databases (http://snps.biofold.org/snps-and-go/). Functional protein association was predicted with the STRING (https://string-db.org/), GeneMANIA (http://genemania.org/), and HitPredict (http://hintdb.hgc.jp/htp/) databases.

2.5. Variant confirmation and cosegregation

Polymerase chain reaction (PCR) and Sanger sequencing were employed to validate the variants and to determine their inheritance and cosegregation. Exon 16 and 31 of IFT140 were amplified from genomic DNA using the following primers: IFT140_E14F: 5′‐TGTGGACTTGGTGACACTGGG‐3′; IFT140_E14Rseq: 5′‐CAACTCCAATCTACCCACTGCC‐3′; IFT140_E29Fseq: 5′‐GCATCCCCTCATCACCACATT‐3′; IFT140_E29R: 5′‐GTCGCGTATTCCAACACAGACAT‐3′. The sequencing of PCR products was performed bidirectionally using the ABI3500 sequencer (Life technology, USA). Analysis of sequences was carried out using Mutation Surveyor (SoftGenetics).

2.6. Transmission electron microscopy (TEM)

TEM was performed as previously described (Wang et al., 2017).

2.7. Immunofluorescence

Prepared spermatozoa were smeared onto polylysine‐coated slides and fixed with methanol at ‒20°C for 20 min. Test slides were blocked with 2% casein in PBS and stained with the rabbit anti‐IFT40 (17460‐1‐AP, Proteintech, USA) and mouse anti‐acetylated tubulin (66200‐1‐Ig, Proteintech, USA) primary antibodies and anti‐mouse FITC‐conjugated (ZF‐0516, Zsbio, China) or anti‐rabbit DsRed‐conjugated (ZF‐0512, Zsbio, China) secondary antibodies. Nuclei were stained with DAPI. Slides were mounted with ProLong Gold Antifade Reagent (Invitrogen, USA) and examined using a LEICA TCS SPE confocal microscope (LEICA, Germany).

3. RESULTS

3.1. Novel IFT40 variants identified in an infertile male patient

The patient was a 29‐year‐old male, 175 cm in height, weighed 100 kg, and was in good general health without obvious discomfort. He had been married for 2 years without child. Within the past year, he had regular sex intercourse of two to three times per week with vaginal ejaculation. The patient's elder brother was 34 years old, whose wife had naturally conceived and given birth to a healthy child.

Physical examination of the patient identified no abnormality in bilateral epididymis and seminal ducts, and no palpable bilateral varicocele. Blood sex hormone levels were: follicle‐stimulating hormone 10.26 mIU/ml, luteinizing hormone 8.38 mIU/ml, testosterone 2.12 ng/ml, estradiol 14.07 pg/ml, prolactin 7.01 ng/ml, and progesterone 0.642 ng/ml. The patient had normal chromosome karyotype, without Y chromosome microdeletions. No abnormality was identified in his seminal vesicle gland, prostate, bilateral testis, epididymis, and spermatic vein by ultrasonography. No other neurological, skeletal, developmental abnormalities, and no renal failure or retinopathy were found.

The patient presented severe OAT. Routine semen analysis showed a sperm concentration of 0–2/HPF with very few active spermatozoa. Sperm morphology analysis found only 0.5% normal spermatozoa, and the vast majority of spermatozoa had irregular head and aberrant neck (Figure 1a,b). The patient's sperm was examined with TEM analysis in comparison to normal sperm. Result showed that normal spermatozoa usually had long cone‐shaped heads, long strip‐shaped tails, and abundant mitochondria on both sides of the tails (Figure 1c). In contrast, the spermatozoa from the patient had abnormal head shape, separation of acrosome from nucleus, irregular morphology of sperm nucleus, short or swollen tails with local bulging, abnormal morphology, and distribution of mitochondria in sperm tails (Figure 1d,e). Semen sample of the patient's healthy brother was also examined, which showed normal semen parameters. Whole‐exome sequencing was performed for the patient, which identified two point mutations in the IFT140: exon16: c.1837G > A: p.Asp613Asn and exon31: c.4247G > A: p.Ser1416Asn.

Figure 1.

Figure 1

Open in a new tab

Morphological analysis of spermatozoa from (a) a normal person and (b) the patient by Papanicolaou staining, ×400 magnification. Transmission electron microscopy images of spermatozoa from (c) a normal person and (d, e) the patient

3.2. IFT40 variants showed family aggregation

Blood samples were collected from the patient, his elder brother, and their both parents. Sanger sequencing was performed to confirm their genotype of IFT140 and cosegregation. The results showed that the patient carried heterozygous alleles of both variants, each of which was inherited from one of the parents. Heterozygosity of IFT140: c.1837G > A was confirmed in the patient's father and IFT140: c.4247G > A was found in the patient's brother and mother (Figure 2a). Both variants showed family aggregation in the patient's pedigree (Figure 2b).

Figure 2.

Figure 2

Open in a new tab

(a) Sanger sequencing alignment of the patient and his close relatives. (b) Family tree of the patient

3.3. Bioinformatics analysis of IFT140 variants

In silico analysis of the IFT140 variants suggested that both variants had extremely low allele frequency in the population (Table 1). Especially, IFT140: c.4247G > A was only identified in the total ExAC database. Orthology analysis showed that both mutation sites were highly conserved across mammalian species as well as Zebrafish (Figure 3). Bioinformatics analysis through the Mutation Taster database predicted a high probability of damage‐causing by both variations, while Polyphen‐2, SIFT, and SNPs&GO analyses suggested that both variations were neutral (Table 1). Protein interaction analysis by STRING database predicted interaction of IFT140 with IFT122, IFT43, WDR35 (IFT121), WDR19 (IFT144), and TTC21B that belong to the IFT complex A and with IFT88, IFT81, IFT80, IFT52, and IFT27 that belong to IFT complex B. Analysis by GeneMANIA and HitPredict also identified TULP3, a binding partner of IFT complex A, and RANBP2 as high‐confidence interactive protein of IFT140.

Table 1.

In silico analysis of IFT140 mutations

Gene mutation Amino acid change 1000G_ALLa 1000G_EAb ExAC (total)c ExAC_EAd ESP6500 siv2_ALLe ESP6500 siv2_EAf Polyphen−2g SIFTh Mutation Tasteri SNPs&GOj
c.1837G > A p.Asp613Asn 0.0002 0.001 0.00002471 0.0003 0 0 Benign (0.215) Tolerated (0.169) Disease causing (1) Neutral (0.041)
c.4247G > A p.Ser1416Asn NA NA 0.00003213 0 0 0 Benign (0.001) Tolerated (0.621) Disease causing (0.983) Neutral (0.147)
Open in a new tab
a

Frequency of variation in total of 1,000 Genomes database (A Deep Catalog of Human Genetic Variation).

b

Frequency of variation in East Asian population of 1,000 Genomes database.

c

Frequency of variation in total of ExAC database.

d

Frequency of variation in East Asian population of ExAC database.

e

Frequency of variation in total of ESP6500 database.

f

Frequency of variation in East Asian population of ESP6500 database.

g

Polyphen‐2 (http://genetics.bwh.harvard.edu/pph2/). Prediction Scores range from 0 to 1 with high scores indicating probably or possibly damaging.

h

SIFT, that is, Sorting Intolerant From Tolerant (http://sift.jcvi.org/). Scores vary between 0 and 1. Variants with scores close or equal to 0 are predicted to be damaging.

i

Mutation Taster (http://www.mutationtaster.org/). The probability value is the probability of the prediction, that is, a value close to 1 indicates a high “security” of the prediction.

j

SNPs&GO (http://snps.biofold.org/snps-and-go/). Probability: disease probability (if > 0.5 mutation is predicted disease).

Figure 3.

Figure 3

Open in a new tab

Schematic diagram showing the location of mutations in the IFT140 and protein of the patient, and the conserved sequences of the mutation points across various species

3.4. Expression of IFT140 in spermatozoa

We used immunofluorescent staining to examine the expression of IFT140 in the spermatozoa of the patient comparing to those of normal male as control. Result showed that IFT140 protein was completely absent in the patient's spermatozoa, but was evidently expressed in the neck and mid‐piece of normal spermatozoa (Figure 4).

Figure 4.

Figure 4

Open in a new tab

Immunofluorescence staining of the spermatozoa of a normal person and the patient

4. DISCUSSION

During spermatogenesis in male mammals, spermatogonia develop into mature spermatozoa through extremely complex cell differentiation processes, which involve thousands of genes. The normal expression of these genes is the basis for maintaining fertility in male mammals (Schultz, Hamra, & Garbers, 2003). Clinically, abnormality in semen parameters is a common cause of male infertility, such as nonobstructive azoospermia and severe OAT. These abnormalities are largely related to the loss of expression or abnormal expression of genes regulating testicular spermatogenesis. Animal models and genetic screening studies have confirmed genetic factors to be the common cause of spermatogenesis disorders (Cannarella, Condorelli, Duca, Vignera, & Calogero, 2019). For example, pathogenic variations in FANCM (Kasak et al., 2018), MEIOB (Gershoni et al., 2019), RNF212, STAG3 (Riera‐Escamilla et al., 2019), TEX11, TEX12, TEX14, and TEX15 (Boroujeni et al., 2018) genes may cause nonobstructive azoospermia in male humans. A previous study by our group also identified a male with cryptozoospermia caused by a highly pathogenic nonsense mutation in TEX15 (Wang et al., 2018). The diverse clinical manifestations may be due to individual differences. The motility of sperm is closely related to the ultrastructure of sperm. In recent years, great progress has been made in the study of genes related to sperm ultrastructure, such as AK7 (Lores et al., 2019), ARMC2 (Coutton et al., 2019), CEP135 (Sha et al., 2017), CFAP43, CFAP44 (Tang et al., 2017), CFAP69 (He et al., 2019), CFAP251 (Li et al., 2019), DNAH1 (Wang et al., 2017), FSIP2 (Martinez et al., 2018), QRICH2 (Shen et al., 2019), SPEF2 (Liu, Lv, et al. 2019; Liu, He, et al., 2019), and TTC21A (Liu, Lv, et al. 2019; Liu, He, et al., 2019). Variations in these genes can affect spermatogenesis, leading to multiple flagella deformities or sperm loss, which manifest as severe teratozoospermia and severe asthenozoospermia. In addition, the correlation between genetic factors and idiopathic oligoasthenospermia has also received increasing attention (Fruhmesser et al., 2013; Vucic et al., 2018).

In this study, semen examinations showed that the patient had severe oligozoospermia and asthenozoospermia, which suggested spermatogenic dysfunction. Compound heterozygous mutations of c.1837G > A and c.4247G > A were identified in IFT140 of the proband, while his brother was a heterozygous carrier of IFT140: c.4247G > A. Each of the two variations originated from one parent. Both the proband and his brother were born naturally by their parents. The brother and his spouse naturally gave birth to a healthy child. These suggested cosegregation of the variations and phenotype in the pedigree conformed to autosomal recessive inheritance.

A number of IFT140 variants have been reported to be associated with ciliopathy in humans, namely the Jeune syndrome (asphyxiating thoracic dystrophy) and Mainzer–Saldino syndrome (MSS) (Helm et al., 2017; Perrault et al., 2012; Schmidts et al., 2013) (Table 2). Jeune syndrome is a rare genetic disorder that affects cartilage and bone development, causing dwarfism, breathing difficulties, and renal failure (de Vries et al., 2010). MSS patients are characterized by craniofacial and skeletal abnormalities, delayed motor development, and are often associated with cystic dysplastic kidneys, dextrocardia, and agenesis of corpus callosum (Badano, Mitsuma, Beales, & Katsanis, 2006). Hull et al. reported six biallelic variants of IFT140 that caused retinitis pigmentosa (RP) while not affecting the patient's nervous and skeletal systems and renal function (Table 2) (Hull et al., 2016). Disruption of Ift140 in Chlamydomonas and Trypanosoma has also been reported to result in the formation of short flagella (Absalon et al., 2008; Zhu et al., 2017).

Table 2.

Summary of IFT140 variant‐related diseases

Disease Major clinical symptoms Genotype of IFT140 variants Reference
Jeune syndrome (asphyxiating thoracic dystrophy) Short stature, small thorax, end‐stage renal failure under 13 years of age, retinal dystrophy c.1380delC (p.Asn460Lysfs28*)/c.874C > T (p.Val292Met), c.1565G > A (p.Gly522Glu)/c.874C > T (p.Val292Met), c.454C > T (p.Leu152Phe)/c.454C > T (p.Leu152Phe), c.2278C > T (p.Arg759*)/? Schmidts et al. (2013)
Developmental delay, nystagmus, short thorax with short ribs, trident limbs, PCSE, nonspecific nephritis c.2399 + 1G > T (splice)/c.634G > A (p.Gly212Arg) Perrault et al. (2012)
Mainzer‐Saldino syndrome (MSS) Short stature, small thorax, end‐stage renal failure under 13 years of age, retinal dystrophy c.2399 + 1G (splice)>T/c.4078T > C (p.Cys1360Arg), c.418G > A (p.Gly140Arg)+c.800A > G (p.Glu267Gly)/c.490G > T (p.Glu164*) Schmidts et al. (2013)
Dysgraphia, Reading difficulties, Adjustment disorder, developmental delay; high myopia, nyctalopia, retinitis pigmentosa, rod‐cone dystrophy; acute‐onset renal failure; hepatomegaly c.634G > A (p.Gly212Arg)/c.634G > A (p.Gly212Arg) Helm et al. (2017)
Early‐onset retinal dystrophy, PCSE, and renal disease, some with nonovert renal disease c.634G > A (p.Gly212Arg)/c.3916dup (p.Ala1306Glyfs*56), c.932A > G (p.Tyr311Cys)/c.857_860del (p.Ile286Lysfs*6), c.2399 + 1G > T (splice)/c.1990G > A (p.Glu664Lys), c.1990G > A (p.Glu664Lys)/c.1990G > A (p.Glu664Lys), c.699T > G (p.Ile233Met)/ c.699T > G (p.Ile233Met), c.1565G > A (p.Gly522Glu)/‐, c.874G > A (p.Val292Met)/‐, c.1727G > A (p.Arg576Gln)/‐, c.489C > T (p.Gly163Gly)+c.488_491del (p.Glu164Thrfs ∗ 10)/‐ Perrault et al. (2012)
Retinitis pigmentosa (RP) Developmentally normal, with no apparent skeletal, neurological abnormalities or renal failure at age 13 to 67 years Bi‐allelic mutations of c.1451C > T (p.Thr484Met), c.2399 + 1G > T (splice), c.2815T > C (p.Ser939Pro), c.998G > A (p.Cys333Tyr), c.1021G > A (p.Ala341Thr), c.1422_23insAA (p.Arg475Asnfs*14) Hull et al. (2016)
Primary infertility Spermatogenic dysfunction, developmentally normal, no apparent skeletal, neurological abnormalities, no renal failure, no retinal dysfunction c.1837G > A (p.Asp613Asn)/c.4247G > A (p.Ser1416Asn) This paper
Open in a new tab

PCSE: phalangeal cone‐shaped epiphyses.

The two variants identified in this study have not been reported to be associated with humans diseases. Bioinformatics analysis through the Mutation Taster database predicted a high probability of damage‐causing by both variations, while Polyphen‐2, SIFT, and SNPs&GO analyses suggested that both variations were neutral. However, a recent animal study (Zhang et al., 2018) found that IFT140 was a key regulator of male fertility and normal spermatogenesis in mice. Ift140 was highly expressed in the testicular tissues of normal mice. Male germ cell‐specific knockout of Ift140 in mice resulted in spermatogenic dysfunction, abnormal sperm morphology (amorphous heads, short/swollen flagella, and other distorted shapes as well as flagellar vesicles), and defective sperm motility, which ultimately led to male infertility. These observations were in accordance with the manifestations of the patient in this study, which serves as a strong evidence for the pathogenicity of the two identified IFT140 variants. The humans IFT140 is homologous to mouse Ift140, and the phenotypes of mutations are largely the same. Therefore, we speculate that IFT140 plays a key role in spermatogenesis in male mammals.

The mechanism of how IFT140 variants affect spermatogenesis is not fully understood. The patient's spermatozoa displayed bulged flagellar tips, as observed in Ift140‐deficient mice. This is a typical phenotype of retrograde trafficking deficiency (Hirano, Katoh, & Nakayama, 2017; Zhang et al., 2018). As the patient displayed almost the same conditions with the male germ cell‐specific Ift140‐deficient mice, we assumed that the IFT140: Asp613Asn and IFT140: Ser1416Asn mutations disrupt key protein‐binding sites or secondary structures of IFT140, leading to attenuated protein function in the spermatogenesis, but not affecting its functions in other systems.

In conclusion, compound heterozygous variants of IFT140: exon16: c.1837G > A: p.Asp613Asn/exon31: c.4247G > A: p.Ser1416Asn might cause spermatogenic dysfunction and infertility in humans. The results indicated the importance of ciliogenesis and IFT in male reproduction. This is the first reporting case of IFT140 mutation causing infertility in humans. Unfortunately, there was only one patient identified with IFT140 variant in this study. Future identification of more cases might provide better evidence for the involvement of IFT140 in humans spermatogenesis.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

ACKNOWLEDGMENTS

This study was financially supported by the Medicine and Health Science Technology Development Project of Shandong Province (Grant no. 2016WS0704), the Natural Science Foundation of Shandong Province (Grant No. ZR2017LH012), and the Science and Technology Project of Fujian Province (Grant No. 2017D011).

Wang X, Sha Y‐W, Wang W‐T, et al. Novel IFT140 variants cause spermatogenic dysfunction in humans. Mol Genet Genomic Med. 2019;7:e920 10.1002/mgg3.920

Xiong Wang, Yan‐wei Sha equally contributed to this paper.

Contributor Information

Li‐bin Mei, Email: meilibinxm@163.com.

Cui‐cui Yu, Email: yhdyyhhf@126.com.

Jiahui Wang, Email: jiahui.wang@outlook.com.

REFERENCES

  1. Absalon, S. , Blisnick, T. , Kohl, L. , Toutirais, G. , Doré, G. , Julkowska, D. , … Bastin, P. (2008). Intraflagellar transport and functional analysis of genes required for flagellum formation in trypanosomes. Molecular Biology of the Cell, 19(3), 929–944. 10.1091/mbc.e07-08-0749 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Badano, J. L. , Mitsuma, N. , Beales, P. L. , & Katsanis, N. (2006). The ciliopathies: An emerging class of human genetic disorders. Annual Review of Genomics and Human Genetics, 7, 125–148. 10.1146/annurev.genom.7.080505.115610 [DOI] [PubMed] [Google Scholar]
  3. Boivin, J. , Bunting, L. , Collins, J. A. , & Nygren, K. G. (2007). International estimates of infertility prevalence and treatment‐seeking: Potential need and demand for infertility medical care. Human Reproduction, 22(6), 1506–1512. 10.1093/humrep/dem046 [DOI] [PubMed] [Google Scholar]
  4. Boroujeni, P. B. , Sabbaghian, M. , Totonchi, M. , Sodeifi, N. , Sarkardeh, H. , Samadian, A. , … Gourabi, H. (2018). Expression analysis of genes encoding TEX11, TEX12, TEX14 and TEX15 in testis tissues of men with non‐obstructive azoospermia. JBRA Assist Reproduction, 22(3), 185–192. 10.5935/1518-0557.20180030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cannarella, R. , Condorelli, R. A. , Duca, Y. , La Vignera, S. , & Calogero, A. E. (2019). New insights into the genetics of spermatogenic failure: A review of the literature. Human Genetics, 138(2), 125–140. 10.1007/s00439-019-01974-1 [DOI] [PubMed] [Google Scholar]
  6. Cole, D. G. , Diener, D. R. , Himelblau, A. L. , Beech, P. L. , Fuster, J. C. , & Rosenbaum, J. L. (1998). Chlamydomonas kinesin‐II‐dependent intraflagellar transport (IFT): IFT particles contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons. Journal of Cell Biology, 141(4), 993–1008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Coutton, C. , Martinez, G. , Kherraf, Z.‐E. , Amiri‐Yekta, A. , Boguenet, M. , Saut, A. , … Ray, P. F. (2019). Bi‐allelic mutations in ARMC2 lead to severe astheno‐teratozoospermia due to sperm flagellum malformations in humans and mice. American Journal of Human Genetics, 104(2), 331–340. 10.1016/j.ajhg.2018.12.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. de Vries, J. , Yntema, J. L. , van Die, C. E. , Crama, N. , Cornelissen, E. A. , & Hamel, B. C. (2010). Jeune syndrome: Description of 13 cases and a proposal for follow‐up protocol. European Journal of Pediatrics, 169(1), 77–88. 10.1007/s00431-009-0991-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Esteves, S. C. (2013). A clinical appraisal of the genetic basis in unexplained male infertility. Journal of Human Reproductive Sciences, 6(3), 176–182. 10.4103/0974-1208.121419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fruhmesser, A. , Vogt, P. H. , Zimmer, J. , Witsch‐Baumgartner, M. , Fauth, C. , Zschocke, J. , … Kotzot, D. (2013). Single nucleotide polymorphism array analysis in men with idiopathic azoospermia or oligoasthenozoospermia syndrome. Fertility and Sterility, 100(1), 81–87. 10.1016/j.fertnstert.2013.03.016 [DOI] [PubMed] [Google Scholar]
  11. Gershoni, M. , Hauser, R. , Barda, S. , Lehavi, O. , Arama, E. , Pietrokovski, S. , & Kleiman, S. E. (2019). A new MEIOB mutation is a recurrent cause for azoospermia and testicular meiotic arrest. Human Reproduction, 34(4), 666–671. 10.1093/humrep/dez016 [DOI] [PubMed] [Google Scholar]
  12. He, X. , Li, W. , Wu, H. , Lv, M. , Liu, W. , Liu, C. , … Cao, Y. (2019). Novel homozygous CFAP69 mutations in humans and mice cause severe asthenoteratospermia with multiple morphological abnormalities of the sperm flagella. Journal of Medical Genetics, 56(2), 96–103. 10.1136/jmedgenet-2018-105486 [DOI] [PubMed] [Google Scholar]
  13. Helm, B. M. , Willer, J. R. , Sadeghpour, A. , Golzio, C. , Crouch, E. , Vergano, S. S. , … Davis, E. E. (2017). Partial uniparental isodisomy of chromosome 16 unmasks a deleterious biallelic mutation in IFT140 that causes Mainzer‐Saldino syndrome. Human Genomics, 11(1), 16 10.1186/s40246-017-0111-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hirano, T. , Katoh, Y. , & Nakayama, K. (2017). Intraflagellar transport‐A complex mediates ciliary entry and retrograde trafficking of ciliary G protein‐coupled receptors. Molecular Biology of the Cell, 28(3), 429–439. 10.1091/mbc.E16-11-0813 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hull, S. , Owen, N. , Islam, F. , Tracey‐White, D. , Plagnol, V. , Holder, G. E. , … Moore, A. T. (2016). Nonsyndromic retinal dystrophy due to bi‐allelic mutations in the ciliary transport gene IFT140. Investigative Ophthalmology & Visual Science, 57(3), 1053–1062. 10.1167/iovs.15-17976 [DOI] [PubMed] [Google Scholar]
  16. Kasak, L. , Punab, M. , Nagirnaja, L. , Grigorova, M. , Minajeva, A. , Lopes, A. M. , … Laan, M. (2018). Bi‐allelic recessive loss‐of‐function variants in FANCM cause non‐obstructive azoospermia. American Journal of Human Genetics, 103(2), 200–212. 10.1016/j.ajhg.2018.07.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Krausz, C. , Escamilla, A. R. , & Chianese, C. (2015). Genetics of male infertility: From research to clinic. Reproduction, 150(5), R159–174. 10.1530/REP-15-0261 [DOI] [PubMed] [Google Scholar]
  18. Li, W. , He, X. , Yang, S. , Liu, C. , Wu, H. , Liu, W. , … Cao, Y. (2019). Biallelic mutations of CFAP251 cause sperm flagellar defects and human male infertility. Journal of Human Genetics, 64(1), 49–54. 10.1038/s10038-018-0520-1 [DOI] [PubMed] [Google Scholar]
  19. Liu, C. , Lv, M. , He, X. , Zhu, Y. , Amiri‐Yekta, A. , Li, W. , … Cao, Y. (2019). Homozygous mutations in SPEF2 induce multiple morphological abnormalities of the sperm flagella and male infertility. Journal of Medical Genetics, [Epub ahead of print]. 10.1136/jmedgenet-2019-106011 [DOI] [PubMed] [Google Scholar]
  20. Liu, W. , He, X. , Yang, S. , Zouari, R. , Wang, J. , Wu, H. , … Zhang, F. (2019). Bi‐allelic mutations in TTC21A induce asthenoteratospermia in humans and mice. American Journal of Human Genetics, 104(4), 738–748. 10.1016/j.ajhg.2019.02.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lorès, P. , Coutton, C. , Khouri, E. E. , Stouvenel, L. , Givelet, M. , Thomas, L. , … Touré, A. (2019). Corrigendum: Homozygous missense mutation L673P in adenylate kinase 7 (AK7) leads to primary male infertility and multiple morphological anomalies of the flagella but not to primary ciliary dyskinesia. Human Molecular Genetics, 28(6), 1052 10.1093/hmg/ddy368 [DOI] [PubMed] [Google Scholar]
  22. Martinez, G. , Kherraf, Z.‐E. , Zouari, R. , Fourati Ben Mustapha, S. , Saut, A. , Pernet‐Gallay, K. , … Coutton, C. (2018). Whole‐exome sequencing identifies mutations in FSIP2 as a recurrent cause of multiple morphological abnormalities of the sperm flagella. Human Reproduction, 33(10), 1973–1984. 10.1093/humrep/dey264 [DOI] [PubMed] [Google Scholar]
  23. Perrault, I. , Saunier, S. , Hanein, S. , Filhol, E. , Bizet, A. A. , Collins, F. , … Rozet, J.‐M. (2012). Mainzer‐Saldino syndrome is a ciliopathy caused by IFT140 mutations. American Journal of Human Genetics, 90(5), 864–870. 10.1016/j.ajhg.2012.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Riera‐Escamilla, A. , Enguita‐Marruedo, A. , Moreno‐Mendoza, D. , Chianese, C. , Sleddens‐Linkels, E. , Contini, E. , … Krausz, C. (2019). Sequencing of a 'mouse azoospermia' gene panel in azoospermic men: Identification of RNF212 and STAG3 mutations as novel genetic causes of meiotic arrest. Human Reproduction, 34(6), 978–988. 10.1093/humrep/dez042 [DOI] [PubMed] [Google Scholar]
  25. Schmidts, M. , Frank, V. , Eisenberger, T. , Al Turki, S. , Bizet, A. A. , Antony, D. , … Bergmann, C. (2013). Combined NGS approaches identify mutations in the intraflagellar transport gene IFT140 in skeletal ciliopathies with early progressive kidney Disease. Human Mutation, 34(5), 714–724. 10.1002/humu.22294 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Schultz, N. , Hamra, F. K. , & Garbers, D. L. (2003). A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proceedings of the National Academy of Sciences of the United States of America, 100(21), 12201–12206. 10.1073/pnas.1635054100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sha, Y. W. , Xu, X. , Mei, L. B. , Li, P. , Su, Z. Y. , He, X. Q. , & Li, L. (2017). A homozygous CEP135 mutation is associated with multiple morphological abnormalities of the sperm flagella (MMAF). Gene, 633, 48–53. 10.1016/j.gene.2017.08.033 [DOI] [PubMed] [Google Scholar]
  28. Shen, Y. , Zhang, F. , Li, F. , Jiang, X. , Yang, Y. , Li, X. , … Xu, W. (2019). Loss‐of‐function mutations in QRICH2 cause male infertility with multiple morphological abnormalities of the sperm flagella. Nature Communications, 10(1), 433 10.1038/s41467-018-08182-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tang, S. , Wang, X. , Li, W. , Yang, X. , Li, Z. , Liu, W. , … Zhang, F. (2017). Biallelic mutations in CFAP43 and CFAP44 cause male infertility with multiple morphological abnormalities of the sperm flagella. American Journal of Human Genetics, 100(6), 854–864. 10.1016/j.ajhg.2017.04.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vucic, N. L. J. , Nikolic, Z. Z. , Vukotic, V. D. , Tomovic, S. M. , Vukovic, I. I. , Kanazir, S. D. , … Brajuskovic, G. N. (2018). NOS3 gene variants and male infertility: Association of 4a/4b with oligoasthenozoospermia. Andrologia, 50(1), e12817 10.1111/and.12817 [DOI] [PubMed] [Google Scholar]
  31. Wang, X. , Jin, H. R. , Cui, Y. Q. , Chen, J. , Sha, Y. W. , & Gao, Z. L. (2018). Case study of a patient with cryptozoospermia associated with a recessive TEX15 nonsense mutation. Asian Journal of Andrology, 20(1), 101–102. 10.4103/1008-682X.194998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wang, X. , Jin, H. , Han, F. , Cui, Y. , Chen, J. , Yang, C. , … Gao, Z. (2017). Homozygous DNAH1 frameshift mutation causes multiple morphological anomalies of the sperm flagella in Chinese. Clinical Genetics, 91(2), 313–321. 10.1111/cge.12857 [DOI] [PubMed] [Google Scholar]
  33. World Health Organization . (2010). WHO laboratory manual for the examination and processing of human semen, 5th ed Geneva, Switzerland: WHO Press. [Google Scholar]
  34. Zhang, Y. , Liu, H. , Li, W. , Zhang, Z. , Zhang, S. , Teves, M. E. , … Zhang, Z. (2018). Intraflagellar transporter protein 140 (IFT140), a component of IFT‐A complex, is essential for male fertility and spermiogenesis in mice. Cytoskeleton (Hoboken), 75(2), 70–84. 10.1002/cm.21427 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhu, B. , Zhu, X. , Wang, L. , Liang, Y. , Feng, Q. , & Pan, J. (2017). Functional exploration of the IFT‐A complex in intraflagellar transport and ciliogenesis. PLoS Genetics, 13(2), e1006627 10.1371/journal.pgen.1006627 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES