REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and Virus Strains
Mycobacterium marinum M strain transformed with pMSP12:tdTomato	Takaki et al., 2013	derivatives of ATCC #BAA-535
M. marinum M strain transformed with pMSP12:EBFP2	Takaki et al., 2013	derivatives of ATCC #BAA-535
M. marinum M strain transformed with pMSP12:tdKatushka	Takaki et al., 2013	derivatives of ATCC #BAA-535
M. marinum M strain transformed with pMSP12:wasabi	Takaki et al., 2013	derivatives of ATCC #BAA-535
M. tuberculosis ΔleuD ΔpanCD double auxotroph strain transformed with pMSP12:mCherry	A. Floto Laboratory	N/A
M. tuberculosis ΔleuDΔpanCD double auxotroph strain transformed with pMSP12:GFP	A. Floto Laboratory	N/A
Chemicals, Peptides, and Recombinant Proteins
Zebrafish recombinant TNF	Roca et al., 2008	N/A
Pepstatin A	Sigma-Aldrich	Cat#P4265; CAS: 26305-03-3
E64d	Sigma-Aldrich	Cat#E8640; CAS: 88321-09-9
BI-6C9	Sigma-Aldrich	Cat#B0186; CAS: 791835-21-7
(S)-(+)-Camptothecin (CPT)	Alfa Aesar	Cat#J62523; CAS: 7689-03-4
Acridine orange (2% solution in H2O)	Sigma-Aldrich	Cat#A9231; CAS: 65-61-2
BCB (Bax Channel Blocker)	Alfa Aesar	Cat#J64257
Rhod-2, AM, cell permeant	Fisher Scientific	Cat#R1245MP
Ru360	VWR International	Cat#557440
Amifostine	Cambridge Bioscience	Cat#14398-50mg-CAY
NAC (N-Acetyl-L-Cysteine)	Cambridge Bioscience	Cat#A0918-10 g
Mitotempo	Cambridge Bioscience	Cat#16621-5mg-CAY
GSH	Cambridge Bioscience	Cat#1242-1
Alisporivir	Novartis	Roca and Ramakrishnan, 2013
Xestospongin C (XestC)	Cambridge Bioscience	Cat#64950-10 ug-CAY
Ryanodine	Generon	Cat#2489-500
Dantrolene sodium salt	Sigma-Aldrich	Cat#D9175-1G; CAS: 14663-23-1
Nifedipine	Cambridge Bioscience	Cat#N3228-1 g
Diltiazem	Cambridge Bioscience	Cat#D3447-1 g
Verapamil HCl	Fisher Scientific	Cat#10403045
Thapsigargin	Sigma-Aldrich	Cat#T9033-.5MG; CAS: 67526-95-8
4-Chloro-m-cresol (4CmC)	Sigma-Aldrich	Cat#55402-5G; CAS: 59-50-7
MitoTracker Red CM-H2Xros	Fisher Scientific	Cat# M7513
MitoSOX	Fisher Scientific	Cat#M36008
Desipramine hydrochloride	Sigma-Aldrich	Cat#D3900-5G; CAS: 58-28-6
Necrostatin-1	Alfa Aesar	Cat#J65341.F+; CAS: 4311-88-0
Necrosulfonamide (NSA)	Cambridge Bioscience	Cat#20844-5mg-CAY; CAS: 1360614-45-7
PTU (1-phenyl-2-thiourea)	Sigma-Aldrich	Cat#P7629; CAS: 103-85-5
Tango Buffer (10x)	Thermo Scientific	Cat#BY5
PMA (Phorbol 12-myristate 13-acetate)	Sigma-Aldrich	Cat#P1585-1MG; CAS: 16561-29-8
Human recombinant TNF	Sigma-Aldrich	Cat#SRP3177-50UG
D (+) Trehalose dehydrate	Sigma-Aldrich	Cat#T0167-10G
Nec-1 s	Cambridge Bioscience	Cat#2263-5
Q-VD-OPh	Source Bioscience	Cat#ABE283
Z-VAD-FMK	Cambridge Bioscience	Cat#14463-1MG-CAY
SYTOX® Green Nucleic Acid Stain	Life Technologies	Cat#S7020
Gibson Assembly
NEBuilder HiFi DNA Assembly Master Mix	New England Biolabs	Cat#E2621
RNeasy Mini Kit	QIAGEN	Cat#74104
mMessage mMachine kit	Ambion	N/A
polyA Tailing kit	Ambion	N/A
Experimental Models: Cell Lines
THP-1 human monocytic cell line	ATCC	TIB-202
Experimental Models: Organisms/Strains
Zebrafish (Danio rerio): wild type AB strain	University of Cambridge	ZFIN ID: ZDB-GENO-960809-7
Zebrafish: Tg(mpeg1:YFP)w200	Roca and Ramakrishnan, 2013	ZFIN ID: ZDB-FISH-150901-6828
Zebrafish: Tg(mpeg1:Brainbow)w201	Pagán et al., 2015	ZFIN ID: ZDB-FISH-151204-7
Zebrafish: baxarr1	This work	N/A
Zebrafish: baxbrr10	This work	N/A
Zebrafish: ripk3rr7	This work	N/A
Zebrafish: Tg(BH:GFP-mfap4:Mito-GCaMP3)	This work	N/A
Oligonucleotides
Morpholino: Cathepsin D E2/I2 TGTCAGCAA GCAGATACTCACATCT	Gene Tools; Follo et al., 2011	ZDB-MRPHLNO-110722-2
Morpholino: BID GGTCAAAGTTCCTGTTGAAGTCCAT	Gene Tools; Kratz et al., 2006	ZDB-MRPHLNO-070126-2
Morpholino: PGAM5 AGCGCCCTCCGAAAA GACATGCTTC	Roca and Ramakrishnan, 2013	ZDB-MRPHLNO-130820-4
Morpholino: cyclophilin D-ATG TTGGGTTTG ACATTTTCTTAGAT	Gene Tools; Roca and Ramakrishnan, 2013	ZDB-MRPHLNO-130820-5
Baxarr1 forward primer for genotyping by HRM, sequence: 5′-GACCTCTGCCTCTTGCAGCTT-3′	This work	N/A
Baxarr1 reverse primer for genotyping by HRM, sequence: 5′-GCAAACACTGCGCGAGGCGTT-3′	This work	N/A
Baxbrr10 forward primer for genotyping by HRM, sequence: 5′-GTTGCATCAAGTTTATGAGGTGTTG-3′	This work	N/A
Baxbrr10 reverse primer for genotyping by HRM, sequence: 5′-CAGGGTAGTAAGGCAGGAG CTAATGG-3′	This work	N/A
RIPK3rr7 forward primer for genotyping by HRM, sequence: 5′-AGAGAAGCGGAGCTGATGTTTGAT-3′	This work	N/A
RIPK3rr7 reverse primer for genotyping by HRM, sequence: 5′-CTTGGCATCCAGGCTGTCACTCAGC-3′	This work	N/A
Recombinant DNA
Zebrafish full-length BAX	This work	N/A
Zebrafish ΔBH3-BAX	This work	N/A
Zebrafish MOM-ΔBH3-BAX	This work	N/A
Zebrafish ER-ΔBH3-BAX	This work	N/A
Zebrafish MOM-full-length BAX	This work	N/A
Zebrafish TMBIM3	This work	N/A
Zebrafish TMBIM6	This work	N/A
Venus-V2A-BH4 (from BC-L2)	This work	N/A
pTol2-PhiC31LS-BH:GFP-mfap4:Mito-GCaMP3	This work	N/A
pME mitoGCaMP3	D. Raible Laboratory; Esterberg et al., 2014	N/A
pTol2 PhiC31LS BH NewMCS (cmlc2:eGFP)	This work	N/A
pTol2 PhiC31LS BH NewMCS (cmlc2:RFP)	This work	N/A
pTol2 mfap4:TdTomato-CAAX	D. Tobin Laboratory; Walton et al., 2015	N/A
pSB_PhiC31LandingSite	Kirchmaier et al., 2013	Addgene #48875
pCS2P+	Marc Kirschner	Addgene #17095
Software and Algorithms
NIS-Elements	Nikon	N/A
Imaris	Bitplane	N/A
Prism	GraphPad	N/A
ImageJ	https://imagej.nih.gov/ij/	N/A
FPC (ImageJ); macro for quantification of bacterial burden by fluorescence imaging used in this work for quantification of camptothecin-induced apoptosis	Takaki et al., 2013	N/A
CorelDraw X5	Corel	N/A