Abstract
This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.
Keywords: carcinoma, squamous cell, laryngeal neoplasms, gene deletion, GSTM1, alleles, gene frequency
References
- 1. Brugere J., Guenel P., Leclerc A., Rodriguez J., Differential effects of tobacco and alcohol in cancer of the larynx, pharynx, and mouth, Cancer, 57: 391–395, 1986. [DOI] [PubMed] [Google Scholar]
- 2. Foulkes W.D., Brunet J.S., Sieh W., Black M.J., Shenouda G., Narod S.A., Familial risks of squamous cell carcinoma of the head and neck: retrospective case‐control study, BMJ, 313: 716–721, 1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Koch W.M., McQuone S., Clinical and molecular aspects of squamous cell carcinoma of the head and neck in the nonsmoker and nondrinker, Curr. Opin. Oncol., 9: 257–261, 1997. [DOI] [PubMed] [Google Scholar]
- 4. Geisler S.A., Olshan A.F., GSTM1, GSTT1, and the risk of squamous cell carcinoma of the head and neck: a mini‐HuGE review, Am. J. Epidemiol., 154: 95–105, 2001. [DOI] [PubMed] [Google Scholar]
- 5. Sheehan D., Meade G., Foley V.M., Dowd C.A., Structure, function and evolution of glutathione transferases: implications for classification of non‐mammalian members of an ancient enzyme superfamily, Biochem. J., 360: 1–16, 2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Hayes J.D., Pulford D.J., The glutathione S‐transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance, Crit. Rev. Biochem. Mol. Biol., 30: 445–600, 1995. [DOI] [PubMed] [Google Scholar]
- 7. Inskip. A. , ElexperuCamiruaga J., Buxton N., Dias P.S., MacIntosh J., Campbell D., Jones P.W., Yengi L., Talbot J.A., Strange R.C., Fryer A.A., Identification of polymorphism at the glutathione S‐transferase, GSTM3 locus: evidence for linkage with GSTM1*A. Biochem. J., 312: 713–716, 1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Emahazion T., Jobs M., Howell W.M., Siegfried M., Wyoni P.I., Prince J.A., Brookes A.J., Identification of 167 polymorphisms in 88 genes from candidate neurodegeneration pathways, Gene, 238: 315–324, 1999. [DOI] [PubMed] [Google Scholar]
- 9. Lin H.J., Han C.Y., Bernstein D.A., Hsiao W., Lin B.K., Hardy S., Ethnic distribution of the glutathione transferase Mu 1–1 (GSTM1) null genotype in 1473 individuals and application to bladder cancer susceptibility, Carcinogenesis, 15: 1077–1081, 1994. [DOI] [PubMed] [Google Scholar]
- 10. Strange R.C., Jones P.W., Fryer A.A., Glutathione S‐transferase: genetics and role in toxicology, Toxicol. Lett., 112–113: 357–363, 2000. [DOI] [PubMed]
- 11. Blot W.J., McLaughlin J.K., Winn D.M., Austin D.F., Greenberg R.S., Preston‐Martin S., Bernstein L., Schoenberg J.B., Stemhagen A., Fraumeni J.F. Jr., Smoking and drinking in relation to oral and pharyngeal cancer, Cancer Res, 48: 3282–3287, 1988. [PubMed] [Google Scholar]
- 12. Vokes E.E., Weichselbaum R.R., Lippman S.M., Hong W.K., Head and neck cancer, N. Engl. J. Med., 328: 184–194, 1993. [DOI] [PubMed] [Google Scholar]
- 13. Copper M.P., Jovanovic A., Nauta J.J., Braakhuis B.J., De Vries N., Van der Waal I., Snow G.B., Role of genetic factors in the etiology of squamous cell carcinoma of the head and neck, Arch. Otolaryngol. Head Neck Surg., 121: 157–160, 1995. [DOI] [PubMed] [Google Scholar]
- 14. Hirvonen A., Husgafvel‐Pursiainen K., Anttila S., Vainio H., The GSTM1 null genotype as a potential risk modifier for squamous cell carcinoma of the lung, Carcinogenesis, 14: 1479–1481, 1993. [DOI] [PubMed] [Google Scholar]
- 15. Lafuente A., Pujol F., Carretero P., Villa J.P., Cuchi A., Human glutathione S‐transferase mu (GST mu) deficiency as a marker for the susceptibility to bladder and larynx cancer among smokers, Cancer Lett., 68: 49–54, 1993. [DOI] [PubMed] [Google Scholar]
- 16. Katoh T., Nagata N., Kuroda Y., Itoh H., Kawahara A., Kuroki N., Ookuma R., Bell D.A., Glutathione S‐transferase M1 (GSTM1) and T1 (GSTT1) genetic polymorphism and susceptibility to gastric and colorectal adenocarcinoma, Carcinogenesis, 17: 1855–1859, 1996. [DOI] [PubMed] [Google Scholar]
- 17. Shanley S.M., Chenevix‐Trench G., Palmer J., Hayward N., Glutathione S‐transferase GSTM1 null genotype is not overrepresented in Australian patients with nevoid basal cell carcinoma syndrome or sporadic melanoma, Carcinogenesis, 16: 2003–2004, 1995. [DOI] [PubMed] [Google Scholar]
- 18. Deakin M., Elder J., Hendrickse C., Peckham D., Baldwin D., Pantin C., Wild N., Leopard P., Bell D.A., Jones P., Duncan H., Brannigan K., Alldersea J., Fryer A.A., Strange R.C., Glutathione S‐transferase GSTT1 genotypes and susceptibility to cancer: studies of interactions with GSTM1 in lung, oral, gastric and colorectal cancers, Carcinogenesis, 17: 881–884, 1996. [DOI] [PubMed] [Google Scholar]
- 19. Yengi L., Inskip A., Gilford J., Alldersea J., Bailey L., Smith A., Lear J.T., Heagerty A.H., Bowers B., Hand P., Hayes J.D., Jones P.W., Strange R.C., Fryer A.A., Polymorphism at the glutathione S‐transferase locus GSTM3: interactions with cytochrome P450 and glutathione S‐transferase genotypes as risk factors for multiple cutaneous basal cell carcinoma, Cancer Res., 56: 1974–1977, 1996. [PubMed] [Google Scholar]
- 20. Goto I., Yoneda S., Yamamoto M., Kawajiri K. Prognostic significance of germ line polymorphisms of the CYP1A1 and glutathione S‐transferase genes in patients with non‐small cell lung cancer, Cancer Res., 56: 3725–3730, 1996. [PubMed] [Google Scholar]
- 21. Yu M.W., Gladek‐Yarborough A., Chiamprasert S., Santella R.M., Liaw Y.F., Chen C.J., Cytochrome P450 2E1 and glutathione S‐transferase M1 polymorphisms and susceptibility to hepatocellular carcinoma, Gastroenterology; 109: 1266–1273, 1995. [DOI] [PubMed] [Google Scholar]
- 22. Oude Ophuis M.B., Van Lieshout E.M., Roelofs H.M., Peters W.H., Manni J.J., Glutathione S‐transferase M1 and T1 and cytochrome P4501A1 polymorphisms in relation to the risk for benign and malignant head and neck lesions, Cancer, 82: 936–943, 1998. [PubMed] [Google Scholar]
- 23. Jourenkova N., Reinikainen M., Bouchardy C., Dayer P., Benhamou S., Hirvonen A., Larynx cancer risk in relation to glutathione S‐transferase M1 and T1 genotypes and tobacco smoking, Cancer Epidemiol. Biomarkers Prev., 7: 19–23, 1998. [PubMed] [Google Scholar]
- 24. Jahnke V., Matthias C., Fryer A., Strange R., Glutathione S‐transferase and cytochrome‐P‐450 polymorphism as risk factors for squamous cell carcinoma of the larynx, Am. J. Surg., 172: 671–673, 1996. [DOI] [PubMed] [Google Scholar]
- 25. Trizna Z., Clayman G.L., Spitz M.R., Briggs K.L., Goepfert H., Glutathione s‐transferase genotypes as risk factors for head and neck cancer, Am J Surg, 170: 499–501, 1995. [DOI] [PubMed] [Google Scholar]
- 26. Mulder T.P., Manni J.J., Roelofs H.M., Peters W.H., Wiersma A., Glutathione S‐transferases and glutathione in human head and neck cancer. Carcinogenesis, 16: 619–624, 1995. [DOI] [PubMed] [Google Scholar]
- 27. Vineis P., Molecular epidemiology: low‐dose carcinogens and genetic susceptibility, Int. J. Cancer., 71: 1–3, 1997. [DOI] [PubMed] [Google Scholar]