Skip to main content
American Journal of Physiology - Heart and Circulatory Physiology logoLink to American Journal of Physiology - Heart and Circulatory Physiology
. 2019 Jun 14;317(2):H357–H363. doi: 10.1152/ajpheart.00081.2019

Aldosterone impairs coronary adenosine-mediated vasodilation via reduced functional expression of Ca2+-activated K+ channels

Maloree Khan 1,5, Alex I Meuth 1,5, Scott M Brown 1,5, Bysani Chandrasekar 4,5, Douglas K Bowles 1,2,3, Shawn B Bender 1,2,5,✉
PMCID: PMC6732485  PMID: 31199187

Abstract

Elevated plasma aldosterone (Aldo) levels are associated with greater risk of cardiac ischemic events and cardiovascular mortality. Adenosine-mediated coronary vasodilation is a critical cardioprotective mechanism during ischemia; however, whether this response is impaired by increased Aldo is unclear. We hypothesized that chronic Aldo impairs coronary adenosine-mediated vasodilation via downregulation of vascular K+ channels. Male C57BL/6J mice were treated with vehicle (Con) or subpressor Aldo for 4 wk. Coronary artery function, assessed by wire myography, revealed Aldo-induced reductions in vasodilation to adenosine and the endothelium-dependent vasodilator acetylcholine but not to the nitric oxide donor sodium nitroprusside. Coronary vasoconstriction to endothelin-1 and the thromboxane A2 mimetic U-46619 was unchanged by Aldo. Additional mechanistic studies revealed impaired adenosine A2A, not A2B, receptor-dependent vasodilation by Aldo with a tendency for Aldo-induced reduction of coronary A2A gene expression. Adenylate cyclase inhibition attenuated coronary adenosine dilation but did not eliminate group differences, and adenosine-stimulated vascular cAMP production was similar between Con and Aldo mice. Similarly, blockade of inward rectifier K+ channels reduced but did not eliminate group differences in adenosine dilation whereas group differences were eliminated by blockade of Ca2+-activated K+ (KCa) channels that blunted and abrogated adenosine and A2A-dependent dilation, respectively. Gene expression of several coronary KCa channels was reduced by Aldo. Together, these data demonstrate Aldo-induced impairment of adenosine-mediated coronary vasodilation involving blunted A2A-KCa-dependent vasodilation, independent of blood pressure, providing important insights into the link between plasma Aldo and cardiac mortality and rationale for aldosterone antagonist use to preserve coronary microvascular function.

NEW & NOTEWORTHY Increased plasma aldosterone levels are associated with worsened cardiac outcomes in diverse patient groups by unclear mechanisms. We identified that, in male mice, elevated aldosterone impairs coronary adenosine-mediated vasodilation, an important cardioprotective mechanism. This aldosterone-induced impairment involves reduced adenosine A2A, not A2B, receptor-dependent vasodilation associated with downregulation of coronary KCa channels and does not involve altered adenylate cyclase/cAMP signaling. Importantly, this effect of aldosterone occurred independent of changes in coronary vasoconstrictor responsiveness and blood pressure.

Listen to this article’s corresponding podcast at https://ajpheart.podbean.com/e/attenuation-of-coronary-adenosine-dilation-by-aldosterone/.

Keywords: acetylcholine, barium, cAMP, inward-rectifier K+ channel

INTRODUCTION

Recent evidence supports increased plasma aldosterone (Aldo) concentration as an independent predictor of cardiovascular mortality. Specifically, plasma Aldo concentration is directly related to cardiovascular mortality in patients referred for coronary angiography (24, 40). Importantly, this association is independent of major established risk factors, including blood pressure, and is present even with elevations of plasma Aldo within the normal range (40). In patients with coronary artery disease, plasma Aldo remains independently associated with the risk of acute ischemic events following percutaneous coronary intervention (21). This is consistent with a previous report of increased myocardial infarction in patients with primary hyperaldosteronism (27); however, the potential mechanisms underlying the association of Aldo with cardiac ischemic events remain unclear.

A critical mechanism of cardioprotection during ischemia is adenosine-mediated coronary vasodilation (10). Indeed, cardiac interstitial and coronary plasma adenosine concentrations are increased above the threshold concentration for vasodilation during cardiac ischemia (35, 38, 41) and inhibition of adenosine-induced vasodilation worsens cardiac ischemia (20, 25). Notably, impaired adenosine-induced coronary vasodilation has been reported in conditions associated with inappropriate activation of the renin-angiotensin-aldosterone system (6, 8, 9, 16, 29). Mechanistically, altered vasodilation to adenosine in these conditions is associated with changes in the functional expression of adenosine type 2 (i.e., A2A, A2B) receptors and downstream K+ channels (6, 16, 29). Whether elevated Aldo contributes to impairment of coronary adenosine-mediated vasodilation, however, has not been examined. The potential involvement of Aldo in this defect is supported by accumulating evidence linking Aldo signaling with altered expression of vascular ion channels, including K+ channels (11), and reports that blockade of the Aldo-binding mineralocorticoid receptor improves adenosine-stimulated coronary flow reserve in diabetic patients (14, 23).

Accordingly, the purpose of this investigation was to examine the hypothesis that increased plasma Aldo impairs adenosine-mediated coronary vasodilation independent of blood pressure. Mechanistically, whether Aldo-induced impairment of this response involves altered A2A/A2B and cAMP signaling and/or downstream K+ channel functional expression were explored. Findings from this investigation add to growing evidence of blood pressure-independent impacts of Aldo on vascular function and implicate impaired adenosine-induced coronary vasodilation as a possible link between elevated Aldo concentrations and poor cardiac outcomes.

METHODS

Animals.

All animal protocols were approved by the Institutional Animal Care and Use Committees of the Harry S. Truman Memorial Veterans Hospital and the University of Missouri. Animals were housed in a temperature-controlled room (12-h:12-h light-dark cycle) and provided ad libitum access to water and standard rodent chow (Formulab 5008; Purina Mills, St. Louis, MO). Male C57BL/6J mice (12 wk of age, Jackson) were randomly assigned to receive infusion of either vehicle (Con; 95% EtOH in sterile saline sc) or Aldo (250 µg·kg−1·day−1 sc) via osmotic minipump (Alzet model 1004) for 4 wk. This dose of Aldo was chosen based on previous evidence demonstrating increases of circulating Aldo within the physiologically relevant range with no change in blood pressure (26). Animals were fasted for 5 h and anesthetized with isoflurane (2–4% in 100% O2), and blood was collected from the inferior vena cava, processed to plasma (sodium EDTA), and frozen at −80°C. Blood glucose was assessed before anesthesia via tail vein (Alpha Trak; Abbott). Animals were euthanized by exsanguination.

Blood pressure.

Systolic blood pressure was determined by tail-cuff plethysmography (BP-2000; Visitech) during the final week of treatment, as previously described (5).

Coronary vasomotor function.

Following excision of the heart, the left ventricular (LV) free wall was removed and immediately placed in ice-cold physiological salt solution (PSS) containing the following (in mM): 119 NaCl, 4.7 KCl, 2.5 CaCl2·2H2O, 1.17 MgSO4·7H2O, 25 NaHCO3, 1.18 KH2PO4, 0.027 EDTA, and 5.5 glucose (pH 7.4). Segments of the left coronary artery (~1 mm) were dissected and mounted on 17-µm stainless steel wires in oxygenated Krebs PSS (95% O2-5% CO2) in a small vessel myograph for isometric tension recording (Danish Myo Technology, Aarhus, Denmark), as previously described (4, 27a). Vessel length was quantified after mounting via a calibrated ocular micrometer. Vessels were warmed to 37°C, equilibrated for 30–40 min with regular washing, and stretched to achieve an internal circumference corresponding to a transmural pressure of 90 mmHg using an established normalization procedure (33). Vessel viability was confirmed by exposure to 80 mM KCl-Krebs-PSS. Following washing, vasodilator responses were assessed to adenosine (ADO; 1 nM to 0.1 mM), acetylcholine (ACh; 1 nM to 0.1 mM), and sodium nitroprusside (SNP; 1 nM to 0.1 mM). Additional experiments were performed to assess vasomotor responses to selective adenosine 2A (A2A) and 2B (A2B) receptor activation with CGS 21680 hydrochloride (1 nM to 0.1 mM) and BAY 60-6583 (10 pM to 10 µM), respectively. Involvement of adenylate cyclase signaling in coronary adenosine dilation (10 µM) was assessed following adenylate cyclase inhibition with SQ-22536 (0.1 mM). The contribution of K+ channels to adenosine-induced vasodilation was evaluated following inhibition of inward rectifier K+ (Kir) channels with barium (0.1 mM) and combined calcium-activated K+ (KCa) channel inhibition with apamin (1 µM), TRAM-34 (1 µM), and iberiotoxin (100 nM), as well as in the presence of 45 mM extracellular K+. Vasodilation to A2A activation by CGS 21680 hydrochloride was further evaluated following combined KCa channel inhibition, as described above. All vasodilator responses were evaluated following preconstriction of vessels with the thromboxane A2 mimetic U46619, and antagonists were added 30 min before assessment of agonist responses. Lastly, coronary vasoconstrictor responses to endothelin-1 (ET-1; 1–30 nM) and U46619 (10 nM to 1 µM) were assessed.

Real-time PCR.

In a dedicated set of animals, the LV coronary vasculature was dissected, cleaned of myocardial and adipose tissue, and frozen at −80°C until processed for total RNA extraction (PicoPure RNA Isolation Kit; Arcturus) and assessment of RNA purity and concentration using a Nanodrop spectrophotometer (Thermo Scientific). To provide sufficient template for RT-PCR analysis, total RNA was amplified to cDNA (Ovation Pico WTA System V2; NuGEN), according to manufacturer’s instructions. Quantitative real-time PCR was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad), as previously described (5). Primer sequences (Table 1) were purchased from IDT (Coralville, IA) and duplicate PCR reactions were performed using iTaq UniverSYBR Green SMX (Bio-Rad). GAPDH primers were used to amplify the endogenous control product and target mRNA expression was calculated as 2−ΔΔCT whereby ΔCT = GAPDH CT – gene of interest CT and are presented normalized to the vehicle-treated group, which was set at 1.

Table 1.

Primer sequences for real-time quantitative PCR

Gene Name Forward (5′→3′) Reverse (5′→3′)
Adora2a TGAAGGCGAAGGCGATCA GGGTCAGGCCGATGGC
Adora2b TTGGCATTGGATTGACTC TATGAGCAGTGGAGGAAG
Gapdh TCACCACCATGGAGAAGGC GCGAAGCAGTTGGTGGTGCA
Kcnn2 ACCCGCGTTTATTTTTGGCG CCCGACTGATCAGGGTTGTC
Kcnn3 TGTTCCTATTGTGCCACGCT CGGTCAGGTCACAGAGCAAT
Kcnn4 TGAGAGGCAGGCTGTCAATG GTGCCAGGTACCACGTCC
Kcnma1 GACGTTCTGAGCGTGACTG TGGTGGAGCAATCATTAACAGAG
Kcnmb1 CCTGGGAGTGGCAATGGTAG CAAAGGCATGGGTACTGGGG

Adenosine-stimulated cAMP production.

Vascular cAMP concentrations under basal and adenosine-stimulated conditions were evaluated in aortas from each treatment group. Thoracic aortas were removed, cleaned, divided into two equal segments, and incubated in individual wells containing DMEM at 37°C for 2 h. Subsequently, one segment was stimulated with adenosine (10 µM) while the other segment received vehicle (sterile saline) for 60 s after which segments were immediately frozen and stored at −80°C. Aortic cAMP concentrations were determined using the direct cAMP ELISA kit (Enzo Life Sciences), according to manufacturer instructions.

Data analysis and statistics.

Coronary vasodilator responses are presented as percent maximal dilation, calculated as [(Tpre – Td)/(Tpre – Tmin)] × 100, and vasoconstrictor responses are presented as percent vasoconstriction, calculated as [(Td – Tmin)/Tmin] × 100, where Tpre is tension following preconstriction with U46619, Td is tension after a drug intervention, and Tmin is minimum tension (initial tension following normalization as mouse coronary artery does not develop spontaneous tone). Data are presented as means ± SE. Statistical analysis was performed using Student’s t-test and two-way, repeated-measures ANOVA with Fisher least significant difference post hoc analysis, as appropriate, in SigmaPlot (Systat). P ≤ 0.05 was considered significant.

RESULTS

Subpressor Aldo infusion attenuates coronary vasodilator responsiveness.

Four weeks of Aldo infusion (250 µg·kg−1·day−1 sc) increased plasma Aldo concentrations (Fig. 1A) but did not change body weight, blood glucose, or heart weight-to-tibia length ratio (an index of cardiac hypertrophy) consistent with no change in blood pressure, compared with Con vehicle-infused mice (Table 2). Isolated coronary arteries from Con and Aldo mice had similar diameters (262 ± 5 vs. 255 ± 4 µm), were preconstricted with similar doses of U46619 (310 ± 60 vs. 270 ± 20 nM), and developed similar U46619-induced tension before examination of vasodilator responses (3.8 ± 0.3 vs. 3.3 ± 0.3 mN/mm). Wire myography studies revealed reduced coronary vasodilation to adenosine and acetylcholine but not to sodium nitroprusside (Fig. 1, B and C) in vessels from Aldo mice compared with Con. Importantly, blunting of adenosine-induced vasodilation by Aldo occurred at adenosine concentrations comparable to estimated interstitial adenosine concentrations during acute cardiac ischemia (38). Furthermore, preliminary studies revealed no effect of nitric oxide synthase inhibition with Nω-nitro-l-arginine on adenosine-induced vasodilation in murine coronary artery (data not shown). Finally, coronary vasoconstrictor responses to 80 mM KCl, the thromboxane A2 mimetic U46619, and ET-1 were not changed by Aldo, compared with Con (data not shown).

Fig. 1.

Fig. 1.

Aldosterone (Aldo) impairs coronary vasodilator responsiveness. Elevated plasma Aldo (A) is associated with impaired coronary adenosine (B) and acetylcholine-induced, but not sodium nitroprusside (SNP; C)-induced, vasodilation. Values are means ± SE; n = 4/group for plasma aldosterone; sample size in parentheses in B and C. *P < 0.05 vs. control (Con).

Table 2.

Phenotypic data of control and aldosterone-infused mice

Control Aldosterone
Body weight, g 25.9 ± 0.4 25.1 ± 0.3
Heart weight, mg 149 ± 4 143 ± 4
Heart weight-to-tibia length ratio 84.7 ± 2.3 80.8 ± 2.0
Blood glucose, mg/dl 119 ± 5 116 ± 7
Systolic blood pressure, mmHg 125 ± 7 126 ± 5

Values are means ± SE; n = 10–20 mice.

Aldo selectively impairs adenosine A2A receptor-dependent vasodilation.

Additional studies revealed that coronary vasodilation elicited by the selective A2A receptor agonist CGS 21680 was attenuated by Aldo (Fig. 2). Coronary vasodilation induced by selective activation of A2B receptors with BAY 60-6583 was unchanged by Aldo. Notably, A2B activation produced much greater vasodilation of murine coronary artery than did selective A2A activation, consistent with other reports in murine vessels (39). In conjunction with reduced A2A-dependent vasodilation, Aldo tended to reduce coronary A2A gene expression (P = 0.09) with no change in vascular A2B gene expression (Fig. 2).

Fig. 2.

Fig. 2.

Aldosterone (Aldo) attenuates coronary adenosine A2A, but not A2B, receptor-dependent vasodilation. Coronary vasodilator responses to the selective A2A receptor agonist CGS 21680 (A) and the selective A2B receptor agonist BAY 60-6583 (B). Coronary gene (mRNA) expression of A2A and A2B receptors by RT-PCR (C). Values are means ± SE; sample size in parentheses in A and B; n = 4–6 for RT-PCR. *P < 0.05 vs. control (Con); §P = 0.09 vs. Con.

Aldo does not impair adenosine-induced coronary cAMP signaling.

To examine whether impaired coronary cAMP signaling contributes to impairment of adenosine-induced vasodilation by Aldo, coronary vasodilation to adenosine was examined in the presence of the adenylate cyclase inhibitor SQ-22536. Pretreatment with SQ-22536 blunted adenosine-induced vasodilation (10 µM) of coronary arteries from both Con and Aldo mice (P < 0.05; Fig. 1B vs. Fig. 3A). Following SQ-22536, however, adenosine-induced vasodilation of coronary arteries from Aldo mice still tended (P = 0.08) to be reduced, compared with Con. Additional mechanistic experiments revealed similar basal cAMP concentrations in Con and Aldo aortas (Fig. 3B). Adenosine stimulation increased cAMP concentrations in both groups, and absolute cAMP concentrations were greater in Aldo aortas, compared with Con, following adenosine stimulation. The adenosine-stimulated increase in aortic cAMP concentrations, relative to baseline concentrations; however, was not different between groups (Fig. 3B).

Fig. 3.

Fig. 3.

Involvement of adenylate cyclase in adenosine-induced vasodilation and adenosine-stimulated cAMP production are not effected by aldosterone (Aldo). Coronary vasodilation to adenosine (ADO) in the presence of adenylate cyclase inhibition with SQ-22536 (0.1 mM; A). Aortic cAMP concentration under basal conditions (Unstim), following adenosine-stimulation (Stim; 10 µM for 60 s), and the adenosine-induced change in cAMP concentration (Delta; B). Values are means ± SE; n = 4–5. *P < 0.05 vs. control (Con) on Stim; †P < 0.05 vs. Unstim within group; ‡P = 0.08 vs. Con.

Aldo attenuates coronary KCa channel involvement in adenosine-induced vasodilation.

Whether attenuated adenosine-induced vasodilation in Aldo mice involves impaired coronary K+ channel function was examined following Kir or combined KCa channel blockade. Inhibition of Kir channels with barium reduced adenosine-induced vasodilation of coronary arteries from both Con and Aldo mice (P < 0.05; Fig. 1B vs. Fig. 4A); however, arteries from Aldo mice still exhibited reduced adenosine vasodilation compared with Con mice (Fig. 4A) implicating channels other than Kir underlying Aldo-induced dysfunction. Accordingly, combined blockade of KCa channels with apamin, TRAM-34, and iberiotoxin reduced adenosine-induced vasodilation in both groups (P < 0.05; Fig. 1B vs. Fig. 4B) and normalized adenosine responses between Con and Aldo arteries (Fig. 4B). Furthermore, combined KCa channel blockade prevented coronary A2A-dependent vasodilation in response to CGS 21680 (Fig. 4C). Further mechanistic studies revealed downregulation of small (Kcnn3) and intermediate (Kcnn4) conductance KCa channels with no change in expression of the α and β subunits of the large conductance KCa channel (Kcnma1 and Kcnmb1) in coronary arteries from Aldo compared with Con mice (Fig. 5). The small conductance KCa channel Kcnn2 could not be detected in mouse coronary artery.

Fig. 4.

Fig. 4.

Aldosterone (Aldo) impairs coronary adenosine-induced vasodilation via blunted KCa, but not Kir, channel function. Coronary vasodilation to adenosine in the presence of Kir blockade with barium (0.1 mM; A). Coronary vasodilation to adenosine (B) and the selective adenosine A2A agonist CGS 21680 (C) in the presence of combined KCa blockade with apamin (1 µM), TRAM-34 (1 µM), and iberiotoxin (100 nM). Values are means ± SE; sample size in parentheses. *P < 0.05 vs. control (Con).

Fig. 5.

Fig. 5.

Aldosterone (Aldo) differentially downregulates coronary KCa channel expression. Coronary gene expression of small-conductance (Kcnn2 and Kcnn3) and intermediate-conductance (Kcnn4) KCa channels as well as the α (Kcnma1)- and β (Kncmb1)-subunits of the large-conductance KCa channel. Values are means ± SE; n = 4–6. *P < 0.05 vs. control (Con); N.D., not detected.

DISCUSSION

This investigation was designed to delineate the impact of subpressor Aldo infusion on coronary adenosine-induced vasodilation and the mechanistic basis of Aldo-induced impairment of adenosine vasodilation. The primary new findings of this study are that 1) coronary adenosine-induced vasodilation is impaired by Aldo infusion independent of blood pressure; 2) Aldo infusion impaired coronary vasodilation to selective A2A, but not A2B, receptor activation; 3) coronary adenylate cyclase activation and cAMP production in response to adenosine stimulation is unchanged by Aldo infusion; 4) impaired coronary dilation to adenosine and selective A2A activation by Aldo are normalized by blockade of KCa, but not Kir, channels; and 5) Aldo infusion induces downregulation of some coronary KCa channels. These findings provide the first evidence that Aldo attenuates coronary adenosine-induced vasodilation involving impaired A2A-KCa-dependent vasodilation. Importantly, these data provide mechanistic insight into potential links underlying the close association of elevated Aldo concentrations and worsened cardiac outcomes in various patient populations.

Accumulating evidence from our laboratory and others has demonstrated vascular dysfunction induced by infusion of a subpressor concentration of Aldo (5, 12, 22, 34). The results of the present study expand this previous work by demonstrating impaired coronary adenosine-induced vasodilation in concert with impaired endothelium-dependent vasodilation following chronic hyperaldosteronism, independent of blood pressure. The latter finding is consistent with prior studies reporting Aldo-induced impairment of endothelium-dependent vasodilation including our report in coronary arterioles from rats infused with Aldo (5, 22, 34). Importantly, the impairment of endothelium-dependent vasodilation by subpressor Aldo occurs with no change in endothelium-independent responses to nitric oxide donors (e.g., sodium nitroprusside), similar to our present results (5, 22, 34). Together, these data suggest a differential impact of Aldo on smooth muscle-dependent vasodilator mechanisms with a primary effect on adenosine-induced vasodilation. Given the cardioprotective impact of adenosine-induced coronary vasodilation during cardiac ischemia (10), these results have important implications for the close association of increased plasma Aldo and cardiac mortality in patients (24, 40). Indeed, the Aldo-induced reduction of coronary adenosine-mediated vasodilation occurred above the vasoactive threshold for adenosine (~0.1 µM) at concentrations realized during acute cardiac ischemia in cardiac interstitium (>0.3 µM) (38, 41).

Mechanistically, our data reveal that Aldo attenuates vasodilation initiated by activation of A2A, but not A2B, receptors in the mouse coronary artery. Furthermore, consistent with some previous reports in other mouse vessels (39), A2B receptor activation elicits more pronounced vasodilation than A2A activation, implicating A2B receptors as the primary mediators of vasodilation to adenosine in mouse coronary artery. In addition, adenosine-induced vasodilation in this vessel occurs independent of nitric oxide and involves adenylate cyclase signaling. These data raise several important points of consideration. First, our results suggest substantive differences in the mechanism of dilation to adenosine in mouse coronary artery compared with isolated arterioles or whole heart preparations that may impact extrapolation of these findings to larger mammals. Specifically, contrary to our results in mouse coronary artery, prior swine studies by us and others utilizing isolated coronary arterioles or in vivo demonstrate primary involvement of A2A, not A2B, receptors in coronary adenosine vasodilation (6, 7, 19). Furthermore, selective A2A agonists and adenosine are equally efficacious in eliciting maximal coronary dilation in humans in vivo (31, 42) and in perfused rat and mouse hearts (13). Thus the results of the present study may underestimate the effect of Aldo to attenuate coronary adenosine-mediated vasodilation across the entire coronary vasculature dominated by A2A signaling. Second, downstream of A2 receptor activation, adenylate cyclase-mediated cAMP production is a primary component of vascular adenosine signaling (15, 32). Notably, coronary adenosine-mediated vasodilation was equivalently reduced by adenylate cyclase inhibition in vessels from Con and Aldo mice and adenosine-stimulated vascular cAMP production was not different between groups. Thus these data suggest that the impairment of adenosine/A2A receptor-dependent vasodilation may occur downstream of cAMP.

It has recently been recognized that Aldo signaling contributes to the functional expression of vascular ion channels, including a variety of K+ channels that contribute to adenosine-mediated coronary dilation (11, 12). Previous work has elucidated involvement of voltage-gated K+ (Kv), ATP-sensitive K+ (KATP), and calcium-activated K+ (KCa) channels in coronary adenosine-mediated vasodilation (6, 7, 13, 17, 18, 32). In the murine coronary artery, our data reveal activation of Kir and KCa channels contributing to adenosine dilation and that dilation to selective A2A activation exclusively involves KCa activation. Accordingly, combined KCa blockade equalized adenosine dilation in vessels from Con and Aldo mice and abrogated A2A-dependent vasodilation in both groups. These data indicate reduced A2A-dependent activation of coronary KCa channels following hyperaldosteronism further corroborated by reduced gene expression of coronary KCa channels, specifically the small conductance KCa (SKCa2.3, Kcnn3) and intermediate conductance KCa (IKCa1, Kcnn4) channels with no change in large conductance KCa channel subunit expression. The latter result is inconsistent with a previous report of reduced BKCa subunit expression in coronary smooth muscle of mice with cardiac overexpression of Aldo synthase (1) although adenosine-induced vasodilation was not assessed. We speculate that the discrepancy between our results and those of this previous report may occur as a result of the coronary vasculature being exposed to much higher aldosterone concentrations in this model of cardiac aldosterone production (1). Coronary expression of small and intermediate conductance KCa channels was not evaluated in this previous report. Together, these data further support a selective impairment of adenosine-mediated coronary vasodilation in hyperaldosteronism mediated by impaired A2A-KCa-dependent vasodilation, independent of blood pressure.

The findings of our study suggest impaired adenosine-mediated coronary vasodilation as a potential mechanism underlying the direct blood pressure-independent association of plasma Aldo levels with acute ischemic events and cardiovascular mortality (21, 24, 40). To our knowledge, this is the first study to examine the impact of subpressor Aldo infusion on coronary adenosine-mediated vasodilation. Importantly, prior studies have established adenosine-mediated vasodilation as a critical protective mechanism during cardiac ischemia such that inhibition of this response is associated with deterioration of cardiac function (10, 20, 25). Furthermore, coronary hyperemia in response to longer term no-flow ischemia (300 s) has been reported to involve adenosine and KCa channel activation (37). Accordingly, we would speculate that the increased risk of cardiac events and worsened prognosis in conditions associated with inappropriate renin-angiotensin-aldosterone system activation are due, at least in part, to attenuation of adenosine-mediated coronary vasodilation. Indeed, coronary microvascular dysfunction, assessed by adenosine- or A2A-stimulated coronary flow reserve, is independently predictive of cardiovascular mortality in patients with end stage renal disease (36) and cardiometabolic diseases including obesity and diabetes (2, 28, 30). The potential involvement of Aldo-dependent limitation of coronary adenosine dilation is supported by two recent studies demonstrating that inhibition of the Aldo-binding mineralocorticoid receptor improves adenosine-stimulated coronary flow reserve in patients with diabetes, independent of blood pressure (14, 23). Thus, while our data demonstrate a link between Aldo and impaired adenosine dilation, additional studies are needed to clearly and mechanistically evaluate this mechanism underlying ultimate cardiac outcomes in patient populations.

In summary, we have demonstrated that Aldo impairs coronary adenosine-mediated dilation involving reduced A2A-KCa-dependent vasodilation associated with KCa channel downregulation. Importantly, this impact of Aldo occurred in the absence of changes in blood pressure or metabolic status (i.e., normal blood glucose) suggesting a direct local coronary impact of Aldo. This study provides important insight into a potential mechanism of increased ischemic events in a variety of patient populations providing a rationale for the use of Aldo antagonists to improve or preserve coronary microvascular function.

GRANTS

This work was funded by Department of Veterans Affairs Biomedical Laboratory Research and Development Grant CDA-2 IK2 BX002030 (to S. B. Bender) and National Heart, Lung, and Blood Institute (NHLBI) Grant HL-136386 (to S. B. Bender). M. Khan was supported by an American Physiological Society Short-Term Research Education Program to Increase Diversity in Health-Related Research (STRIDE) Fellowship, funded by NHLBI Grant R25-HL-115473. B. Chandrasekar is a Veterans Affairs Research Career Scientist (IK6 BX004016-01), and his work is supported by a VA Merit Award I01 BX004220) This work was also supported by resources and the use of facilities at the Harry S. Truman Memorial Veterans Hospital in Columbia, MO.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

M.K., D.K.B., and S.B.B. conceived and designed research; M.K., A.I.M., S.M.B., and S.B.B. performed experiments; M.K., A.I.M., S.M.B., and S.B.B. analyzed data; M.K., S.M.B., B.C., D.K.B., and S.B.B. interpreted results of experiments; M.K. and S.B.B. prepared figures; M.K. and S.B.B. drafted manuscript; M.K., A.I.M., S.M.B., B.C., D.K.B., and S.B.B. edited and revised manuscript; M.K., A.I.M., S.M.B., B.C., D.K.B., and S.B.B. approved final version of manuscript.

ACKNOWLEDGMENTS

We gratefully acknowledge the technical assistance of Chastidy Bailey.

REFERENCES

  • 1.Ambroisine ML, Favre J, Oliviero P, Rodriguez C, Gao J, Thuillez C, Samuel JL, Richard V, Delcayre C. Aldosterone-induced coronary dysfunction in transgenic mice involves the calcium-activated potassium (BKCa) channels of vascular smooth muscle cells. Circulation 116: 2435–2443, 2007. doi: 10.1161/CIRCULATIONAHA.107.722009. [DOI] [PubMed] [Google Scholar]
  • 2.Bajaj NS, Osborne MT, Gupta A, Tavakkoli A, Bravo PE, Vita T, Bibbo CF, Hainer J, Dorbala S, Blankstein R, Bhatt DL, Di Carli MF, Taqueti VR. Coronary microvascular dysfunction and cardiovascular risk in obese patients. J Am Coll Cardiol 72: 707–717, 2018. doi: 10.1016/j.jacc.2018.05.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bender SB, Castorena-Gonzalez JA, Garro M, Reyes-Aldasoro CC, Sowers JR, DeMarco VG, Martinez-Lemus LA. Regional variation in arterial stiffening and dysfunction in Western diet-induced obesity. Am J Physiol Heart Circ Physiol 309: H574–H582, 2015. doi: 10.1152/ajpheart.00155.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bender SB, DeMarco VG, Padilla J, Jenkins NT, Habibi J, Garro M, Pulakat L, Aroor AR, Jaffe IZ, Sowers JR. Mineralocorticoid receptor antagonism treats obesity-associated cardiac diastolic dysfunction. Hypertension 65: 1082–1088, 2015. doi: 10.1161/HYPERTENSIONAHA.114.04912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bender SB, Tune JD, Borbouse L, Long X, Sturek M, Laughlin MH. Altered mechanism of adenosine-induced coronary arteriolar dilation in early-stage metabolic syndrome. Exp Biol Med (Maywood) 234: 683–692, 2009. doi: 10.3181/0812-RM-350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Berwick ZC, Payne GA, Lynch B, Dick GM, Sturek M, Tune JD. Contribution of adenosine A(2A) and A(2B) receptors to ischemic coronary dilation: role of K(V) and K(ATP) channels. Microcirculation 17: 600–607, 2010. doi: 10.1111/j.1549-8719.2010.00054.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dagres N, Saller B, Haude M, Hüsing J, von Birgelen C, Schmermund A, Sack S, Baumgart D, Mann K, Erbel R. Insulin sensitivity and coronary vasoreactivity: insulin sensitivity relates to adenosine-stimulated coronary flow response in human subjects. Clin Endocrinol (Oxf) 61: 724–731, 2004. doi: 10.1111/j.1365-2265.2004.02156.x. [DOI] [PubMed] [Google Scholar]
  • 9.Downing SE, Lee JC, Weinstein EM. Coronary dilator actions of adenosine and CO2 in experimental diabetes. Am J Physiol 243: H252–H258, 1982. doi: 10.1152/ajpheart.1982.243.2.H252. [DOI] [PubMed] [Google Scholar]
  • 10.Duncker DJ, Bache RJ. Regulation of coronary blood flow during exercise. Physiol Rev 88: 1009–1086, 2008. doi: 10.1152/physrev.00045.2006. [DOI] [PubMed] [Google Scholar]
  • 11.DuPont JJ, Hill MA, Bender SB, Jaisser F, Jaffe IZ. Aldosterone and vascular mineralocorticoid receptors: regulators of ion channels beyond the kidney. Hypertension 63: 632–637, 2014. doi: 10.1161/HYPERTENSIONAHA.113.01273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.DuPont JJ, Jaffe IZ. 30 Years of the mineralocorticoid receptor: the role of the mineralocorticoid receptor in the vasculature. J Endocrinol 234: T67–T82, 2017. doi: 10.1530/JOE-17-0009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Flood A, Headrick JP. Functional characterization of coronary vascular adenosine receptors in the mouse. Br J Pharmacol 133: 1063–1072, 2001. doi: 10.1038/sj.bjp.0704170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Garg R, Rao AD, Baimas-George M, Hurwitz S, Foster C, Shah RV, Jerosch-Herold M, Kwong RY, Di Carli MF, Adler GK. Mineralocorticoid receptor blockade improves coronary microvascular function in individuals with type 2 diabetes. Diabetes 64: 236–242, 2015. doi: 10.2337/db14-0670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Headrick JP, Ashton KJ, Rose’meyer RB, Peart JN. Cardiovascular adenosine receptors: expression, actions and interactions. Pharmacol Ther 140: 92–111, 2013. doi: 10.1016/j.pharmthera.2013.06.002. [DOI] [PubMed] [Google Scholar]
  • 16.Heaps CL, Tharp DL, Bowles DK. Hypercholesterolemia abolishes voltage-dependent K+ channel contribution to adenosine-mediated relaxation in porcine coronary arterioles. Am J Physiol Heart Circ Physiol 288: H568–H576, 2005. doi: 10.1152/ajpheart.00157.2004. [DOI] [PubMed] [Google Scholar]
  • 17.Hein TW, Belardinelli L, Kuo L. Adenosine A(2A) receptors mediate coronary microvascular dilation to adenosine: role of nitric oxide and ATP-sensitive potassium channels. J Pharmacol Exp Ther 291: 655–664, 1999. [PubMed] [Google Scholar]
  • 18.Hein TW, Kuo L. cAMP-independent dilation of coronary arterioles to adenosine : role of nitric oxide, G proteins, and K(ATP) channels. Circ Res 85: 634–642, 1999. doi: 10.1161/01.RES.85.7.634. [DOI] [PubMed] [Google Scholar]
  • 19.Hein TW, Wang W, Zoghi B, Muthuchamy M, Kuo L. Functional and molecular characterization of receptor subtypes mediating coronary microvascular dilation to adenosine. J Mol Cell Cardiol 33: 271–282, 2001. doi: 10.1006/jmcc.2000.1298. [DOI] [PubMed] [Google Scholar]
  • 20.Hori M, Tamai J, Kitakaze M, Iwakura K, Gotoh K, Iwai K, Koretsune Y, Kagiya T, Kitabatake A, Kamada T. Adenosine-induced hyperemia attenuates myocardial ischemia in coronary microembolization in dogs. Am J Physiol 257: H244–H251, 1989. doi: 10.1152/ajpheart.1989.257.1.H244. [DOI] [PubMed] [Google Scholar]
  • 21.Ivanes F, Susen S, Mouquet F, Pigny P, Cuilleret F, Sautière K, Collet JP, Beygui F, Hennache B, Ennezat PV, Juthier F, Richard F, Dallongeville J, Hillaert MA, Doevendans PA, Jude B, Bertrand M, Montalescot G, Van Belle E. Aldosterone, mortality, and acute ischaemic events in coronary artery disease patients outside the setting of acute myocardial infarction or heart failure. Eur Heart J 33: 191–202, 2012. doi: 10.1093/eurheartj/ehr176. [DOI] [PubMed] [Google Scholar]
  • 22.Jia G, Habibi J, Aroor AR, Hill MA, Yang Y, Whaley-Connell A, Jaisser F, Sowers JR. Epithelial sodium channel in aldosterone-induced endothelium stiffness and aortic dysfunction. Hypertension 72: 731–738, 2018. doi: 10.1161/HYPERTENSIONAHA.118.11339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Joffe HV, Kwong RY, Gerhard-Herman MD, Rice C, Feldman K, Adler GK. Beneficial effects of eplerenone versus hydrochlorothiazide on coronary circulatory function in patients with diabetes mellitus. J Clin Endocrinol Metab 92: 2552–2558, 2007. doi: 10.1210/jc.2007-0393. [DOI] [PubMed] [Google Scholar]
  • 24.Joseph JJ, Echouffo-Tcheugui JB, Kalyani RR, Yeh HC, Bertoni AG, Effoe VS, Casanova R, Sims M, Wu WC, Wand GS, Correa A, Golden SH. Aldosterone, renin, cardiovascular events, and all-cause mortality among african americans: The Jackson Heart Study. JACC Heart Fail 5: 642–651, 2017. doi: 10.1016/j.jchf.2017.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Laxson DD, Homans DC, Bache RJ. Inhibition of adenosine-mediated coronary vasodilation exacerbates myocardial ischemia during exercise. Am J Physiol Heart Circ Physiol 265: H1471–H1477, 1993. doi: 10.1152/ajpheart.1993.265.5.H1471. [DOI] [PubMed] [Google Scholar]
  • 26.McGraw AP, Bagley J, Chen WS, Galayda C, Nickerson H, Armani A, Caprio M, Carmeliet P, Jaffe IZ. Aldosterone increases early atherosclerosis and promotes plaque inflammation through a placental growth factor-dependent mechanism. J Am Heart Assoc 2: e000018, 2013. doi: 10.1161/JAHA.112.000018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Milliez P, Girerd X, Plouin PF, Blacher J, Safar ME, Mourad JJ. Evidence for an increased rate of cardiovascular events in patients with primary aldosteronism. J Am Coll Cardiol 45: 1243–1248, 2005. doi: 10.1016/j.jacc.2005.01.015. [DOI] [PubMed] [Google Scholar]
  • 27a.Mueller KB, Bender SB, Hong K, Yang Y, Aronovitz M, Jaisser F, Hill MA, Jaffe IZ. Endothelial mineralocorticoid receptors differentially contribute to coronary and mesenteric vascular function without modulating blood pressure. Hypertension 66: 988–997, 2015. doi: 10.1161/HYPERTENSIONAHA.115.06172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Murthy VL, Naya M, Foster CR, Gaber M, Hainer J, Klein J, Dorbala S, Blankstein R, Di Carli MF. Association between coronary vascular dysfunction and cardiac mortality in patients with and without diabetes mellitus. Circulation 126: 1858–1868, 2012. doi: 10.1161/CIRCULATIONAHA.112.120402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Noblet JN, Owen MK, Goodwill AG, Sassoon DJ, Tune JD. Lean and obese coronary perivascular adipose tissue impairs vasodilation via differential inhibition of vascular smooth muscle K+ channels. Arterioscler Thromb Vasc Biol 35: 1393–1400, 2015. doi: 10.1161/ATVBAHA.115.305500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Osborne MT, Bajaj NS, Taqueti VR, Gupta A, Bravo PE, Hainer J, Bibbo CF, Dorbala S, Blankstein R, Di Carli MF. Coronary microvascular dysfunction identifies patients at high risk of adverse events across cardiometabolic diseases. J Am Coll Cardiol 70: 2835–2837, 2017. doi: 10.1016/j.jacc.2017.09.1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Prasad A, Zareh M, Doherty R, Gopal A, Vora H, Somma K, Mehra A, Clavijo LC, Matthews RV, Shavelle DM. Use of regadenoson for measurement of fractional flow reserve. Catheter Cardiovasc Interv 83: 369–374, 2014. doi: 10.1002/ccd.25055. [DOI] [PubMed] [Google Scholar]
  • 32.Price JM, Cabell JF, Hellermann A. Inhibition of cAMP mediated relaxation in rat coronary vessels by block of Ca2+ activated K+ channels. Life Sci 58: 2225–2232, 1996. doi: 10.1016/0024-3205(96)00217-2. [DOI] [PubMed] [Google Scholar]
  • 33.Richard V, Kaeffer N, Tron C, Thuillez C. Ischemic preconditioning protects against coronary endothelial dysfunction induced by ischemia and reperfusion. Circulation 89: 1254–1261, 1994. doi: 10.1161/01.CIR.89.3.1254. [DOI] [PubMed] [Google Scholar]
  • 34.Schäfer N, Lohmann C, Winnik S, van Tits LJ, Miranda MX, Vergopoulos A, Ruschitzka F, Nussberger J, Berger S, Lüscher TF, Verrey F, Matter CM. Endothelial mineralocorticoid receptor activation mediates endothelial dysfunction in diet-induced obesity. Eur Heart J 34: 3515–3524, 2013. doi: 10.1093/eurheartj/eht095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Scott JB, Chen WT, Swindall BT, Dabney JM, Haddy FJ. Evidence from bioassay studies indicating a role for adenosine in cardiac ischemic and hypoxic dilation in the dog. Circ Res 45: 451–459, 1979. doi: 10.1161/01.RES.45.4.451. [DOI] [PubMed] [Google Scholar]
  • 36.Shah NR, Charytan DM, Murthy VL, Skali Lami H, Veeranna V, Cheezum MK, Taqueti VR, Kato T, Foster CR, Hainer J, Gaber M, Klein J, Dorbala S, Blankstein R, Di Carli MF. Prognostic value of coronary flow reserve in patients with dialysis-dependent ESRD. J Am Soc Nephrol 27: 1823–1829, 2016. doi: 10.1681/ASN.2015030301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Shinoda M, Toki Y, Murase K, Mokuno S, Okumura K, Ito T. Types of potassium channels involved in coronary reactive hyperemia depend on duration of preceding ischemia in rat hearts. Life Sci 61: 997–1007, 1997. doi: 10.1016/S0024-3205(97)00604-8. [DOI] [PubMed] [Google Scholar]
  • 38.Stepp DW, Kroll K, Feigl EOK. K+ATP channels and adenosine are not necessary for coronary autoregulation. Am J Physiol 273: H1299–H1308, 1997. doi: 10.1152/ajpheart.1997.273.3.H1299. [DOI] [PubMed] [Google Scholar]
  • 39.Teng B, Fil D, Tilley SL, Ledent C, Krahn T, Mustafa SJ. Functional and RNA expression profile of adenosine receptor subtypes in mouse mesenteric arteries. J Cardiovasc Pharmacol 61: 70–76, 2013. doi: 10.1097/FJC.0b013e318278575e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tomaschitz A, Pilz S, Ritz E, Meinitzer A, Boehm BO, März W. Plasma aldosterone levels are associated with increased cardiovascular mortality: the Ludwigshafen Risk and Cardiovascular Health (LURIC) study. Eur Heart J 31: 1237–1247, 2010. doi: 10.1093/eurheartj/ehq019. [DOI] [PubMed] [Google Scholar]
  • 41.Tune JD, Richmond KN, Gorman MW, Olsson RA, Feigl EO. Adenosine is not responsible for local metabolic control of coronary blood flow in dogs during exercise. Am J Physiol Heart Circ Physiol 278: H74–H84, 2000. doi: 10.1152/ajpheart.2000.278.1.H74. [DOI] [PubMed] [Google Scholar]
  • 42.Vasu S, Bandettini WP, Hsu LY, Kellman P, Leung S, Mancini C, Shanbhag SM, Wilson J, Booker OJ, Arai AE. Regadenoson and adenosine are equivalent vasodilators and are superior than dipyridamole- a study of first pass quantitative perfusion cardiovascular magnetic resonance. J Cardiovasc Magn Reson 15: 85, 2013. doi: 10.1186/1532-429X-15-85. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Heart and Circulatory Physiology are provided here courtesy of American Physiological Society

RESOURCES