Skip to main content
Journal of Southern Medical University logoLink to Journal of Southern Medical University
. 2019 Apr 20;39(4):381–386. doi: 10.12122/j.issn.1673-4254.2019.04.01

OAS1 gene polymorphism is associated with central nervous system involvement in children with enterovirus 71 infection

OAS1基因多态性与儿童肠道病毒71型感染合并中枢神经系统受累相关

Yaping LI 1,*, Song ZHAI 1,*, Wenjun WANG 1, Huiling DENG 1,2, Mei LI 1, Xiaoli JIA 1, Shuangsuo DANG 1,*
PMCID: PMC6744003  PMID: 31068279

Abstract

Objective

We investigated the association between OAS1 gene polymorphism and susceptibility to central nervous system (CNS) involvement of enterovirus (EV)71 infection.

Methods

This case-control study was conducted among 180 children with EV71 infection, including 72 with mild infections without any complications and 108 with severe infections and CNS involvement; 201 children undergoing routine physical examination served as the healthy controls. For all the participants, the single nucleotide polymorphisms (SNPs) at OAS1 rs2660 and rs1131454 were analyzed using SNPscan multiple SNP typing methods.

Results

No significant differences were found between the case and control groups in genotype or allele distributions of rs2660 and rs1131454. OAS1 rs2660 polymorphism was significantly different between the children with CNS involvement and those with mild EV71 infection, and the genotype AG frequency was higher and the genotype GG frequency was lower in children with CNS involvement. No significant difference was found in the distribution of genotypes or alleles of rs1131454 between the children with CNS involvement and those with mild EV71 infection.

Conclusion

OAS1 gene rs2660 and rs1131454 SNPs are not associated with the susceptibility to or CNS involvement of EV71 infection, but OAS1 rs2660 SNPs are significantly correlated with the susceptibility to CNS involvement in EV71 infection. Children carrying OAS1 rs2660 AG genotype are more likely to have CNS involvement after EV71 infection.

Keywords: enterovirus 71; genetic polymorphisms; 2′, 5′-oligoadenylate synthetase; central nervous system

INTRODUCTION

Enterovirus 71 (EV71) is a small RNA virus of the Enterovirus genus in the Picornaviridae family [1]. EV71 was first isolated in 1969 from an American child with encephalitis and has been identified as one of the major pathogens responsible for outbreaks of hand, foot and mouth disease (HFMD) in children worldwide. Over the past two decades, severe outbreaks of HFMD had been reported in Asia-Pacific countries including China, Singapore, Malaysia, Japan, Korea, Vietnam and Thailand [2]. According to the data of the Chinese National Health and Family Planning Commission of China, from 2008 to 2017, a total of 13.8 million cases of HFMD were reported in China, with an increasing trend of morbidity and severe cases[3], and around 45% of them were associated with EV71 and nearly all deaths (over 3700 cases) were attributed to EV71.

Although EV71 infections can produce varying clinical manifestations, from fever and herpangina in mild HFMD to central nervous system (CNS) involvement in severe cases, most of these infections can be asymptomatic. However, in some children the disease progresses rapidly with aseptic meningitis, acute flaccid paralysis, multiple organ dysfunction, and even death. The occurrence and development of HFMD have been confirmed to be associated with virus, host and environmental factors[4]. The host factors can affect the occurrence and development of EV71-associated diseases[5]. Recently, human gene polymorphisms have been shown to play an important role in the pathogenesis of EV71 infection [4]. To investigate the mechanism of genetic susceptibility to EV71 infection at the molecular level is one of the main research directions.

2', 5'-Oligoadenylate synthetase 1 (OAS1), one of the major proteins induced by type Ⅰ interferon, plays a critical role in host defense against viral infections[6]. In the presence of double-stranded RNA structures (viral genomes or single-stranded RNA transcripts that possess double-stranded characteristics), OAS1 converts ATP to 2', 5'-oligoadenylates (2-5As), which activate latent RNase L that, when activated, degrades single-stranded RNAs and inhibits viral replication[6]. In recent years, the contributions of RNase L and OAS1 to innate immunity have become increasingly apparent[6].

Single nucleotide polymorphisms (SNPs) of OAS1 gene are known to modulate the expression level and enzyme activity of OAS1 to potentially influence the susceptibility to and the severity of viral diseases[7]. So far 57 SNPs have been identified in OAS1 gene. Two functional SNPs (rs2660 and rs1131454) in OAS1 gene have been shown to be related with inhibiting viral replication in several viral diseases caused by hepatitis C virus [8, 9], hepatitis B virus, coxsackie virus 16, influenza A virus [10], dengue virus, West Nile virus[11], respiratory epithelial cell syncytial virus, ocular herpes simplex virus type 1, tick-borne encephalitis virus[12], and severe acute respiratory syndrome virus [13]. The differences in antiviral immune response result in different prognoses after EV71 infection, but the mechanism is not clear. We hypothesize that the diversity of genetic background affects the host's immune response, which leads to the diversity of clinical manifestations and prognosis. In this study, we aimed to investigate the relationship between these two SNPs in OAS1 gene and EV71 infection to identify the potentially at-risk children susceptible to EV71 infection and CNS involvement following EV71 infection.

PATIENTS AND METHODS

Study participants

A total of 180 children with the diagnosis of HFMD associated with EV71 infection were enrolled from the Department of Infectious Diseases at the Second Affiliated Hospital of Xi'an Jiaotong University and the Department of Infectious Diseases of Xi'an Children's Hospital (Xi'an, China) between April, 2014 and December, 2015. The diagnosis of HFMD was established based on the criteria in the Hand, Foot and Mouth Disease Clinical Guide (2010 edition)[14]. Children with persistent high fever and nervous system symptoms such as brainstem encephalitis, pulmonary edema and circulation dysfunction were classified as having severe HFMD. All these 180 children were confirmed to have EV71 infection with laboratory evidence provided by the Clinical Laboratories of the above two hospitals and the Xi'an Center for Disease Control. We also recruited a healthy control group consisting of 201 children undergoing routine physical examinations during the same period. All the children in the control group were screened against a history of HFMD or herpangina. All the participants in this study were unrelated Chinese of Han Nationality and resided in the same geographical area.

This study was approved by the Ethics Committee of the Second Affiliated Hospital of Xi'an Jiaotong University and was carried out in line with the Declaration of Helsinki. Written informed consent was obtained from the guardians of all the participants.

Identification of EV71 infection

Real-time quantitative PCR (qRT-PCR) was performed to identify EV71 infection by detecting EV71 nucleic acid[15] in the fecal samples of the children using the upstream primer 5'-GCAGCCCAAAAGAACTTCAC-3' and the downstream primer 5'-ATTTCAGCAGCTTGGA GTGC-3', following precisely the manufacturer's protocols of the EV71 nucleic acid detection kit (Da An Gene Co., Guangzhou, China). EV71 viral load was determined by fluorescence quantitative PCR and compared with the standard system. In the negative control group, sterilized water for injection was used instead of the specimens, and the positive control was used as the template.

Extraction and identification of genomic DNA

For children with EV71 infection, whole blood samples were collected and genomic DNA was extracted using the FlexiGene DNA Kit (Qiagen, Shanghai, China). For the healthy controls, buccal brush samples were collected and genomic DNA was extracted using the Centra Puregene Buccal Cell Kit (Qiagen, Shanghai, China).

Selection of OAS1 gene polymorphic loci

The sites in the functional areas such as exons, 5' untranslated regions (UTRs) and 3' UTRs were preferentially considered. The minor allele frequency (MAF) in the population of China is ≥0.05, and the sites associated with other diseases in previous report were also considered as the secondary sites[16, 17]. The sites with larger MAFs were preferred. Thus rs2660 and rs1131454 of OAS1 gene were selected as the target polymorphic loci in this study.

SNP genotyping

SNP genotyping was performed using the SNPscan Kit (Genesky Biotechnologies Inc., Shanghai, China) [17]. PCR was carried out for 35 cycles with annealing temperatures of 62 and 52 ℃ for rs2660 and rs1131454, respectively. For each of rs2660 and rs1131454, we designed the 3' primers for the forward template chain (3F), for A allele on the forward template chain (AF), and for G allele on the forward template chain (GF), whose sequences are listed below (Ref. seq.: NC_ 000012.11):

rs2660,

GACAAAGCTCCTCAGTGAGCTGG (3F), <break/>       CAGGTGGGACTCTTGATCCAGACAA (AF), <break/>        CAGGTGGGACTCTTGATCCAGACAG (GF);

rs1131454,

GCTATAAACCTAACCCCCAAATCTATGTC (3F), <break/>        CCGAACAGGTCAGTTGACTGTCA (AF), <break/>        CCGAACAGGTCAGTTGACTGTCG (GF).

Statistical analysis

Hardy-Weinberg equilibrium was examined using Chi-square test[15]. Polymorphism frequencies between the groups were analyzed also using Chi-square test. The children with EV71 infection and healthy controls were compared to estimate the associations of the alleles and genotypes with the susceptibility to EV 71 infection; wethen compared the children with CNS involvement and those with mild EV71 infection to estimate the associations of the alleles and genotypes with CNS involvement of EV71 infection. All the associations were estimated by calculating age- and gender-adjusted odds ratios (ORs) and 95% confidence intervals (CIs), using binary logistic regression analysis. The additive model and dominant model were fitted for polymorphisms of OAS1 (rs2660 and rs1131454). P < 0.05 was considered to indicate a statistically significant difference. All the statistical analyses were performed using SPSS17.0 software (SPSS Inc., Chicago, IL, USA).

RESULTS

Baseline characteristics of the participants

A total of 180 children with EV71 infection (male/ female: 111/69; median age: 20.5 months; age range: 6-96 months) were enrolled. Seventy-two children had mild infections without any complications (male/female: 44/28; median age: 24.5 months; age range: 8-96 months). Their manifestations included exanthema (characterized by papulovesicular rash on the palms and soles) and multiple oral ulcers, with or without fever. The other 108 children had severe infections involving the CNS (male/female: 67/41; median age: 19.5 months; age range: 6-72 months), manifested by aseptic meningitis, encephalitis, poliomyelitis-like syndrome, or encephalomyelitis [18]. CNS involvement could be accompanied by cardiorespiratory symptoms. The gender distribution was comparable between the mild cases and cases with CNS involvement (χ2=0.02, P= 0.90); the mean age was younger in cases with CNS involvement than in the mild cases, but the difference was not statistically significant (Mann-Whitney U test, P=0.07). In the 201 healthy controls, the age (median: 24 months; range: 8-72 months) and gender distribution (male/female: 119/82) were comparable to those of the EV71-infected children (χ2=0.24, P=0.62; MannWhitney U test, P=0.837, respectively).

Hardy-Weinberg equilibrium of the polymorphisms

The genotypic distribution of rs2660 and rs1131454 in OAS1 gene was consistent with Hardy-Weinberg equilibrium in children with EV71 infection and healthy controls (data not shown), supporting the validity of these participants to represent the study population.

Association between OAS1 gene polymorphisms and susceptibility to EV71 infection

The distribution of genotypes and alleles of rs2660 and rs1131454 showed no significant difference between the children with EV71 infection and the healthy controls (Tab. 1), or between the children with CNS involvement of EV71 infection and the healthy controls (Tab. 2).

1.

Distribution of OAS1 gene alleles and genotypes in EV71 HFMD cases and controls

Genotype and allele Control (n=201) Case group (n=180) Crude OR (95% CI) Adjusted OR (95% CI)
rs2660
  AA 105 100 - -
  AG 85 65 0.80 (0.53-1.23) 0.76 (0.49-1.17)
  GG 11 15 1.43 (0.63-3.27) 1.43(0.62-3.29)
  AG+GG 96 80 0.88 (0.58-1.31) 0.83 (0.55-1.25)
  A 295 265 - -
  G 107 95 0.99 (0.72-1.36) 0.97 (0.70-1.34)
rs1131454
  AA 61 50 -
  AG 100 92 1.12(0.70-1.79) 1.12(0.70-1.79)
  GG 40 38 1.16(0.65-2.07) 1.14 (0.64-2.05)
  AG+GG 140 130 1.13(0.73-1.77) 1.13(0.72-1.76)
  A 222 192 - -
  G 180 168 1.08 (0.81-1.44) 1.08 (0.81-1.44)

2.

Association between single nucleotide polymorphisms of OAS1 gene and severity of EV71 HFMD

Genotype Mild cases(n=72) CNS involvement (n=108) Crude OR (95% Cl) Adjusted OR (95% Cl)
rs2660
  AA 41 59 - -
  AG 20 45 1.56 (0.81-3.03) 2.27(1.07-85)
   GG 11 4 0.25 (0.08-0.85) 0.27 (0.08-0.97)
   AG+GG 31 49 1.10(0.60-2.00) 1.43 (0.74-2.77)
  A 102 163 - -
  G 42 53 0.79 (0.49-1.27) 0.90 (0.55-1.46)
rs1131454
  AA 18 32 - -
  AG 34 58 0.96 (0.47-1.96) 1.01 (0.51-2.20)
  GG 20 18 0.51 (0.21-1.20) 0.52 (0.22-1.26)
  AG+GG 54 76 0.79 (0.40-1.55) 0.84 (0.43-1.67)
  A 70 122 - -
  G 74 94 0.73 (0.48-1.11) 0.76 (0.50-1.17)

Association between OAS1 gene polymorphisms and CNS involvement of EV71 infection

OAS1 rs2660 polymorphism was significantly different between children with CNS involvement and those with mild EV71 infection. The genotype AG frequency was significantly higher (OR=2.27, 95% CI: 1.07-4.85) and the genotype GG frequency was significantly lower (OR= 0.27, 95% CI: 0.08-0.97) in children with CNS involvement. The distribution of the genotypes and alleles of rs1131454 showed no significant difference between the children with CNS involvement and those with mild EV71 infection (Tab. 3).

3.

Association between single nucleotide polymorphisms of OAS1 gene and CNS involvement in EV71 HFMD

Genotype Controls (n=201) CNS involvement (n=108) Crude OR (95% Cl) Adjusted OR (95% Cl)
rs2660
  AA 105 59 - -
  AG 85 45 1.06 (0.66-1.72) 1.06 (0.65-1.73)
  GG 11 4 1.55 (0.47-5.07) 1.38(0.75-2.54)
  AG+GG 96 49 1.23 (0.77-1.97) 1.23 (0.76-1.98)
  A 295 163 - -
  G 107 53 1.12(0.76-1.63) 1.05 (0.87-1.28)
rs1131454
  AA 61 32 - -
  AG 100 58 0.90 (0.53-1.55) 0.91 (0.53-1.56)
  GG 40 18 1.17(0.58-2.35) 1.08 (0.76-1.54)
  AG+GG 140 76 0.97 (0.58-1.61) 0.96 (0.57-1.61)
  A 222 122 - -
  G 180 94 1.05 (0.75-1.47) 1.02 (0.87-1.21)

DISCUSSION

HFMD is an acute infectious disease mainly caused by EV71 and coxsackievirus 16[15]. Differences in antiviral immune responses result in different prognoses after EV71 infection, but the mechanism is not clear[5]. OAS1 is an antiviral protein induced by interferon and also an important kinase in cell signaling pathways that respond to cellular and environmental stress[19]. Considering the effects of OAS1 gene polymorphism on the antiviral activity of OAS1 protease, several studies examined the association between OAS1 gene and HFMD[20]. In this study we selected two functional OAS1 polymorphic markers (rs2660 and rs1131454) that are associated with multiple viral infections, including hepatitis C virus and West Nile virus[8, 9, 11, 16]. OAS1 rs1131454 SNP is located in the third exon of the OAS1 gene, and affects the synthesis of OAS1 protein. It has been shown that patients with EV71 infection with different genotypes of OAS1 rs1131454 have significantly different blood leukocyte count, C-reactive protein level, and blood glucose concentration[20, 21], which reflect the severity of EV71 infection. In this study we found no significant difference in the genotype or allele distribution of rs1131454 between the children with EV71 infection and the healthy controls, or between children with CNS involvement and those with mild EV71 infection. As wedid not analyze the levels of OAS1 in the peripheral blood or cerebrospinal fluid of the patients, and all the samples were collected from Xi'an with a limited geographical coverage, it remains unclear whether OAS1 rs1131454 affects the expression of OAS1 in children with EV71 infection.

We did not observe significant differences in OAS1 rs2660 genotype or allele frequencies between EV71-infected children and the healthy controls. But in the children with EV71 infection, we found that OAS1 rs2660 AG genotype frequency was significantly higher and GG genotype frequency was lower in children with CNS involvement than in those with mild EV71 infection. These results suggest that OAS1 gene polymorphism is not significantly correlated to the susceptibility to EV71 infection. In general, the rs2660 AA genotype promotes disease susceptibility, whereas GG genotype confers protection[22-24], possibly because AA genotype results in the lowest, AG the intermediate and GG the highest OAS1 enzyme activity. Our results are consistent with these observations and suggest that the rs2660 AG genotype may not increase the risk of EV71 infection, but can be associated with an increased possibility of CNS involvement after infection. But given the retrospective nature of this study and the geographically localized sampling, we need to further validate our results in a large epidemiological screening study.

In summary, our results confirm that OAS1 rs1131454 and rs2660 polymorphisms are not associated with the risk of EV71 infection, but children carrying the OAS1 rs2660 AG genotype are more likely to have CNS involvement after EV71 infection. Further studies are needed to investigate the mechanism by which EV71 infections result in different clinical phenotypes, especially in the context of genetic predisposing factors of CNS infection.

Biographies

李亚萍,博士,主治医师,E-mail: liyaping8605@126.com

翟嵩,博士,副主任医师,E-mail: zhaisong1103@xjtu.edu.cn

Funding Statement

国家自然科学基金(81701632);陕西省重点项目-社会发展领域(2017ZDXM-SF-071)

Supported by National Natural Science Foundation of China(81701632) and Key Projects of Social Development(2017ZDXMSF-071)

Contributor Information

Yaping LI (李 亚萍), Email: liyaping8605@126.com.

Song ZHAI (翟 嵩), Email: zhaisong1103@xjtu.edu.cn.

Shuangsuo DANG (党 双锁), Email: dang212@126.com.

References

  • 1.Alotaibi S, Kennedy J, Tellier R, et al. Epstein-Barr virus in pediatric multiple sclerosis. JAMA. 2004;291(15):1875–9. doi: 10.1001/jama.291.15.1875. [Alotaibi S, Kennedy J, Tellier R, et al. Epstein-Barr virus in pediatric multiple sclerosis[J]. JAMA, 2004, 291(15): 1875-9.] [DOI] [PubMed] [Google Scholar]
  • 2.Xu W, Liu CF, Yan L, et al. Distribution of enteroviruses in hospitalized children with hand, foot and mouth disease and relationship between pathogens and nervous system complications. Virol J. 2012;9:8. doi: 10.1186/1743-422X-9-8. [Xu W, Liu CF, Yan L, et al. Distribution of enteroviruses in hospitalized children with hand, foot and mouth disease and relationship between pathogens and nervous system complications [J]. Virol J, 2012, 9: 8.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhang J. Trend of epidemics and variation of pathogens of hand, foot and mouth disease in China: a dynamic series analysis, 2008-2017. https://reference.medscape.com/medline/abstract/30744263. Zhonghua Liu Xing Bing Xue Za Zhi. 2019;40(2):147–54. doi: 10.3760/cma.j.issn.0254-6450.2019.02.005. [Zhang J. Trend of epidemics and variation of pathogens of hand, foot and mouth disease in China: a dynamic series analysis, 2008-2017 [J]. Zhonghua Liu Xing Bing Xue Za Zhi, 2019, 40(2): 147-54.] [DOI] [PubMed] [Google Scholar]
  • 4.Li YP, Zhai S, Li M, et al. Polymorphisms of TLR7 rs3853839 and rs179010 are associated with susceptibility to and severity of hand, foot and mouth disease caused by enterovirus 71 in male children. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&amp;amp;amp;id=xbyfzmyxzz201707017. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2017;33(7):953–8. [Li YP, Zhai S, Li M, et al. Polymorphisms of TLR7 rs3853839 and rs179010 are associated with susceptibility to and severity of hand, foot and mouth disease caused by enterovirus 71 in male children [J]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi, 2017, 33(7): 953-8.] [PubMed] [Google Scholar]
  • 5.Li YP, Dang SS, Deng HL, et al. Breastfeeding, previous Epstein-Barr virus infection, Enterovirus 71 infection, and rural residence are associated with the severity of hand, foot, and mouth disease. Eur J Pediatr. 2013;172(5):661–6. doi: 10.1007/s00431-013-1939-1. [Li YP, Dang SS, Deng HL, et al. Breastfeeding, previous Epstein-Barr virus infection, Enterovirus 71 infection, and rural residence are associated with the severity of hand, foot, and mouth disease[J]. Eur J Pediatr, 2013, 172(5): 661-6.] [DOI] [PubMed] [Google Scholar]
  • 6.Choi UY, Kang JS, Hwang YS, et al. Oligoadenylate synthase-like (OASL) proteins:dual functions and associations with diseases. Exp Mol Med. 2015;47(3):e144. doi: 10.1038/emm.2014.110. [Choi UY, Kang JS, Hwang YS, et al. Oligoadenylate synthase-like (OASL) proteins:dual functions and associations with diseases[J]. Exp Mol Med, 2015, 47(3): e144.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bonnevie-NV, Field LL, Lu S, et al. Variation in antiviral 2', 5'-oligoadenylate synthetase (2'5'AS) enzyme activity is controlled by a single-nucleotide polymorphism at a splice-acceptor site in the OAS1 gene. Am J Hum Genet. 2005;76(4):623–33. doi: 10.1086/429391. [Bonnevie-NV, Field LL, Lu S, et al. Variation in antiviral 2', 5'-oligoadenylate synthetase (2'5'AS) enzyme activity is controlled by a single-nucleotide polymorphism at a splice-acceptor site in the OAS1 gene[J]. Am J Hum Genet, 2005, 76(4): 623-33.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Knapp S, Yee LJ, Frodsham AJ, et al. Polymorphisms in interferon-induced genes and the outcome of hepatitis C virus infection: roles of MxA, OAS-1 and PKR. Genes Immun. 2003;4(6):411–9. doi: 10.1038/sj.gene.6363984. [Knapp S, Yee LJ, Frodsham AJ, et al. Polymorphisms in interferon-induced genes and the outcome of hepatitis C virus infection: roles of MxA, OAS-1 and PKR[J]. Genes Immun, 2003, 4 (6): 411-9.] [DOI] [PubMed] [Google Scholar]
  • 9.Li CZ, Kato N, Chang JH, et al. Polymorphism of OAS-1 determines liver fibrosis progression in hepatitis C by reduced ability to inhibit viral replication. Liver Int. 2009;29(9):1413–21. doi: 10.1111/liv.2009.29.issue-9. [Li CZ, Kato N, Chang JH, et al. Polymorphism of OAS-1 determines liver fibrosis progression in hepatitis C by reduced ability to inhibit viral replication[J]. Liver Int, 2009, 29(9): 1413-21.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Min JY, Krug RM. The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: inhibiting the 2'-5' oligo (A) synthetase/RNase L pathway. Proc Natl Acad Sci USA. 2006;103(18):7100–5. doi: 10.1073/pnas.0602184103. [Min JY, Krug RM. The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: inhibiting the 2'-5' oligo (A) synthetase/RNase L pathway[J]. Proc Natl Acad Sci USA, 2006, 103(18): 7100-5.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yakub I, Lillibridge KM, Moran A, et al. Single nucleotide polymorphisms in genes for 2'-5'-oligoadenylate synthetase and RNase L inpatients hospitalized with West Nile virus infection. J Infect Dis. 2005;192(10):1741–8. doi: 10.1086/jid.2005.192.issue-10. [Yakub I, Lillibridge KM, Moran A, et al. Single nucleotide polymorphisms in genes for 2'-5'-oligoadenylate synthetase and RNase L inpatients hospitalized with West Nile virus infection[J]. J Infect Dis, 2005, 192(10): 1741-8.] [DOI] [PubMed] [Google Scholar]
  • 12.Barkhash AV, Perelygin AA, Babenko VN, et al. Variability in the 2'-5'-oligoadenylate synthetase gene cluster is associated with human predisposition to tick-borne encephalitis virus-induced disease. J Infect Dis. 2010;202(12):1813–8. doi: 10.1086/653024. [Barkhash AV, Perelygin AA, Babenko VN, et al. Variability in the 2'-5'-oligoadenylate synthetase gene cluster is associated with human predisposition to tick-borne encephalitis virus-induced disease[J]. J Infect Dis, 2010, 202(12): 1813-8.] [DOI] [PubMed] [Google Scholar]
  • 13.Hijikata M, Itoyama S, Quy T, et al. Polymorphisms of interferoninducible genes OAS-1 and MxA associated with SARS in the Vietnamese population. Biochem Biophys Res Commun. 2005;329(4):1234–9. doi: 10.1016/j.bbrc.2005.02.101. [Hijikata M, Itoyama S, Quy T, et al. Polymorphisms of interferoninducible genes OAS-1 and MxA associated with SARS in the Vietnamese population[J]. Biochem Biophys Res Commun, 2005, 329(4): 1234-9] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ministry of Health of the People's Republic of China. Hand, Foot and Mouth Disease Clinic Guide (2010 edition)[OL]. Available: <a href="http://www.moh.gov.cn/publicfiles/business/htmlfiles/mohyzs/s3586/20101004/46884.htm" target="_blank">http://www.moh.gov.cn/publicfiles/business/htmlfiles/mohyzs/s3586/20101004/46884.htm</a> (in Chinese).
  • 15.Deng HL, Zhang YF, Li YP, et al. N-terminal pro-brain natriuretic peptide levels associated with severe hand, foot and mouth disease. BMC Infect Dis. 2016;16(1):585. doi: 10.1186/s12879-016-1929-9. [Deng HL, Zhang YF, Li YP, et al. N-terminal pro-brain natriuretic peptide levels associated with severe hand, foot and mouth disease [J]. BMC Infect Dis, 2016, 16(1): 585.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lim JK, Lisco A, McDermott DH, et al. Murphy B Genetic Variation in OAS1 Is a Risk Factor for Initial Infection with West Nile Virus in Man. PLoS Pathog. 2009;5(2):e1000321. doi: 10.1371/journal.ppat.1000321. [Lim JK, Lisco A, McDermott DH, et al. Murphy B Genetic Variation in OAS1 Is a Risk Factor for Initial Infection with West Nile Virus in Man[J]. PLoS Pathog, 2009, 5(2): e1000321.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mandal S, Abebe F. Chaudhary J. 2'-5' oligoadenylate synthetase 1 polymorphism is associated with prostate cancer. Cancer. 2011;117(24):5509–18. doi: 10.1002/cncr.v117.24. [Mandal S, Abebe F. Chaudhary J. 2'-5' oligoadenylate synthetase 1 polymorphism is associated with prostate cancer[J]. Cancer, 2011, 117(24): 5509-18.] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chang LY, Lin TY, Hsu KH, et al. Clinical features and risk factors of pulmonary oedema after enterovirus-71-related hand, foot, and mouth disease. Lancet. 1999;354(9191):1682–6. doi: 10.1016/S0140-6736(99)04434-7. [Chang LY, Lin TY, Hsu KH, et al. Clinical features and risk factors of pulmonary oedema after enterovirus-71-related hand, foot, and mouth disease[J]. Lancet, 1999, 354(9191): 1682-6.] [DOI] [PubMed] [Google Scholar]
  • 19.Scheuner D, Patel R, Wang F, et al. Double-stranded RNAdependent protein kinase phosphorylation of the alpha-subunit of eukaryotic translation initiation factor 2 mediates apoptosis. J Biol Chem. 2006;281(30):21458–68. doi: 10.1074/jbc.M603784200. [Scheuner D, Patel R, Wang F, et al. Double-stranded RNAdependent protein kinase phosphorylation of the alpha-subunit of eukaryotic translation initiation factor 2 mediates apoptosis[J]. J Biol Chem, 2006, 281(30): 21458-68.] [DOI] [PubMed] [Google Scholar]
  • 20.Cai YY, Chen Q, Zhou W, et al. Association analysis of polymor? phisms in OAS l with susceptibility and severity of hand, foot and mouth disease. Int J Immunogenet. 2014;41(5):384–92. doi: 10.1111/iji.12134. [Cai YY, Chen Q, Zhou W, et al. Association analysis of polymor⁃ phisms in OAS l with susceptibility and severity of hand, foot and mouth disease[J]. Int J Immunogenet, 2014, 41(5): 384-92] [DOI] [PubMed] [Google Scholar]
  • 21.Song L. Association of OAS1(rs1131454)gene polymorphism with the susceptibility to severity of Enterovirus-71 infection[D]. Master Thesis. Qiingdao University. 2015.
  • 22.Fedetz M, Matesanz F, Caro-Maldonado A, et al. OAS1 gene haplotype confers susceptibility to multiple sclerosis. Tissue Antigens. 2006;68(5):446–9. doi: 10.1111/tan.2006.68.issue-5. [Fedetz M, Matesanz F, Caro-Maldonado A, et al. OAS1 gene haplotype confers susceptibility to multiple sclerosis[J]. Tissue Antigens, 2006, 68(5): 446-9.] [DOI] [PubMed] [Google Scholar]
  • 23.O'Brien M, Lonergan R, Costelloe L, et al. OAS1: a multiple sclerosis susceptibility gene that influences disease severity. Neurology. 2010;75(5):411–8. doi: 10.1212/WNL.0b013e3181ebdd2b. [O'Brien M, Lonergan R, Costelloe L, et al. OAS1: a multiple sclerosis susceptibility gene that influences disease severity[J]. Neurology, 2010, 75(5): 411-8.] [DOI] [PubMed] [Google Scholar]
  • 24.He WW, Sciavolino PJ, Wing J, et al. A novel human prostatespecific, androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer. http://cn.bing.com/academic/profile?id=118fe6450daf6b14a9580149822b2747&amp;amp;amp;encoded=0&amp;amp;amp;v=paper_preview&amp;amp;amp;mkt=zh-cn. Genomics. 1997;43(1):69–77. doi: 10.1006/geno.1997.4715. [He WW, Sciavolino PJ, Wing J, et al. A novel human prostatespecific, androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer[J]. Genomics, 1997, 43(1): 69-77.] [DOI] [PubMed] [Google Scholar]

Articles from Journal of Southern Medical University are provided here courtesy of Editorial Department of Journal of Southern Medical University

RESOURCES