Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Sep 15.
Published in final edited form as: Clin Cancer Res. 2019 Jul 2;25(18):5623–5637. doi: 10.1158/1078-0432.CCR-18-2207

Pleiotropic impact of DNA-PK in cancer and implications for therapeutic strategies

Emanuela Dylgjeri 1,2, Christopher McNair 1,2, Jonathan F Goodwin 1,2, Heather K Raymon 3, Peter A McCue 4, Ayesha A Shafi 1,2, Benjamin E Leiby 2,10, Renée de Leeuw 1,2, Vishal Kothari 4, Jennifer J McCann 1,2, Amy C Mandigo 1,2, Saswati N Chand 1,2, Matthew J Schiewer 1,2, Lucas J Brand 1,2, Irina Vasilevskaya 1,2, Nicolas Gordon 1,2, Talya S Laufer 1,2, Leonard G Gomella 4, Costas D Lallas 4, Edouard J Trabulsi 4, Felix Y Feng 5,6,7, Ellen H Filvaroff 3, Kristin Hege 3, Dana Rathkopf 8, Karen E Knudsen 1,2,4,9
PMCID: PMC6744985  NIHMSID: NIHMS1523809  PMID: 31266833

Abstract

Purpose:

DNA-dependent protein kinase catalytic subunit (DNA-PK) is a pleiotropic kinase involved in DNA repair and transcriptional regulation. DNA-PK is deregulated in selected cancer types, and is strongly associated with poor outcome. The underlying mechanisms by which DNA-PK promotes aggressive tumor phenotypes are not well understood. Here, unbiased molecular investigation in clinically relevant tumor models reveal novel functions of DNA-PK in cancer.

Experimental Design:

DNA-PK function was modulated using both genetic and pharmacologic methods in a series of in vitro models, in vivo xenografts, and patient derived explants (PDEs), and the impact on downstream signaling and cellular cancer phenotypes was discerned. Data obtained were used to develop novel strategies for combinatorial targeting of DNA-PK and hormone signaling pathways.

Results:

Key findings reveal that: i) DNA-PK regulates tumor cell proliferation; ii) pharmacological targeting of DNA-PK suppresses tumor growth both in vitro, in vivo and ex vivo; iii) DNA-PK transcriptionally regulates known DNA-PK-mediated functions as well as novel cancer-related pathways that promote tumor growth; iv) dual targeting of DNA-PK/TOR kinase (TORK) transcriptionally up-regulates androgen signaling, which can be mitigated using the AR antagonist, Enzalutamide; v) co-targeting AR and DNA-PK/TORK leads to the expansion of anti-tumor effects, uncovering modulation of novel, highly relevant pro-tumorigenic cancer pathways; and viii) co-targeting DNA-PK/TORK and AR has cooperative growth inhibitory effects in vitro and in vivo.

Conclusion:

These findings uncovered novel DNA-PK transcriptional regulatory functions and led to the development of a combinatorial therapeutic strategy for advanced prostate cancer patients, currently being tested in the clinical setting.

Keywords: DNA-PK, TOR kinase, prostate cancer, androgen receptor, kinase inhibitor

Introduction

Multiple DNA damage repair (DDR) mechanisms have been selected for thorough evolution to preserve genomic integrity. DNA double-strand breaks (DSB) are the most deleterious and toxic forms of damage that, if left unrepaired, lead to cell cycle arrest and cell death(1, 2). Two main pathways are employed to repair DSB: homologous recombination (HR), which utilizes a sister chromatid in close proximity as a template resulting in high fidelity DSB repair(3, 4); and non-homologous end-joining (NHEJ), which does not require a sister chromatid template resulting in a more error-prone form of repair that can occur throughout the cell cycle(5, 6). While both processes aid in maintaining genomic integrity in normal cells, cancer cells utilize these processes, including up-regulation of key DDR proteins, to acquire more aggressive phenotypes and develop resistance to DNA damaging agents(7). Therefore, targeting the DNA repair machinery and/or its components that are deregulated in cancer has the potential to be employed as anti-cancer therapeutic strategies.

Among many DDR proteins deregulated in cancer, DNA-dependent protein kinase catalytic subunit (DNA-PKcs, referred to as DNA-PK herein), a key DNA repair protein involved in NHEJ, is known to play a pro-tumorigenic role in many cancers including prostate, breast, colon, cervix, and chronic leukemias(8–11). DNA-PK is up-regulated as a function of disease progression in prostate cancer (PCa), among other, and both DNA-PK overexpression and hyperactivation are associated with aggressive disease(12). Increased DNA-PK expression and activity correlate with resistance to both chemotherapy and radiation therapy, and overall poor outcomes, thus nominating DNA-PK as a potential therapeutic target in the management of cancer(8, 13). Previous studies in multiple tumor types, including PCa, have shown that down-regulation of DNA-PK via genetic perturbation or pharmacological inhibition leads to sensitization to radiation, decreased tumor size, decreased metastasis, and increased survival, thus providing the rationale for investigating DNA-PK inhibitors in the clinic for PCa(12, 14–16).

While the DNA repair functions of DNA-PK are well established, the kinase has also been shown to regulate multiple cellular processes of cancer relevance, including genomic stability, cell cycle, metabolism, metastasis, and transcriptional regulation(8, 17–19). Previous studies have shown that DNA-PK plays a protective role against drug-induced apoptosis, and promotes proliferation and radiation resistance(18, 20). Moreover, DNA-PK is involved in transcriptional regulation of pro-metastatic gene networks in PCa and secretion of metastasis-associated factors that influence the tumor microenvironment leading to migration and invasion in melanoma (12, 21). Given these roles of DNA-PK in cancer, therapeutic agents to target DNA-PK kinase activity have been developed and are being tested in numerous clinical trials (NCT02516813, NCT02316197, NCT01353625 and NCT02833883).

To further understand the functions of DNA-PK, unbiased molecular investigation was performed in clinically relevant tumor models with the further goal of suppressing pleiotropic DNA-PK functions. Using a series of in vitro models, in vivo xenografts, and ex vivo patient derived explants (PDEs), it was demonstrated that DNA-PK regulates tumor cell proliferation as well as modulates known and novel DNA-PK transcriptional processes. Genetic and pharmacological inhibition, using a specific laboratory grade DNA-PK inhibitor (NU7441) and a clinical grade dual DNA-PK/TOR kinase (DNAPK/TORK) inhibitor (CC-115) (22–26), led to inhibition of proliferation in castration-resistant prostate cancer (CRPC) models. Unbiased transcriptomic analyses demonstrated modulation of pathways known to be regulated by DNA-PK, including androgen response, estrogen signaling, cell cycle, and proliferation pathways. Novel processes of cancer relevance modulated by DNA-PK, including oxidative phosphorylation, epithelial mesenchymal transition, TNFα signaling via NFKβ, TGFβ signaling and KRAS signaling were also uncovered. Inhibition of DNA-PK/TORK via CC-115, led to transcriptional up-regulation of androgen signaling due to TOR kinase inhibition, which was expected based on previous studies. The observed up-regulation of androgen response upon dual DNA-PK/TORK inhibition served as rationale to test the combination with androgen receptor (AR) antagonist, Enzalutamide (Enza). Combinatorial treatment of DNA-PK targeting agents with Enza resulted in an expansion of the transcriptional changes and uncovered distinct downstream transcriptional alterations as compared to single agent targeting including Wnt β-catenin signaling, Hedgehog signaling, inflammatory response, and immune response signaling. Furthermore, several cancer-relevant pathways regulated exclusively by DNA-PK were identified by comparing transcriptional effects caused by a specific TOR kinase inhibitor (CC-223), with the dual DNA-PK/TOR kinase inhibitor (CC-115), both in the combination with Enza. Lastly, co-targeting of DNA-PK/TORK and AR led to cooperative anti-proliferative effects in vitro, in vivo and ex vivo in PDEs. In sum, the data herein demonstrate that in the absence of exogenous DNA damage DNA-PK regulates pro-tumorigenic pathways that can be effectively targeted using clinically-relevant pharmacological agents and that DNA-PK inhibitors can act in concert with AR antagonists in advanced PCa.

Materials and Methods

Proliferation Assay

Cell lines:

Cells lines, C4–2, 22Rv1, LNCaP, VCaP, and LN95 were authenticated by ATCC and checked for mycoplasma upon thawing and at termination of maintenance after <20 passages.

Inhibitors:

Cell lines LNCaP, VCaP, C4–2, 22Rv1, and LN95, were plated in 96-well plates at 1500, 1500, 500, 1000, and 1000 cells/well concentration, respectively. All cell lines were grown in full serum culture media, with the exception of LN95, which are normally cultured in charcoal-stripped serum. Cells were treated the next day with 0–25 μM concentrations of NU7441, CC-115, and CC-223 for 6 days and compared to vehicle control, DMSO. IC25, IC50 and IC75 (when possible) were determined for CC-115 in each cell line. Combination treatments with Enazalutamide (Enza), CC-115 + Enza, were conducted by treating cells with CC-115 IC25, IC50 and IC75 dose and titrating the concentration of Enza (0–25 μM). After 6 days, Quant-iT PicoGreen dsDNA assay kit (Abcam) was used according to protocol and data was recorded using a BioTek Synergy HT plate reader. Results were analyzed and graphed using GraphPad Prism7 to generate dose response curves for the single agent treatments. The combination treatment data were analyzed using CompuSyn Software analysis, to determine the combination index of CC-115 and Enza using non-constant ratio parameters.

siRNA:

CRPC cell lines, C4–2 and 22Rv1, cells were seeded at a 1 × 105 density on poly L-lysine coated plates in culture media for 24 hours. Cells were then transfected for 8 hours in serum-free media conditions with either control or PRKDC siRNA pools (Thermo Scientific) according to manufacturer’s protocol as previously described(12). Cells were then maintained in complete media for 96 hours post transfection and processed for either RNA, protein or growth assays.

BrdU Incorporation Assay

BrdU labeling and detection were performed as previously described(12, 14). Samples were acquired using a GUAVA easyCyte flow cytometer and analyzed using InCyte software for BrdU incorporation.

Western Blotting

Cells were treated as specified and cell lysates were generated as previously described(12). AR (N-20, directed against amino acids 1–20), DNA-PK (Thermo Fisher Scientific, #MS-423-P), Vinculin (Sigma-Aldrich, #V9264–200UL), VAV3 (EMD Millipore, #07–464), Prex1 (EMD Millipore, #MABC178), Lamin B (Santa Cruz, #6217), pAKT (Cell Signaling, 9271S), AKT (Cell Signaling, 9272S), pS6 (Cell Signaling, 2211S), S6 (Cell Signaling, 2217S), PARP/cleaved PARP (Cell Signaling, 9542S) antibodies were used for immunoblotting.

Gene expression

Cells were treated as specified above. RNA was isolated using TRIzol (Life Technologies) and quantitative PCR was conducted using primers as shown below.

Mouse gene expression analysis was performed by extracting total RNA from tumor tissues using TRIzol Reagent (Sigma). RT-PCR was performed using 1-Step RT-PCR kit, SuperScript™ One-Step RT-PCR Systems (Life Technologies), following manufacturer’s instructions. Probes for human FKBP5 (Hs00188025) was purchased from Life Technologies.

Patient Derived Explants (PDE)

PDE experiments were conducted as previously described(12, 27, 28). Tissues samples were treated as specified. Immunohistochemistry staining for Ki67 was performed by Thomas Jefferson Pathology Core Facilities and scored by a board-certified pathologist who reported percent Ki67 positivity after counting all cancer cells in the slide provided. Patient Derived Explants (PDEs) are IRB exempt due to de-identification of specimens. The Thomas Jefferson University Institutional Review Board has reviewed this procurement protocol and determined this research to be in compliance with federal regulations governing research on de-identified specimens and/or clinical data [45 CFR 46.102(f)].

Mouse Models

Animals.

Male 6- to 8-weeks-old CB17 SCID mice were obtained from Charles River Laboratories. All animal studies were performed under protocols approved by Institutional Animal Care and Use Committees.

Formulation.

Suspensions of CC-115 and Enza were prepared in aqueous 0.5% carboxymethyl cellulose and 0.25% Tween-80. The formulations were homogenized using a Teflon pestle and mortar (Potter-Elvehjem tissue grinder). For multiday studies, the compound was freshly formulated every third day. Between doses, the formulated compound was stored under constant stirring using magnetic stirrer at 4°C in the dark. The treatments article and vehicle were administered by oral gavage.

Development of CRPC tumor model.

LNCaP tumor cells (6×106/mouse) were injected subcutaneously into the hind flanks of male CB17 SCID mice. When the tumor volumes reached approximately 200 mm3, the mice were surgically castrated, and the tumor growth was closely monitored. Relapsed tumors that reached 300–500mm3 in volume were used as donor tissue for transplanting to the next cohort of castrated mice. For transplantation, tumors from several donor mice were pooled, minced and mixed with matrigel (BD Biosciences) before implanting into the hind flank of the recipient mice. Approximately 25–50 mg of tumor tissue per mouse was transplanted for each mouse. Several cycles (2–5) of tumor transplantation were performed until enhanced tumorigenicity (80–90% tumor take-rate) was observed.

Efficacy studies with CRPC model.

For efficacy studies, tumor fragments from passage 6 were used for inoculations. Twenty days after tumor fragment inoculation, mice bearing HR-LNCaP tumors of 200–400 mm3 were randomly assigned to receive oral doses of vehicle, CC-115, Enza, or combination of CC-115 and Enza once a day for the duration of the study. Tumor volumes were determined before the initiation of treatment and were considered as the starting volumes. Tumors were measured twice a week for the duration of the study. The long and short axes of each tumor were measured using a digital caliper in millimeters. The tumor volumes were calculated using the formula: width2 x length/2 and expressed in cubic millimeters (mm3).

In vivo target validation

pS6RP in tumor samples from was determined using Meso Scale Discovery kit (pS6RP: MA6000 p-S6RP (Ser 235/236) Whole Cell Lysate Kit (MSD, #K110DFD-2) and expressed as the mean Meso Scale Counts ± SEM per kit manufacturer’s instructions.

pAKT (S473) and total AKT in tumor samples were measured simultaneously using the Meso Scale Discovery kit (pAKT (S473)/Total AKT: MS6000 Phospho(S473)/Total AKT Whole Cell Lysate (MSD, #K11100D-2) multiplex assay. The amount of phosphorylated AKT was calculated per kit manufacturer’s instructions and reported as a percentage of total AKT. The results were expressed as the mean percentage phorphorylated AKT ± SEM for each group.

pDNA-PK (S2056) and total DNA-PK in tumor samples were measured simultaneously using IHC. Five to 10 micron (μm) thick cryostat sections were used. Shortly, frozen sections were fixed in 4% paraformaldehyde for 10 minutes at room temperature, washed in PBS, blocked, and permeabilized with 5% normal goat serum and 0.3% Triton X-100. Sections were then incubated with a cocktail of primary antibodies (1 μg/mL of anti-mouse anti-human DNA-PKcs monoclonal antibody (Thermo Scientific, #MS-369-P0) and anti-pDNA-PK (rabbit anti-human pDNA-PK (S2056) polyclonal antibody (Abcam, ab18192))for 2 hours followed by incubation with a cocktail of secondary antibodies (60 minutes). The sections were washed, counterstained with Hoechst dye (0.4 μg/mL) and mounted with antifade reagent. The sections were visualized with a Nikon E800 microscope and data were quantitated using Metamorph software. Using a 20X objective, 5 different fields from each section and 4 tumors from each treatment or control group were used for quantitation. The data are expressed as the percentage threshold area of pDNAPK staining over the threshold area of DNA-PKcs (total DNAPK staining). The data from each individual animal was used to calculate the mean ± SEM for each group.

Statistical analysis

In vitro data are presented as mean +/− standard deviation, xenograft and in vivo biomarker data are presented as mean ± SEM. Statistical analyses, including p-values, performed using GraphPad Prism7.

RNA-Seq

RNA-Sequencing

C4–2 cells were plated in hormone proficient conditions at 50,000 cells per plate overnight, followed by 1 μM single agent drug treatments (NU7441, CC-115, CC-223 and Enza) in biological triplicate. 22Rv1 cells were plated in hormone-proficient conditions at 100,000 cells per plate overnight, followed by 1μM treatment with CC-115 and vehicle control for 24 hours, with experiments collected in triplicate. RNA was extracted and purified using TRIzol and RNAeasy Mini kit (Qiagen) according to the manufacturer’s instructions. RNA-Seq libraries were subsequently constructed using the TruSeq Stranded Total RNA Library Prep Gold kit (protocol # 15031048 Rev E) and sequenced on Illumina’s NextSeq 500 sequencer at the Sidney Kimmel Cancer Sequencing core facility using paired-end 75bp reads. For combination treatments all drugs were used at 1 μM concentration.

RNA-Seq Analyses

RNA-Seq was aligned against the hg19 human genome using STAR v2.5.2a (29). Differential gene expression was generated using DESeq2 v1.12.4(30). Gene set enrichment analysis (GSEA) was performed using gene sets from the Molecular Signature Database(31). Circos plots were created using Circos v0.69–3(32). RNA-Seq data have been deposited in the GEO repository under the accession number GSE116765.

RESULTS

DNA-PK regulates tumor cell proliferation in CRPC

DNA-PK is a multifunctional kinase that plays pleiotropic roles in biological processes, including DNA-repair, transcriptional regulation, and genomic instability(8, 18). In PCa, DNA-PK is associated with development of metastatic disease, and functional data support the concept that this is due in large part to the transcriptional functions of DNA-PK(12, 18, 21). To better understand the roles of DNA-PK in advanced PCa and investigate DNA-PK as a therapeutic target, CRPC models were utilized to interrogate the effects of targeting DNA-PK expression through genetic and pharmacological perturbation. Depletion of DNA-PK using RNAi (Figure 1A, left) and inhibition of DNA-PK activity using a highly specific pharmacological inhibitor (NU7441) (Figure 1A, right, Supplemental 1A) in CRPC cell models resulted in decreased tumor cell proliferation (by 45.8% and 50.0% in C4–2 and 26% and 43.6% in 22Rv1, respectively). In addition, the assessment of 5-Bromo-deoxyuridine (BrdU) incorporation by actively proliferating cells shows that DNA-PK inhibition significantly reduced cells in active S-phase in C4–2 and 22Rv1 by 20.7% and 4.5%, respectively (Figure 1B, Supplemental 1B). In summary, DNA-PK suppression inhibits cell proliferation and cell cycle progression.

Figure 1. DNA-PK regulates tumor cell proliferation in CRPC.

Figure 1.

A) Proliferation assays using DNA-PK knockdown (siDNA-PK) and pharmacological inhibition of DNA-PK (NU7441,1 μM) in CRPC cell lines using Trypan Blue(left) and Pico Green (right) assay respectively. Cell counts were obtained at 1, 4, and 6 days post transfection for knockdown experiments, and at day 0 (prior to treatment), 4, and 6 for inhibitor experiments. Relative cell number was calculated for each day normalizing to their appropriate controls. Data are represented as mean ± SD of biological triplicate. Student t-test statistical analyses were used where *p<0.05, ***p<0.001 compared to control. B) Representative FACS plots of BrdU incorporation after 24-hour treatment with 1 μM NU7441 and vehicle control (DMSO). Quantification of active S phase FACS data are presented as mean ± SD of biological triplicate. C) RNA-Seq schematic of C4-2 cell line treated with vehicle control (DMSO) and DNA-PK inhibitor (NU7441, 1 μM) in triplicate for 24 hours before RNA was harvested. MA plot was generated by comparing NU7441 treated cells to vehicle control showing gene expression modulation with the number of transcripts up-regulated (top) and down-regulated (bottom). GSEA using Hallmark geneset from MSigDB analysis was used to identify enriched and de-enriched pathways for DNA-PKi treated cells compared to vehicle control using FDR<0.25. Each pathway is depicted by a ribbon in the circos plot where blue ribbons identify pathways enriched exclusively by DNA-PKi and green ribbons identify pathways de-enriched by NU7441 treatment.

While these and previous findings link DNA-PK to regulation of cell proliferation, coupled with previous data demonstrating that tumor-associated DNA-PK acutely promotes metastasis(12, 21, 33), the overall mechanisms by which DNA-PK promotes disease progression are not completely understood. An unbiased RNA-sequencing (RNA-Seq) approach was utilized to delineate the molecular functions of DNA-PK in CRPC. DNA-PKi resulted in alteration of transcriptional networks, with 980 up-regulated and 1346 down-regulated transcripts (Figure 1C, Padj <0.05). Gene Set Enrichment Analysis (GSEA) was performed using the Hallmark pathway analysis from the Molecular Signatures Database (MSigDB) to identify pathways modulated by DNA-PK (Figure 1C, right); significantly over represented pathways (FDR<0.25) are shown using a circos plot where significantly enriched and de-enriched pathways are represented by blue and green ribbons, respectively (FDR) <0.25). Consistent with previous reports, GSEA revealed de-enrichment in pathways known to be modulated by DNA-PK, including androgen response, DNA repair, cell cycle/proliferation, and pro-tumorigenic processes, thus recapitulating the highly selective nature of DNA-PK’s transcriptional regulatory functions(8, 14). Additionally, the current study of DNA-PK inhibition revealed novel pathways affected by DNA-PK including TGFβ signaling, KRAS signaling, TNFα signaling via NFκB, oxidative phosphorylation, and unfolded protein response (Figure 1C, right). These clinically relevant pathways are known to play important roles in tumor progression, thus highlighting the importance of delineating the roles of DNA-PK with respect to transcriptional regulation in cancer to reveal novel mechanisms of action. Together, these data demonstrate that the pro-proliferative functions of DNA-PK in cancer cells are associated with distinct pro-tumorigenic transcriptional regulatory events.

Targeting DNA-PK using a therapeutically active compound inhibits tumor cell proliferation and regulates known DNA-PK transcriptional processes.

While NU7441 is a highly specific DNA-PK inhibitor, this agent is not suited for clinical use. However, the dual DNA-PK and TOR kinase (TORK) inhibitor (CC-115) (Supplemental 1C) has been recently developed and is in multiple clinical trials. Assessment of the dual kinase targeting in hormone-sensitive prostate cancer (HSPC) and CRPC models revealed that targeting DNA-PK using both CC-115 and NU7441 reduced cell viability in a dose dependent manner, with CC-115 inducing apoptosis (Figure 2A, Supplemental 1D). Similarly, FACS analysis demonstrated that targeting of DNA-PK with CC-115 significantly reduced cells in active S-phase compared to vehicle control and NU7441 treated cells (Supplemental 1B and E). These data suggest that targeting DNA-PK using CC-115 more potently inhibits tumor cell proliferation compared to NU7441 in both HSPC and CRPC models. Considering the important role of DNA-PK in transcriptional regulation, it was imperative to identify the transcriptomic alterations caused by this therapeutically active agent.

Figure 2. Targeting DNA-PK with CC-115 potently inhibits tumor cell proliferation and regulates known DNA-PK transcriptional processes.

Figure 2.

A) Dose response proliferation assays using NU7441 (DNA-PK inhibitor) and CC-115 (dual DNA-PK/TOR kinase inhibitor) in HSPC and CRPC cell lines using Pico Green assay at 6 days post treatment compared to vehicle control. B) RNA-Seq schematic of C4-2 cell line treated with 1 μM of CC-115 in triplicate for 24 hours before RNA was harvested. MA plots was generated for CC-115 treatment compared to control showing gene expression modulation with the number of transcripts up-regulated (top) and down-regulated (bottom). C) GSEA using Hallmark geneset from MSigDB analysis was used to identify enriched and de-enriched pathways for NU7441 and CC-115 treated cells compared to control using FDR<0.25. Each pathway is depicted by a ribbon in the circos plot where blue ribbons identify pathways de-enriched exclusively by NU7441, dark blue = exclusive enrichment by NU7441, orange = exclusive de-enrichment by CC-115, Red = enrichment by CC-115, purple = commonly de-enriched and green = commonly enriched. Commonly enriched and de-enriched pathways regulated by DNA-PK are represented using heat maps to the right.

To investigate the impact of targeting DNA-PK using the dual kinase inhibitor on the transcriptome, RNA-Seq analysis was performed in CRPC cells treated with CC-115. Principal Component Analysis (PCA) and sample clustering provided a high level of confidence in the effects observed for each treatment as demonstrated by tight sample clustering between their respective treatments (Supplemental Figure 1C). As CC-115 is a dual kinase inhibitor targeting both DNA-PK and TORK, enhanced effects on the transcriptome were anticipated as compared to DNA-PK-exclusive targeting agents. Indeed, CC-115 treatment resulted in alteration of transcriptional networks, with 4896 up-regulated and 5878 down-regulated transcripts in C4–2, and 3555 up-regulated and 4358 down-regulated transcripts in 22Rv1(Figure 2B, Supplemental 2A, adjusted p value <0.05). Through analyses of both transcript profiles and Gene Set Enrichment Analysis (GSEA), pathways modulated by DNA-PK/TORK targeting via CC-115 were highly conserved in C4–2 and 22Rv1, with 3149 and 2187 transcript changes in common but down- and up-regulated by CC-115 respectively. Furthermore, CC-115 consistently modulated targets in both models systems were validated in in multiple CRPC models (Supplemental Figure 2C).

Moreover, the results of two gene set enrichment analyses in C4–2 (CC-115 and NU7441 treatments) were overlaid to uncover high confidence DNA-PK-exclusive pathways (Figure 2C, left). The combined transcriptionally altered pathways are illustrated using a circos plot where significantly enriched and de-enriched pathways exclusive to NU7441 (light and dark blue ribbons respectively), vs. pathways exclusive to CC-115 (orange and red ribbons respectively) (False Discovery Rate (FDR) <0.25) are shown. As expected, the dual kinase inhibitor CC-115 altered TORK-regulated pathways of cancer relevance, including fatty acid metabolism, glycolysis and apoptosis pathways(34, 35). By contrast, a robust core set of pathways commonly regulated by both the single DNA-PKi (NU7441) and the dual DNA-PKi/TORi (CC-115) were identified (purple and green ribbons). The number of commonly de-enriched pathways (purple) exceeded the number of commonly enriched pathways (green) by 14 and 2 respectively, suggesting that DNA-PK primarily up-regulates transcriptional processes that play important roles in tumor progression. Among these processes were known DNA-PK effectors, such as DNA-repair and cell cycle/proliferation, but also novel pathways where the role of DNA-PK transcriptional regulation is less understood, including oxidative phosphorylation, epithelial mesenchymal transition (EMT), TNFα signaling via NFKβ, IL6/Jak/Stat3 signaling, and TGFβ signaling (Figure 2C, left). In summary, these data show that targeting DNA-PK utilizing a clinical grade inhibitor, CC-115, potently inhibits proliferation of CRPC cells and impacts DNA-PK-regulated transcriptional events enriched for cancer-relevant pathways.

Cooperative effects of co-targeting AR and DNA-PK pathways

Among the common regulated pathways, GSEA identified androgen signaling, a known driver of PCa at all stages of disease(36). As DNA-PK is a known modulator of AR signaling(14), it was not surprising that treatment with a DNA-PK specific inhibitor (NU7441) resulted in de-enrichment of androgen signaling (Figure 3A, left; FDR<0.25). In contrast, androgen signaling was enriched when targeting DNA-PK/TORK axis using CC-115 (Figure 3A, middle; FDR<0.25). While androgen signaling down-regulation was expected upon DNA-PK suppression, it has been previously described that AR signaling up-regulation can occur upon TORK inhibition in PCa(37, 38). Up-regulation of androgen signaling was associated with elevated AR protein levels in C4–2 (Figure 3A, right; Supplemental 2D) and was confirmed via RT-PCR demonstrating induction of AR target gene expression upon CC-115 treatment (Figure 3B, Supplemental 2E). Similar up-regulation of AR target gene transcripts was also seen using a specific TORK inhibitor (CC-223, also in clinical trials NCT02031419, NCT01177397, NCT01545947), which further indicates that inhibition of TOR kinase is likely causing AR up-regulation (Supplemental 3A)(39). In summary, these data suggest that TORK suppression leads to up-regulation of AR signaling in CRPC.

Figure 3. Dual targeting of DNA-PK and TOR kinases in combination with Enzalutamide leads to distinct downstream transcriptional alterations compared to single agent targeting.

Figure 3.

A) The Androgen Response Hallmark is oppositely regulated by targeting DNA-PK (NU7441) and DNA-PK/TOR (CC-115). GSEA enrichment plots for androgen response upon NU7441 and CC-115 are shown. Immunoblot analyses of androgen receptor expression in C4-2 cells is depicted to the right, with quantification AR in three independent experiments represented as average as mean ± SD. AR is significantly up-regulated upon DNA-PK/TOR targeting (p<0.01). B) Interrogation of AR target genes expression via qPCR using single and combination drug treatment (1 μM) with Enza (1 μM) after 24 hours before RNA was harvested. Data represented as mean ± SD of biological triplicates. Students’ t-test statistical analyses were used where *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 compared to single agent treatments. (C) RNA-Seq schematic of C42 cell line treated with Enza (1μM) and NU7441 (1 μM) plus Enzalutamide (1 μM) in and Enza (1 μM) and CC-115 (1 μM) plus Enza (1 μM) in for 24 hours before RNA was harvested. MA plots were generated for Enza alone and NU7441 + Enza combination compared to control and CC-115 + Enza combination compared to control. Venn diagrams were generated using genes up- or down- regulated by at least 1.5-fold change and adjusted p<0.05. Genes that were gained in the combination treatment were utilized for GSEA hallmark geneset analysis. Pathways shown in the heat maps above were obtained using FDR<0.25.

Since AR targeting agents are used as first line therapy for metastatic disease(40, 41), a FDA approved AR antagonist, Enza, was used in combination with NU7441 and CC-115. As expected, the combination with Enza further down-regulated AR target gene transcript levels when used with NU7441 due to a negative feedback loop between DNA-PK and AR, which has been previously described(14). The combination of Enza with CC-115 mitigated the up-regulation of AR target genes induced by the inhibition of TORK in CRPC models (Figure 3B, Supplemental 2E, Supplemental 3A). In summary, combination treatments of DNA-PK inhibition with Enza reduce the up-regulation of AR signaling in CRPC.

To further understand the impact of DNA-PK suppression in combination with AR targeting on the transcriptome, RNA-Seq was performed on C4–2 (Supplemental 4A) and validated in two other models for specific targets (Supplemental 4B). Enza alone resulted in 638 up-regulated and 791 down-regulated transcripts. As expected, a larger number of transcripts were altered in Enza + NU7441 (2284 up-regulated, 3644 down-regulated) and Enza + CC-115 (3632 up-regulated, 534 down-regulated) than Enza alone (Figure 3C, top; adjusted P value <0.05). Up- and down-regulated genes by 1.5-fold change for single agent exposure (Enza alone, NU7441 alone, and CC-115 alone) were compared to their respective combination exposure (Enza + Nu7441 and Enza + CC-115) as represented by Venn diagrams (Figure 3C, middle). An expansion of transcriptomic alterations was observed for both NU7441 and CC-115 in combination with Enza. GSEA pathway analysis was performed to identify up- and down- regulated pathways, represented as heat maps, based on the gained genes exclusive to each combination treatment (Figure 3C, bottom; FDR<0.25). Transcriptional down-regulated events associated with NU7441 + Enza combination were enriched for 18 pathways, while up-regulated gene expression events were enriched for only 2 pathways. The down-regulated gene set exhibited enrichment of known DNA-PK and AR modulated processes such as androgen response, cell cycle and hypoxia, as expected. Similarly, CC-115 + Enza down- and up-regulated gene sets were enriched for known AR, TORK and DNA-PK known processes. However, novel pathways including Wnt β-catenin signaling, Hedgehog signaling, inflammatory response, and immune response signaling were gained upon both combinatorial treatments, which were not previously seen in the single agent targeting approach with either kinase inhibitor or Enza (Supplemental 4B). In summary, targeting DNA-PK and AR signaling in concert leads to an expanded transcriptomic profile that modulates novel pro-tumorigenic signaling pathways when compared to each treatment alone.

To uncover DNA-PK specific effects in the context of AR inhibition with Enza, RNA-Seq was performed using the TORK specific inhibitor CC-223 in combination with Enza to mitigate the effects of targeting AR and TORK, thus uncovering putative DNA-PK specific effects (Supplemental 3B-D). Utilizing genes modulated by 1.5-fold change for CC-115 + Enza and CC-223 + Enza combinations, GSEA analysis was performed (Supplemental 3D). While there was significant overlap between the two conditions signifying genes/pathways modulated by TORK and AR inhibition, CC-115 + Enza and CC-223 + Enza had distinct effects, which can be attributed to DNA-PK and TORK, respectively. Processes that can be attributed to DNA-PK (CC-115 exclusive) consisted of pathways involved in metabolism, inflammatory response, and pro-tumorigenic signaling similar to the DNA-PK pathways previously uncovered in Figure 3C. In summary, the up-regulation of AR signaling upon DNA-PK/TORK dual targeting with CC-115 can be mitigated using Enza and this combination strategy led to an expansion of transcriptomic alterations that are distinct from those observed with single agent targeting. Furthermore, novel putative DNA-PK-exclusive transcriptional regulatory events were identified, further implicating DNA-PK as a transcriptional regulator of cancer-relevant pathways.

Feasibility of co-targeting DNA-PK/TORK and AR axis in vivo.

To investigate whether the combination of DNA-PK targeting agents with Enza demonstrate superior efficacy in comparison to CC-115 and Enza alone, combination index analyses were performed after treatments with CC-115 at IC25, IC50 or IC75 concentrations combined with varied doses of Enza in both HSPC and CRPC models. Combination of CC-115 (IC25, IC50 or IC75) when combined with Enza (all doses) showed synergism in both HSPC and CRPC models (Figure 4A). To extend these observations into a preclinical model of CRPC, the combination of CC-115 + Enza was tested in a xenograft model generated as shown in Figure 4B, left. Following tumor engraftment, mice were treated with vehicle, CC-115 alone (2 mg/kg), Enza alone (low and high dose, 5mg/kg and 10mg/kg respectively), and the combination of CC-115 + Enza at low and high Enza doses (2mg/kg CC-115 + 5mg/kg Enza and 2mg/kg CC-115 + 10mg/kg Enza). Additionally, mRNA expression of the AR target gene FKBP5 was interrogated to validate the efficacy of targeting the AR axis in this model. As expected, FKBP5 mRNA, as well as TORK and DNA-PK activity (Supplemental 5A-B), were elevated upon treatment with CC-115 alone, but were attenuated by the combination of CC-115 + Enza (low and high dose), thus corroborating the in vitro finding as shown in Figure 3B (Figure 4B, right). Moreover, CC-115 and CC-115 + Enza were shown to reduce DNA-PK activity and TORK target expression in an in vivo HSPC model study treated with CC-115 alone, Enza, and CC-115 + Enza (unpublished data). In sum, these data recapitulate androgen signaling up-regulation upon DNA-PKi/TORKi inhibition observed in vitro and mitigation of this effect with the Enza +CC-115 combination in vivo.

Figure 4. Co-targeting DNA-PK/ TOR kinase and AR axis has additive growth inhibitory effects in vivo.

Figure 4.

A) Combination Index determination in PC cell lines when using CC-115 at IC25, IC50 and IC75 in combination with varied concentrations of Enza. Experiments were performed in biological triplicates. B) Schematic of castration resistant prostate cancer mouse model (CRPC) developed by Celgene. Upon establishment of CRPC tumors, the AR axis was interrogated by measuring FKBP5 mRNA expression levels in tumors after treatments via qPCR (right). Data represented as mean ± SEM of biological triplicates. Student s’t-test statistical analyses were used where *p<0.05 compared to control (red) or as otherwise indicated by the brackets. C) Average tumor doubling time was calculated for each treatment cohort. D) The percentage of tumors reaching 1500 mm3 was calculated for each cohort. E) Tumor growth was monitored for 19 days after single agent or combination drug treatment. Relative tumor volume is shown for each treatment normalized to tumor volume at the start of treatment. Mouse data are presented as mean ± SEM and one-way ANOVA was used for statistical analysis where *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 compared to control.

Tumor doubling time was increased upon treatment with Enza alone and CC-115 + Enza but not CC-115 alone; however, combination of CC-115 + Enza (low and high dose) led to significantly increased tumor doubling time compared to CC-115 alone, demonstrating that the combination treatment is more effective than single agent treatment in vivo (Figure 4C). Similarly, combination treatments led to higher survival (using a tumor volume of 1500mm3 as an endpoint) compared to either single treatment alone, with CC-115 + Enza low and high dose having a 75% and 87.5% survival rate, respectively (Figure 4D). Tumor volume was monitored throughout the duration of the study (39 days total, 19 days post initial treatment). At the end of the study CC-115 alone showed marginal activity leading to approximately 22% decrease in tumor volume, Enza alone showed dose-dependent activity (35% and 48% tumor volume decrease for 5mg/kg and 10mg/kg respectively), and the combination treatments of CC-115 plus low and high dose Enza showed additive effects with a 61% and 62% decrease in tumor volume with the combination at the high Enza dose demonstrated a 29% decrease of tumor volume as compare to Enza (10mg/kg) and 64% decrease when compared to vehicle (Figure 4E). Moreover, similar studies perforemed in another CRPC model, LNCaP –AR, recapitulate the results presented herein where the combination treatment leads to greater tumor growth inhibition compared to Enza or CC-115 alone (unpublished data). In summary, these data demonstrate that targeting the DNA-PK/TORK and AR with CC-115 in combination with Enza results in decreased tumor proliferation both in vitro and in vivo when compared to control or either agent treatment alone.

Dual DNA-PK/TOR kinase inhibition and co-targeting AR elicits cooperative anti-tumor effects in human PCa explants.

Since targeting of DNA-PK-TOR-AR axis showed synergistic and additive anti-proliferative effects in vitro and in vivo respectively, the impact of this combination treatment was studied in an Patient Derived Explant (PDE) model using human tumor samples from high volume disease that were obtained after radical prostatectomy as previously described(28) and summarized in Figure 5A. Importantly these tissues retain histoarchitecture, AR expression, proliferation rate and the microenvironment features of the original tumor(27, 28, 42). Upon resection, the tumor samples were subdivided and treated with vehicle control, CC-115 (0.1, 0.5, and 1 μM) alone, Enza (1 μM) alone, and combination of CC-115 (0.1, 0.5, and 1 μM) + Enza (1 μM). Levels of Ki67, an indicator of tumor cell proliferation, were measured using immunohistochemistry. Seventy five percent of PDEs (6/8) responded to Enza treatment (lower Ki67 positivity) as compared to control. CC-115 at high dose (1 μM) showed strong anti-proliferative effects when used as a single agent. The anti-proliferative effects were enhanced upon combining CC-115 with Enza especially with 0.1 and 0.5 μM CC-115 (PDEs #1, 3, 7, 8). When the concentration of CC-115 was increased to 1μM, robust anti proliferative effects were observed but no further benefit was seen with the addition of Enza (1μM) (PDEs #2, 4, 5, 6) (Figure 5C). These data demonstrate that targeting DNA-PK/TORK alone and in combination with Enza has anti-proliferative effects in primary prostate human tumors, and provide the impetus for clinical evaluation of DNA-PK targeting agents in combination with Enza.

Figure 5. Dual DNA-PK/TOR kinase inhibition and co-targeting AR elicits cooperative anti-tumor effects in human prostate cancer.

Figure 5.

A) Schematic of human Patient Derived Explant (PDE) model generation from human prostatectomy samples that are treated with single agent CC-115 (0.1, 0.5, 1 μM DNA-PK/TOR inhibitor) and Enza (1μM) and combination treatments (0.1, 0.5, 1 μM CC-115+ 1 μM Enza) for 6 days. B) Representative Ki67 IHC tissue staining after each treatment are shown at 40X magnification. C) Each PDE sample (each patient is represented by a different color) was scored by by Digital Imaging Analysis (Aperio System) and confirmed by a pathologist. Data is represented as Ki67 mean ± SD of each cohort of patient tissues treated with the same treatment. D) Schematic of the CC-115 and Enza clinical trial currently conducted in patients with CRPC. E) Model summarizing findings in this paper.

Based in part on the findings presented here, a first-in-man Phase IB/II clinical trial (NCT02833883) is being conducted in PCa, with endpoints assessing safety and pharmacokinetics of escalating doses of CC-115 in combination with Enza (160 mg BID) to establish the maximum tolerated dose (MTD). These data will be used in a phase II trial to assess endpoints of safety, biochemical recurrence by looking at PSA levels, and progression free survival (Figure 5D). Combined the studies presented herein have further defined the transcriptional-regulatory roles of DNA-PK, and have identified processes that are affected by combinatorial targeting strategies of DNA-PKi/TORKi/Enza (Figure 5E). Furthermore, the combination of DNA-PKi/TORi and Enza has demonstrated to have superior anticancer effects to single agent treatment in vitro, in vivo, and ex vivo. These studies serve as the rationale for clinical investigation of the combination of DNA-PK/TOR targeting agents and Enza in the management of CRPC.

Discussion

DNA-PK is a multifunctional kinase that is deregulated in multiple human malignancies. In aggressive PCa, DNA-PK is strongly associated with poor outcome(12). Despite being studied for its role in DNA repair and transcriptional regulation, much remains to be uncovered about the mechanisms by which DNA-PK promotes cancer phenotypes. The study presented here identifies DNA-PK as a transcriptional regulator of multiple known and novel cancer-relevant pathways in the absence of exogenous DNA damage in PCa. Furthermore, data herein demonstrate that DNA-PK targeting using a clinical grade inhibitor, in concert with a standard of care AR antagonist, has cooperative anti-tumor effects in PCa. Key findings reveal that: i) DNA-PK regulates tumor cell proliferation; ii) pharmacological targeting of DNA-PK suppresses tumor growth both in vitro, in vivo and ex vivo; iii) DNA-PK transcriptionally regulates known DNA-PK-mediated functions as well as novel cancer-related pathways that promote tumor growth; iv) dual targeting of DNA-PK/TOR kinase (TORK) transcriptionally up-regulates androgen signaling, which can be mitigated using the AR antagonist, Enzalutamide; v) co-targeting AR and DNA-PK/TORK leads to the expansion of anti-tumor effects, uncovering modulation of novel, highly relevant pro-tumorigenic cancer pathways; and viii) co-targeting DNA-PK/TORK and AR has cooperative growth inhibitory effects in vitro and in vivo. In sum, this study uncovered multiple novel cancer-relevant processes that are transcriptionally modulated by DNA-PK in models of advanced disease, and demonstrated that DNA-PK/TORK can be effectively targeted in combination with Enza to prevent tumor growth in PCa in the absence of exogenous DNA damage. This study provides strong rationale for using this three-pronged attack by targeting DNA-PK, TORK, and AR axes in the management of lethal CRPC.

DNA-PK has been previously shown to modulate cancer phenotypes through DNA repair via NHEJ and transcriptional regulatory mechanisms (8, 12, 14, 43–45). Consistent with these previous findings, unbiased profiling of transcriptional networks sensitive to DNA-PK inhibition further support the concept that DNA-PK positively regulates gene networks involved in DNA repair and hormone signaling as observed in Figure 1C and 2C. Previously published data have also linked DNA-PK to play a pro-metastatic role in cancer(12, 21). DNA-PK promotes metastasis in part through transcriptional modulation of pro-metastatic gene networks in the Rac-Rho pathway in PCa(12). Another study in melanoma has shown that DNA-PK modifies the tumor microenvironment by modulating the secretion of pro-migratory molecules and promotes metastasis(21). Data herein identified EMT and TNFα via NfκB pathways as also responsive to DNA-PK function. These findings are impactful as EMT is an important step toward development of metastases, and TNFα plays a critical role in tumor microenvironment and EMT plasticity. Previous studies have described DNA-PK to directly interact with the EMT protein Snail and drive metastasis(33), however it is of high importance to understand how DNA-PK modulates EMT/TNFα gene networks transcriptionally. Understanding the mechanisms by which DNA-PK transcriptionally modulates pro-metastatic signaling would allow for development of new therapeutics to target these processes with the goal of suppressing metastasis.

In addition to regulation of metastatic pathways, the data presented here uncovered a novel DNA-PK-mediated influence on immune and inflammation response pathways including: interferon alpha response, interferon gamma response, inflammatory response, and TNFα pathway. These data complement previous findings which identified DNA-PK as a modulator of V(D)J recombination, activator of the innate immune response, and subsequent inflammatory response in the presence of foreign DNA and pathogens(46–49). Uncovering the crucial impact of DNA-PK on both the innate and adaptive immune response is the focus of ongoing investigations. Moreover, understanding how the innate and immune responses are modulated in patients treated with DNA-PK-directed therapeutics will likely give insight into DNA-PK–dependent immune-related mechanisms of response and/or resistance. A recent study identified DNA-PK inhibition as therapeutic approach that modulates immunity in melanoma and may increase the efficacy of immunotherapies(50), thus it would be of interest to study immunotherapy and DNA-PK inhibitors in PCa tumors that overexpress DNA-PK and assess their efficacy as novel therapeutic strategies. In addition to transcriptional regulation of immune response pathways, data herein suggest that DNA-PK modulates cancer cell metabolism including: fatty acid metabolism, cholesterol homeostasis, and oxidative phosphorylation (Fig.1C, 2C and Supplemental Figure 3D). While these findings support previously published data describing the role of DNA-PK in lipogenesis and mitochondrial biogenesis and function(51–53), this study is the first to describe DNA-PK directly affecting the transcriptional regulation of metabolic gene networks rather than modulating metabolic processes through phosphorylation of co-factors or protein-protein interactions. These findings support the rationale to assess the critical impact of DNA-PK in tumor–associated metabolic and immunomodulating processes.

Based on the pro-tumorigenic role of DNA-PK in cancer and the data linking it to metastatic potential, DNA-PK has been nominated as a therapeutic target. Recently developed DNA-PK inhibitors have entered the clinical trial space in combination with irradiation in multiple liquid and solid tumors. In the study presented here, two DNA-PK inhibitors were used: a specific laboratory-grade DNA-PK inhibitor (NU7441) and a clinical grade dual DNA-PK/TORK inhibitor (CC-115). The advantage of using the dual DNA-PK inhibitor is multi-fold: i) CC-115 inhibits not only DNA-PK but also TORK, which is commonly deregulated in cancer and is involved in cancer metabolism, tumor microenvironment, proliferation, and metastasis; ii) TORK targeting is already under investigation in multiple cancers including prostate, and already FDA approved in renal cell carcinoma(54, 55), however CRPC patients has had negligible results, suggesting that targeting DNA-PK in combination with TORK may lead to better results in CRPC(38, 56); iii) CC-115 can potently inhibit proliferation as a single agent in models of HSPC and CRPC to a greater magnitude than either DNA-PK or TORK inhibition alone, and iv) CC-115 is under current clinical investigation. One of the challenges that was anticipated and observed in this study with the use of two TORK targeting agents was the up-regulation of the androgen response due to a feedback regulatory mechanism between TOR and AR(37, 38). Utilization of TORK inhibitors as single agents has demonstrated minimal efficacy in clinical trials in CRPC, mainly attributed to the feedback response with AR(57, 58). Combination of TORK targeting agents with a standard of care androgen antagonist, Enza, are being investigated in clinical trials in CRPC (NCT02125084, NCT02407054). The data herein show that DNA-PKi/TORKi/Enza combination performed better than Enza alone and DNA-PK/TORKi alone in inhibiting proliferation in PCa models in vitro, in vivo and ex vivo. Thus, co-targeting of DNA-PK, TORK, and AR would be a multi-factorial treatment strategy that impresses upon multiple pro-tumorigenic pathways, with the potential to improve therapeutic response. Despite the likely benefits of the DNA-PK/TORK/AR combination treatment, there are potential concerns that can be hypothesized, such as increased toxicity, drug-drug interaction effects, and development of resistance mechanisms. Based on the findings presented here, a first-in-man DNA-PK-targeted therapeutic clinical trial was opened to study the combination treatment of the dual inhibitor CC-115 with Enza in men with CRPC (NCT02833883). Clinical assessment of CC-115/Enza combination will shed more light on whether the toxicities are manageable and whether they outweigh the benefits.

In summary, DNA-PK is known to be overexpressed, hyperactivated and a driver of aggressive phenotypes in advanced prostate cancer(12), however the underpinning mechanisms are not well understood. Data presented herein defined the global transcriptomic functions of DNA-PK in the absence of exogenous DNA damage, and uncovered novel processes that are modulated by DNA-PK including transcriptional regulation of EMT, immune response and metabolism. Moreover, a combination therapy targeting multiple critical nodes involved in PCa was identified, and was fast-tracked into a clinical study. CRPC remains universally lethal disease, however co-targeting DNA-PK, TORK, and AR could provide an effective anti-cancer therapeutic strategy for the management of CRPC.

Supplementary Material

1
2
mRNA Primers Forward Reverse
PRKDC GAATCGAACCCTGATTCCCCGTC TTGTTTCGCAACCAGTTCAC
ROCK2 TCCCCCATCAACGTGGAGAGCT TGCCTTGTGACGAACCAACTGCA
NME1 CAGGAACCATGGCCAACTGTG CGGATGGTCCCAGGCTTGG
c-MYC AAACACAAACTTGAACAGCTAC ATTTGAGGCAGTTTACATTATGG
FZD1 CCTGGATTGGCATTTGGTC TACGTAAGCACCGTGAAGAG
PLOD1 GAAATGGGCCATGTGAGAG TAGTTCAACTGCAGCTTGG
SAP30 GCGTTTGTATTGGAGTCGAG TTCTAGGGAATTCGGGCTG
TRIM 14 AGAGGCTTCAGGCATACAC CTTAAAGAAGCTCTTGACGGG
NT5S TGGTGATGAAGTTGTGGGA CAAACACTAAATTTGTCCCTGG
THY1 GCTTCTGTCTGGTTTATTTAGG TCCCTCTTCACGAACTCTC
OPRK1 GTCTACTCCGTAGTGTTCGT CCATTGAAATTCCAACCGGA
FASN TATGCTTCTTCGTGCAGCAGT GTGGATGATGCTGATGATGGA
JAG1 GATGAATGTGCCAGCAACC GATGTCCAGCTGACAGAGG
MAPK14 AAAATGTCTCAGGAGAGGCCC GTGTCAAAAGCAGCACACACA
TMPRSS2 GGACAGTGTGCACCTCAAAGAC TCCCACGAGGAAGGTCCC
KLK3/PSA TGTGTGCTGGACGCTGGA CACTGCCCCATGACGTGAT
FKBP5 GCAACAGTAGAAATCCACCTG CTCCAGAGCTTTGTCAATTCC
18S CGGCGACGACCCATTCGAAC GAATCGAACCCTGATTCCCCGTC

Statement of Translational Relevance.

DNA-PK is a driver of aggressive disease and has been nominated as a therapeutic target in multiple cancer types. Targeting DNA-PK is an attractive therapeutic strategy that can lead to significant anti-cancer effects. However, further understanding of DNA-PK functions, especially transcriptional regulation, is essential for the development of effective treatments. This study demonstrates that DNA-PK transcriptionally modulates gene networks beyond its known function in DNA repair, hormone signaling and metastatic pathways. Data herein identified novel DNA-PK-mediated functions including regulation of epithelial mesenchymal transition, immune response, and metabolic processes. Moreover, the unbiased transcriptomic data in this study informed the investigation of a combinatorial strategy targeting DNA-PK, TOR kinase (TORK) and androgen receptor (AR) that is currently being evaluated in the clinical setting in castration-resistant prostate cancer (CRPC). The data presented in this study has led to bench-to-bed discoveries that have the potential to affect the management and treatment of CRPC in the clinical setting.

Acknowledgements

We gratefully thank all the members of the Knudsen laboratory for their intellectual and technical support. Additionally, we thank the following institutions that supported this work: the NIH/NCI grants to KEK (RO1 CA176401, R01 CA182569, R01 CA217329, P30 CA056036), the Prostate Cancer Foundation (to KEK, AAS and RdL), the Sidney Kimmel Cancer Center Support Grant (5P30CA056036) and the Translational Pathology, MetaOmics and Biostatistics shared resource core facilities at SKCC.

Footnotes

The authors declare no potential conflict of interest.

REFERENCES:

  • 1.O’Connor MJ. 2015. Targeting the DNA Damage Response in Cancer. Mol Cell 60:547–560. [DOI] [PubMed] [Google Scholar]
  • 2.Jackson SP, Bartek J. 2009. The DNA-damage response in human biology and disease. Nature 461:1071–1078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Moynahan ME, Jasin M. 2010. Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis. Nat Rev Mol Cell Biol 11:196–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ceccaldi R, Rondinelli B, D’Andrea AD. 2016. Repair Pathway Choices and Consequences at the Double-Strand Break. Trends Cell Biol 26:52–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Radhakrishnan SK, Jette N, Lees-Miller SP. 2014. Non-homologous end joining: emerging themes and unanswered questions. DNA Repair (Amst) 17:2–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Davis AJ, Chen DJ. 2013. DNA double strand break repair via non-homologous end-joining. Transl Cancer Res 2:130–143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jeggo PA, Pearl LH, Carr AM. 2016. DNA repair, genome stability and cancer: a historical perspective. Nat Rev Cancer 16:35–42. [DOI] [PubMed] [Google Scholar]
  • 8.Goodwin JF, Knudsen KE. 2014. Beyond DNA repair: DNA-PK function in cancer. Cancer Discov 4:1126–1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Beskow C, Skikuniene J, Holgersson A, Nilsson B, Lewensohn R, Kanter L, Viktorsson K. 2009. Radioresistant cervical cancer shows upregulation of the NHEJ proteins DNA-PKcs, Ku70 and Ku86. Br J Cancer 101:816–821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Soderlund Leifler K, Queseth S, Fornander T, Askmalm MS. 2010. Low expression of Ku70/80, but high expression of DNA-PKcs, predict good response to radiotherapy in early breast cancer. Int J Oncol 37:1547–1554. [DOI] [PubMed] [Google Scholar]
  • 11.Willmore E, Elliott SL, Mainou-Fowler T, Summerfield GP, Jackson GH, O’Neill F, Lowe C, Carter A, Harris R, Pettitt AR, Cano-Soumillac C, Griffin RJ, Cowell IG, Austin CA, Durkacz BW. 2008. DNA-dependent protein kinase is a therapeutic target and an indicator of poor prognosis in B-cell chronic lymphocytic leukemia. Clin Cancer Res 14:3984–3992. [DOI] [PubMed] [Google Scholar]
  • 12.Goodwin JF, Kothari V, Drake JM, Zhao S, Dylgjeri E, Dean JL, Schiewer MJ, McNair C, Jones JK, Aytes A, Magee MS, Snook AE, Zhu Z, Den RB, Birbe RC, Gomella LG, Graham NA, Vashisht AA, Wohlschlegel JA, Graeber TG, Karnes RJ, Takhar M, Davicioni E, Tomlins SA, Abate-Shen C, Sharifi N, Witte ON, Feng FY, Knudsen KE. 2015. DNA-PKcs-Mediated Transcriptional Regulation Drives Prostate Cancer Progression and Metastasis. Cancer Cell 28:97–113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hsu FM, Zhang S, Chen BP. 2012. Role of DNA-dependent protein kinase catalytic subunit in cancer development and treatment. Transl Cancer Res 1:22–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Goodwin JF, Schiewer MJ, Dean JL, Schrecengost RS, de Leeuw R, Han S, Ma T, Den RB, Dicker AP, Feng FY, Knudsen KE. 2013. A hormone-DNA repair circuit governs the response to genotoxic insult. Cancer Discov 3:1254–1271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.O’Connor MJ, Martin NM, Smith GC. 2007. Targeted cancer therapies based on the inhibition of DNA strand break repair. Oncogene 26:7816–7824. [DOI] [PubMed] [Google Scholar]
  • 16.Shinohara ET, Geng L, Tan J, Chen H, Shir Y, Edwards E, Halbrook J, Kesicki EA, Kashishian A, Hallahan DE. 2005. DNA-dependent protein kinase is a molecular target for the development of noncytotoxic radiation-sensitizing drugs. Cancer Res 65:4987–4992. [DOI] [PubMed] [Google Scholar]
  • 17.Lee KJ, Lin YF, Chou HY, Yajima H, Fattah KR, Lee SC, Chen BP. 2011. Involvement of DNA-dependent protein kinase in normal cell cycle progression through mitosis. J Biol Chem 286:12796–12802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kong X, Shen Y, Jiang N, Fei X, Mi J. 2011. Emerging roles of DNA-PK besides DNA repair. Cell Signal 23:1273–1280. [DOI] [PubMed] [Google Scholar]
  • 19.Ruis BL, Fattah KR, Hendrickson EA. 2008. The catalytic subunit of DNA-dependent protein kinase regulates proliferation, telomere length, and genomic stability in human somatic cells. Mol Cell Biol 28:6182–6195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Stronach EA, Chen M, Maginn EN, Agarwal R, Mills GB, Wasan H, Gabra H. 2011. DNA-PK mediates AKT activation and apoptosis inhibition in clinically acquired platinum resistance. Neoplasia 13:1069–1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kotula E, Berthault N, Agrario C, Lienafa MC, Simon A, Dingli F, Loew D, Sibut V, Saule S, Dutreix M. 2015. DNA-PKcs plays role in cancer metastasis through regulation of secreted proteins involved in migration and invasion. Cell Cycle 14:1961–1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Davidson D, Amrein L, Panasci L, Aloyz R. 2013. Small Molecules, Inhibitors of DNA-PK, Targeting DNA Repair, and Beyond. Front Pharmacol 4:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhao Y, Thomas HD, Batey MA, Cowell IG, Richardson CJ, Griffin RJ, Calvert AH, Newell DR, Smith GC, Curtin NJ. 2006. Preclinical evaluation of a potent novel DNA-dependent protein kinase inhibitor NU7441. Cancer Res 66:5354–5362. [DOI] [PubMed] [Google Scholar]
  • 24.Tsuji T, Sapinoso LM, Tran T, Gaffney B, Wong L, Sankar S, Raymon HK, Mortensen DS, Xu S. 2017. CC-115, a dual inhibitor of mTOR kinase and DNA-PK, blocks DNA damage repair pathways and selectively inhibits ATM-deficient cell growth in vitro. Oncotarget 8:74688–74702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mortensen DS, Perrin-Ninkovic SM, Shevlin G, Elsner J, Zhao J, Whitefield B, Tehrani L, Sapienza J, Riggs JR, Parnes JS, Papa P, Packard G, Lee BG, Harris R, Correa M, Bahmanyar S, Richardson SJ, Peng SX, Leisten J, Khambatta G, Hickman M, Gamez JC, Bisonette RR, Apuy J, Cathers BE, Canan SS, Moghaddam MF, Raymon HK, Worland P, Narla RK, Fultz KE, Sankar S. 2015. Optimization of a Series of Triazole Containing Mammalian Target of Rapamycin (mTOR) Kinase Inhibitors and the Discovery of CC-115. J Med Chem 58:5599–5608. [DOI] [PubMed] [Google Scholar]
  • 26.Thijssen R, Ter Burg J, Garrick B, van Bochove GG, Brown JR, Fernandes SM, Rodriguez MS, Michot JM, Hallek M, Eichhorst B, Reinhardt HC, Bendell J, Derks IA, van Kampen RJ, Hege K, Kersten MJ, Trowe T, Filvaroff EH, Eldering E, Kater AP. 2016. Dual TORK/DNA-PK inhibition blocks critical signaling pathways in chronic lymphocytic leukemia. Blood 128:574–583. [DOI] [PubMed] [Google Scholar]
  • 27.Centenera MM, Raj GV, Knudsen KE, Tilley WD, Butler LM. 2013. Ex vivo culture of human prostate tissue and drug development. Nat Rev Urol 10:483–487. [DOI] [PubMed] [Google Scholar]
  • 28.Shafi AA, Schiewer MJ, de Leeuw R, Dylgjeri E, McCue PA, Shah N, Gomella LG, Lallas CD, Trabulsi EJ, Centenera MM, Hickey TE, Butler LM, Raj G, Tilley WD, Cukierman E, Knudsen KE. 2018. Patient-derived Models Reveal Impact of the Tumor Microenvironment on Therapeutic Response. Eur Urol Oncol 1:325–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. 2013. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Robinson MD, McCarthy DJ, Smyth GK. 2010. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26:139–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. 2005. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102:15545–15550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones SJ, Marra MA. 2009. Circos: an information aesthetic for comparative genomics. Genome Res 19:1639–1645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Pyun BJ, Seo HR, Lee HJ, Jin YB, Kim EJ, Kim NH, Kim HS, Nam HW, Yook JI, Lee YS. 2013. Mutual regulation between DNA-PKcs and Snail1 leads to increased genomic instability and aggressive tumor characteristics. Cell Death Dis 4:e517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Loewith R, Hall MN. 2011. Target of rapamycin (TOR) in nutrient signaling and growth control. Genetics 189:1177–1201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Laplante M, Sabatini DM. 2009. mTOR signaling at a glance. J Cell Sci 122:3589–3594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Knudsen KE, Penning TM. 2010. Partners in crime: deregulation of AR activity and androgen synthesis in prostate cancer. Trends Endocrinol Metab 21:315–324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Carver BS, Chapinski C, Wongvipat J, Hieronymus H, Chen Y, Chandarlapaty S, Arora VK, Le C, Koutcher J, Scher H, Scardino PT, Rosen N, Sawyers CL. 2011. Reciprocal feedback regulation of PI3K and androgen receptor signaling in PTEN-deficient prostate cancer. Cancer Cell 19:575–586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bitting RL, Armstrong AJ. 2013. Targeting the PI3K/Akt/mTOR pathway in castration-resistant prostate cancer. Endocr Relat Cancer 20:R83–99. [DOI] [PubMed] [Google Scholar]
  • 39.Mortensen DS, Fultz KE, Xu S, Xu W, Packard G, Khambatta G, Gamez JC, Leisten J, Zhao J, Apuy J, Ghoreishi K, Hickman M, Narla RK, Bissonette R, Richardson S, Peng SX, Perrin-Ninkovic S, Tran T, Shi T, Yang WQ, Tong Z, Cathers BE, Moghaddam MF, Canan SS, Worland P, Sankar S, Raymon HK. 2015. CC-223, a Potent and Selective Inhibitor of mTOR Kinase: In Vitro and In Vivo Characterization. Mol Cancer Ther 14:1295–1305. [DOI] [PubMed] [Google Scholar]
  • 40.Scher HI, Fizazi K, Saad F, Taplin ME, Sternberg CN, Miller K, de Wit R, Mulders P, Chi KN, Shore ND, Armstrong AJ, Flaig TW, Flechon A, Mainwaring P, Fleming M, Hainsworth JD, Hirmand M, Selby B, Seely L, de Bono JS, Investigators A. 2012. Increased survival with enzalutamide in prostate cancer after chemotherapy. N Engl J Med 367:1187–1197. [DOI] [PubMed] [Google Scholar]
  • 41.Merseburger AS, Haas GP, von Klot CA. 2015. An update on enzalutamide in the treatment of prostate cancer. Ther Adv Urol 7:9–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Schiewer MJ, Goodwin JF, Han S, Brenner JC, Augello MA, Dean JL, Liu F, Planck JL, Ravindranathan P, Chinnaiyan AM, McCue P, Gomella LG, Raj GV, Dicker AP, Brody JR, Pascal JM, Centenera MM, Butler LM, Tilley WD, Feng FY, Knudsen KE. 2012. Dual roles of PARP-1 promote cancer growth and progression. Cancer Discov 2:1134–1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Medunjanin S, Weinert S, Schmeisser A, Mayer D, Braun-Dullaeus RC. 2010. Interaction of the double-strand break repair kinase DNA-PK and estrogen receptor-alpha. Mol Biol Cell 21:1620–1628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Trevino LS, Bolt MJ, Grimm SL, Edwards DP, Mancini MA, Weigel NL. 2016. Differential Regulation of Progesterone Receptor-Mediated Transcription by CDK2 and DNA-PK. Mol Endocrinol 30:158–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hill R, Lee PW. 2010. The DNA-dependent protein kinase (DNA-PK): More than just a case of making ends meet? Cell Cycle 9:3460–3469. [DOI] [PubMed] [Google Scholar]
  • 46.Taccioli GE, Amatucci AG, Beamish HJ, Gell D, Xiang XH, Torres Arzayus MI, Priestley A, Jackson SP, Marshak Rothstein A, Jeggo PA, Herrera VL. 1998. Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity. Immunity 9:355–366. [DOI] [PubMed] [Google Scholar]
  • 47.Ju J, Naura AS, Errami Y, Zerfaoui M, Kim H, Kim JG, Abd Elmageed ZY, Abdel-Mageed AB, Giardina C, Beg AA, Smulson ME, Boulares AH. 2010. Phosphorylation of p50 NF-kappaB at a single serine residue by DNA-dependent protein kinase is critical for VCAM-1 expression upon TNF treatment. J Biol Chem 285:41152–41160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ferguson BJ, Mansur DS, Peters NE, Ren H, Smith GL. 2012. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife 1:e00047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wang Y, Sun H, Wang J, Wang H, Meng L, Xu C, Jin M, Wang B, Zhang Y, Zhang Y, Zhu T. 2016. DNA-PK-mediated phosphorylation of EZH2 regulates the DNA damage-induced apoptosis to maintain T-cell genomic integrity. Cell Death Dis 7:e2316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Tsai AK, Khan AY, Worgo CE, Wang LL, Liang Y, Davila E. 2017. A Multikinase and DNA-PK Inhibitor Combination Immunomodulates Melanomas, Suppresses Tumor Progression, and Enhances Immunotherapies. Cancer Immunol Res 5:790–803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wong RH, Chang I, Hudak CS, Hyun S, Kwan HY, Sul HS. 2009. A role of DNA-PK for the metabolic gene regulation in response to insulin. Cell 136:1056–1072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Amatya PN, Kim HB, Park SJ, Youn CK, Hyun JW, Chang IY, Lee JH, You HJ. 2012. A role of DNA-dependent protein kinase for the activation of AMP-activated protein kinase in response to glucose deprivation. Biochim Biophys Acta 1823:2099–2108. [DOI] [PubMed] [Google Scholar]
  • 53.Park SJ, Gavrilova O, Brown AL, Soto JE, Bremner S, Kim J, Xu X, Yang S, Um JH, Koch LG, Britton SL, Lieber RL, Philp A, Baar K, Kohama SG, Abel ED, Kim MK, Chung JH. 2017. DNA-PK Promotes the Mitochondrial, Metabolic, and Physical Decline that Occurs During Aging. Cell Metab 26:447. [DOI] [PubMed] [Google Scholar]
  • 54.Dutcher JP, de Souza P, McDermott D, Figlin RA, Berkenblit A, Thiele A, Krygowski M, Strahs A, Feingold J, Hudes G. 2009. Effect of temsirolimus versus interferon-alpha on outcome of patients with advanced renal cell carcinoma of different tumor histologies. Med Oncol 26:202–209. [DOI] [PubMed] [Google Scholar]
  • 55.Motzer RJ, Escudier B, Oudard S, Hutson TE, Porta C, Bracarda S, Grunwald V, Thompson JA, Figlin RA, Hollaender N, Urbanowitz G, Berg WJ, Kay A, Lebwohl D, Ravaud A, Group R-S. 2008. Efficacy of everolimus in advanced renal cell carcinoma: a double-blind, randomised, placebo-controlled phase III trial. Lancet 372:449–456. [DOI] [PubMed] [Google Scholar]
  • 56.Park JC, Eisenberger MA. 2015. Advances in the Treatment of Metastatic Prostate Cancer. Mayo Clin Proc 90:1719–1733. [DOI] [PubMed] [Google Scholar]
  • 57.Rathkopf DE, Larson SM, Anand A, Morris MJ, Slovin SF, Shaffer DR, Heller G, Carver B, Rosen N, Scher HI. 2015. Everolimus combined with gefitinib in patients with metastatic castration-resistant prostate cancer: Phase 1/2 results and signaling pathway implications. Cancer 121:3853–3861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Statz CM, Patterson SE, Mockus SM. 2017. mTOR Inhibitors in Castration-Resistant Prostate Cancer: A Systematic Review. Target Oncol 12:47–59. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES