Skip to main content
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2019 Aug 26;25(5):1197–1209. doi: 10.1007/s12298-019-00700-5

Gene pyramiding for elite tomato genotypes against ToLCV (Begomovirus spp.), late blight (Phytophthora infestans) and RKN (Meloidogyne spp.) for northern India farmers

Ashish Kumar 1, Salesh Kumar Jindal 1,✉, Major Singh Dhaliwal 1, Abhishek Sharma 1, Sukhjeet Kaur 1, Sandeep Jain 2
PMCID: PMC6745573  PMID: 31564782

Abstract

Mega variety with multiple disease and pest tolerance is one of the major research objectives to protect the crop from biotic stresses in current scenario of climate change. Three tomato leaf curl virus resistance genes (Ty-1, Ty-2 and Ty-3), two late blight resistance genes (Ph-2 and Ph-3) and one root knot nematodes resistance gene (Mi-1.2) were pyramided from different donor parents with the help of marker-assisted backcrossing followed by phenotypic selection. During 2016–2017 (August–March), 100 lines of BC1F4 mapping population were evaluated against these diseases and pest screening. Punjab Chhuhara (a popular north Indian tomato cultivar) was used as a recipient parent that is susceptible for all these diseases and pest. Whereas the resistant parents included CLN3022F2-154-11-11-0 for tomato leaf curl virus, LBR-15 for late blight and NR-5 for root knot nematodes. The study results evaluated, 13 advanced backcrossed lines which possessed multiple disease and pest resistance with better horticultural traits over the parents as well as checks. This investigation showed that the introgression of Ty-1, Ty-2, Ty-3, Ph-2, Ph-3 and Mi-1.2 genes significantly improved the resistance against leaf curl, late blight and root knot nematodes diseases in selected advanced backcrossed lines of tomato. These improved multiple diseases resistant lines may play an important role in future pre-breeding tomato improvement projects.

Electronic supplementary material

The online version of this article (10.1007/s12298-019-00700-5) contains supplementary material, which is available to authorized users.

Keywords: MAS, Marker assisted backcrossing, Multiple disease and pest resistance, Resistance breeding

Introduction

Tomato (Solanum lycopersicum L.) is second most important vegetable after potato worldwide, while third in India after potato and onion (Luthria et al. 2006) in respect to production. The major biotic stresses during tomato cultivation are leaf curl caused by begomoviruses, late blight caused by Phytophthora infestans (Mont.) de Bary and root knot caused by Meloidogyne spp. in tomato cultivating area across the globe. Tomato yellow leaf curl/tomato leaf curl disease (TYLCD/ToLCD) is transmitted by whitefly that is mainly caused by begomoviruses. There are several species of begomoviruses viz. monopartite [Tomato leaf curl Kerala virus (ToLCKeV), Tomato leaf curl Ranchi virus (ToLCRnV), Tomato leaf curl Patna virus (ToLCPaV), Tomato leaf curl Rajasthan virus (ToLCRaV), Tomato leaf curl Pune virus (ToLCPV), Tomato leaf curl Lucknow virus (ToLCLuV), Tomato leaf curl Bangalore virus (ToLCBaV), Tomato leaf curl Karnataka virus (ToLCKaV), Tomato leaf curl Joydebpur virus (ToLCJoV) and Tomato leaf curl Gujarat virus (ToLCGuV)] and bipartite [Tomato leaf curl New Delhi virus (ToLCNDV) and Tomato leaf curl Palampur virus (ToLCPalV)], these both types are prevalent in India (Tiwari et al. 2010; Kanakala et al. 2013; Dhaliwal and Sharma 2016). During the previous studies, there are six genes viz. Ty-1, Ty-2, Ty-3, Ty-4, ty-5 and Ty-6, which have been reported to provide resistance against tomato leaf curl disease that are located on different chromosomes of tomato (Hutton et al. 2012; Hutton and Scott 2014; Ji et al. 2007). At commercial level, most of these genes have been exploited to develop resistant lines/hybrids either singly or in numerous combinations that resulted in a wide range of resistance levels against tomato-infecting begomoviruses (Prasanna et al. 2015). De Barro et al. (2011) reported that Bemisia tabaci includes about 24 typical species of whitefly which not only affect the host plants by virus dissemination but also damage the plant directly by sucking the cell sap.

On the other hand, late blight is another most serious disease caused by Phytophthora infestans (Mont.) in cool and humid tomato growing areas (Nelson 2008). In previous studies, there are three genes viz. Ph-1, Ph-2 and Ph-3 have been reported to confirm resistance against late blight (Gallegly and Marvel 1955; Gardner and Panthee 2010). While gene, Ph-1 alone was found ineffective in tomato breeding due to occurrence of distinct races of P. infestans (Foolad et al. 2008) and no molecular marker reported which is tightly associated with this resistance gene. Whereas, Ph-2 combined with Ph-3 gene are being commercially utilized in resistance breeding programme of tomato (Panthee and Gardner 2011). Ph-3 is much more worthwhile than Ph-1 and Ph-2 genes and confers incompletely dominant resistance to a wide range of races, including those that overcome Ph-1 and Ph-2 (Chunwongse et al. 2002). Recently, Ph-5 gene had also been reported in a distinct accession of S. pimpinellifolium (PI 270433) to provide resistance against a wide range of P. infestance races (Foolad et al. 2006; Merk et al. 2012).

Root knot nematodes (RKN) are endo-parasitic nematodes infecting many plant species including tomato and are distributed worldwide causing RKN disease (Williamson and Hussey 1996). The genus Meloidogyne includes almost 100 species, among them; M. incognita, M. arenaria and M. javanica are capable to infect the tomato plant (Elling 2013; Hadisoeganda and Sasser 1982). Nine genes viz. from Mi-1 to Mi-9 have been identified till date, confirming resistance against RKN disease (Ammiraju et al. 2003; Cap et al. 1993; Peng and Tang 2001; Veremis et al. 1999; Wang et al. 2001). Out of these, only Mi-1 gene provides high degree of resistance to RKN, therefore it is being commercially used for development of RKN resistance in cultivated tomato (Milligan et al. 1998; Danso et al. 2011; Kaur 2014).

Application of cultural and chemical approaches in management of biotic stresses may not be always effective. Because in case of virus and nematodes, it is sometime difficult to use manual practices. In such condition, the development of resistant cultivars against these biotic stresses is the best preventive method to control besides any adverse effect on local agro-ecology. Main objective of this investigation is to identify multiple disease resistant lines/hybrids in tomato.

Materials and methods

Evaluation for multiple disease resistance and horticultural traits

A population comprised of 100 lines of BC1F4 population was evaluated through natural, artificial and molecular screening to identify the multiple disease and pest resistant lines at Department of Vegetable Science, Punjab Agricultural University, Ludhiana, Punjab (India) during 2016–2017 from August to March. The experimental field is situated at 30°55′ north latitude, 75°54′ east longitude and at an altitude of 247 m above mean sea level. To generate BC1F4 population, leaf curl virus resistant parent (Table 1) CLN3022F2-154-11-11-0 was crossed with F1 of late blight resistant parent (LBR-15) and RKN resistant parent (NR-5) to develop three way F1. This three way F1 was further crossed with recurrent parent Punjab Chhuhara (north Indian popular tomato cultivar) to develop complex F1. This complex F1 was re-crossed with Punjab Chhuhara to develop BC1F1 population and further selfed to produce BC1F2 population. Then, MAS was followed for identification of homozygous plants and the selected plants were selfed to develop BC1F3 and then BC1F4 population. The cultivated variety ‘Punjab Chhuhara’ (released in 1975 by Punjab Agricultural University, Ludhiana, Punjab, India) was used as a common susceptible check for all three diseases viz. leaf curl, late blight and root knot nematodes showing homozygous susceptible genetic background for all pyramided genes (Ty-1, Ty-2, Ty-3, Ph-2, Ph-3 and Mi-1.2). Resistant parents/checks include PVB-4 derived from CLN3022F2-154-11-11-0 by Dhaliwal et al. (2018) for leaf curl virus showing homozygous resistance for Ty-1, Ty-2, and Ty-3 genes, LBR-15 that carried Ph-2 and Ph-3 gene for late blight resistance and NR-5 homozygous for Mi-1.2 gene and resistance against RKN. During current study, different horticultural traits viz. fruit weight (g), fruit yield (kg plant−1), pericarp thickness (mm), P/E ratio, number of locules fruit−1, total soluble solids (°Brix), dry matter (%), lycopene (mg 100 g−1 of fresh weight) and titrable acidity (g 100 mL−1 of juice) were recorded that are related with tomato breeding. All the agro-morphological data were subjected to statistical analysis using ‘Windostat Version 9.2’ developed by INDOSTAT services Ltd. Hyderabad, India. Whereas the biochemical traits viz. total soluble solids, dry matter, lycopene and titrable acidity were estimated as suggested by AOAC (2000) and Srivastava and Kumar (2002).

Table 1.

Tomato germplasm used in development of mapping population

Particulars Punjab Chhuhara (R) CLN3022F2-154-11-11-0 (D) LBR-15 (D) NR-5 (D)
Source of germplasm Punjab Agricultural University, Ludhiana, Punjab, India-141004 World Vegetable Centre, Taiwan World Vegetable Centre, Taiwan Punjab Agricultural University, Ludhiana, Punjab, India-141004
Accession number Released cultivar EC-654720 EC-654692 8-2-1-2-5
Parentage/releasing year 1975 – – –
Duration type (early, medium and late) Medium Early Medium Medium
Fruit type/shape Pear Round Round Pear
Suitable for area of cultivation Northern India – – Northern India
Biotic/abiotic stress tolerant Susceptible to tomato leaf curl virus, late blight and root knot nematodes Resistant to tomato leaf curl virus Resistant to late blight Resistant to root knot nematodes

R recipient, D donor

Natural and artificial screening of ToLCD, late blight and RKN

The experimental field is situated at 30°55′ north latitude, 75°54′ east longitude and at an altitude of 247 m above sea level occurring sandy loam type of soil. Fertilizers were applied at the rate of 25 kg of N along with 25 kg of P2O5 and 25 kg of K2O per acre before planting of crop and 35 kg of N per acre also applied at 30 days after transplanting. There was no pesticide application during the investigation. Four weeks old seedlings of thirty plants of each entry were transplanted on 2nd August, 2016 in a plot of 12.6 m2 with two replications for natural screening of ToLCD, late blight and RKN. The natural screening of tomato leaf curl virus was conducted during rainy season when whitefly (vector) population was at peak. The data of disease incidence and disease severity was recorded at 30 (September), 60 (October) and 90 (November) days post transplantation of the tomato seedlings. The artificial screening for tomato leaf curl virus was conducted from August to October 2016 in an insect proof net house when average monthly temperature was ranged from 25.8 to 30.4 °C with relative humidity of 63.0 to 74.0% as suggested by Shankarappa et al. (2008). Ten plants of each entry were sown in plug trays along with resistant and susceptible parents/checks on 8th August 2016 in a net house for artificial screening. Seedlings at four leaves stage were inoculated with viruliferous whiteflies. In artificial inoculation screening, 45 days post inoculation disease severity and disease incidence were observed as suggested by Shankarappa et al. (2008). Disease incidence (DI) and disease severity or per cent disease index (PDI) was calculated as described by McKinney (1923). The coefficient of infection (CI) values was calculated as suggested by Banerjee and Kalloo (1987) with some modifications.

The occurrence of late blight disease was observed during January to March 2017 when high humidity was coupled with cool temperature. All the experimental material was subjected to artificial screening of late blight disease in the month of February 2017, through the “detached leaf assay” and maintained the room temperature of 18 ± 2 °C and relative humidity of 80–100% as suggested by Chen et al. (2008). The disease severity index (DSI) was calculated based on percentage of leaf area affected of the individual leaf at the scale of 0–6 (Chen et al. 2008), seven days post inoculation. Natural screening of RKN disease was observed at the end of crop cycle, 120 days post transplantation. Five selected plants from each entry were uprooted and roots were graded from 0 to 10 rating scale (Bridge and Page 1980) based on visual appearance of galls on the root system and roots were categorized as resistant and susceptible, accordingly. For artificial screening of RKN, the seeds of all the 100 lines along with resistant and susceptible parents/checks were raised in a sick plot (350 larvae/250 cc) with two replications on 8th August 2016. Fifteen plants of each genotype were uprooted from each replication after 60 days of sowing and average of them were considered for final root gall index (RGI) in the scale of 0–5 as described by Taylor and Sasser (1978).

Genotypic screening of Ty, Ph and Mi genes

The genomic DNA (deoxyribonucleic acid) was isolated from young leaves of all the lines including resistant and susceptible parents/checks by using the protocol suggested by Doyle and Doyle (1987). Marker-assisted selection was performed using gene specific molecular markers for confirmation of resistance gene loci viz. ToLCD (Ty-1, Ty-2 and Ty-3), late blight (Ph-2 and Ph-3) and root knot nematodes (Mi-1.2) (Table 2). Polymerase Chain Reactions (PCR) were performed in 10 μL per reaction containing 1 μL of template DNA (conc. 200 ng/μL), 4.3 μL double distilled autoclaved water, 3.5 μL EmeraldAmp GT PCR Master Mix (2X Premix), 0.6 μL of each forward and reverse primers (conc. 20 pmol). The PCR amplification was performed using programmable thermocycler (Eppendorf vapo.protect®) with ‘Touchdown protocol/general PCR profile’ using the cycling profile for separate markers (Table 2). The amplified PCR products were analyzed using 2% agarose gel in 1× TAE (Tris–acetate–EDTA) buffer stained with ethidium bromide 5.0 μL/100 mL with 50 bp ladder. The fragments were observed in ultra violet (UV) light through Alphamager® HP system.

Table 2.

Targeted resistance genes and linked molecular markers used in marker assisted selection

Marker Type of marker Targeted gene Chromosome number Restriction enzyme Expected product size (susceptible, resistant) ~ bp Primer sequence 5′–3′ References
Mi23 SCAR Mi-1.2 6 – 420, 380 (Fig. 2)

F:TGGAAAAATGTGAATTTCTTTTG

R: GCATACTATAGGCTTGTTTACCC

Seah et al. (2007)
JB-1 CAPS Ty-1 6 TaqI 400, 500 (Fig. 3)

F:AACCATTATCCGGTTCACTC

R: TTTCCATTCCTTGTTTCTCTG

Pérez De Castro et al. (2007)
TG105 CAPS Ty-2 11 TaqI 200, 350 (Fig. 4)

F:CTTCAGAATTCTGTTTTAGT

R: ATGTCACATTTGTTGCTTGGACCATCC

Garcia and Maxwell (2007)
FLUW-25 SCAR Ty-3 6 – 475, 641 (Fig. 5)

F:CAAGTGTGCATATACTTCATA(T/G)TCACC

R:CCATAATATAACCTCTGTTTCTATTTCGAC

Ji et al. (2007)
dTG422 CAPS Ph-2 10 HinfI 245, 275 (Fig. 6) Mutschler-Chu (2018)
TG328 CAPS Ph-3 9 ApoI 274, 243 (Fig. 7) Mutschler-Chu (2018)

CAPS cleaved amplified polymorphic sequence, SCAR sequence characterized amplified region

Results

Genotypic evaluation of Ty, Ph and Mi genes

The current study with the help of marker-assisted selection (MAS) identified 13 lines out of 100 advance breeding lines of BC1F4 population harboring different Ty, Ph and Mi genes (Table 3). One line (RS-TW-2-3-1-5) harbored all the pyramided six resistance genes and was heterozygous resistance (+/−) for Ty-1 while homozygous resistance (+/+) for Ty-2, Ty-3, Ph-2, Ph-3 and Mi-1.2 genes. Lines viz. RS-TW-125-3-16-11, RS-TW-126-6E-1-11, RS-TW-128-4-1E-21, RS-TW-128-6-1-11 and RS-TW-128-7-2-11 harbored five out of six pyramided genes. Line RS-TW-128-6-1-11 was found homozygous for five resistance genes (Ty-1, Ty-3, Ph-2, Ph-3 and Mi-1.2). Line RS-TW-125-3-16-11 was homozygous for Ty-1, Ph-2, Ph-3 and Mi-1.2 genes and heterozygous for Ty-3 while there was no PCR amplification observed for Ty-2 gene. Line RS-TW-126-6E-1-11 was homozygous for Ty-1, Ph-2, Ph-3 and Mi-1.2 genes and heterozygous for Ty-2 while there was no PCR amplification observed for Ty-3 gene. Line RS-TW-128-4-1E-21 was homozygous for Ty-2, Ph-2 and Mi-1.2 genes and heterozygous for Ty-1 and Ph-3 genes, while there was no PCR amplicon observed for Ty-3 gene. Line RS-TW-128-7-2-11 was homozygous for Ty-3, Ph-2, Ph-3 and Mi-1.2 genes and heterozygous resistance for Ty-1 while there was no PCR amplicon observed for Ty-2 gene. Lines viz. RS-TW-16-1-10-8, RS-TW-124-5-4-11, RS-TW-125-3-4-2, RS-TW-125-3-10-11, RS-TW-126-8-3-11, RS-TW-130-8-3-11 and RS-TW-130-8-6-11 possessed four out of six pyramided genes (Table 4).

Table 3.

Response of multiple disease resistant lines of tomato in phenotypic (artificial screening) and molecular screening against tomato leaf curl disease, root knot nematodes and late blight

BC1F4 lines Tomato leaf curl disease Root knot nematodes Late blight
DI (%) PDI (%) CI 90 DAI Ty-1 Ty-2 Ty-3 RGI 60 DAS Mi-1.2 DSI 7 DAI Ph-2 Ph-3
RS-TW-2-3-1-5 5.00 ± 5.00 0.71 ± 0.71 0.18 HR +/− +/+ +/+ 1.0 ± 0.20 R +/+ 0.50 ± 0.50 HR +/+ +/+
RS-TW-16-1-10-8 25.00 ± 5.00 10.71 ± 2.14 2.68 HR +/− −/− +/+ 0.9 ± 0.10 R +/+ 3.00 ± 0.00 MR +/+ −/−
RS-TW-124-5-4-11 50.00 ± 10.00 33.22 ± 3.28 16.61 MR +/+ NA NA 1.0 ± 0.00 R +/+ 1.50 ± 0.50 R +/+ +/+
RS-TW-125-3-4-2 45.00 ± 5.00 30.94 ± 2.40 15.47 R +/+ NA −/− 1.0 ± 0.00 R +/− 1.50 ± 0.50 R +/+ +/+
RS-TW-125-3-10-11 60.00 ± 5.00 34.43 ± 5.72 17.21 MR +/+ NA NA 1.0 ± 0.00 R +/+ 2.50 ± 0.50 MR +/+ +/−
RS-TW-125-3-16-11 25.00 ± 5.00 15.23 ± 4.01 3.81 HR +/+ NA +/− 0.9 ± 0.10 R +/+ 1.50 ± 0.50 R +/+ +/+
RS-TW-126-6E-1-11 25.00 ± 5.00 16.87 ± 4.48 4.22 HR +/+ +/− NA 0.9 ± 0.10 R +/+ 1.50 ± 0.50 R +/+ +/+
RS-TW-126-8-3-11 80.00 ± 0.00 36.39 ± 1.96 18.19 MR NA +/+ −/− 0.9 ± 0.10 R +/+ 1.50 ± 0.50 R +/+ +/+
RS-TW-128-4-1E-21 25.00 ± 5.00 14.75 ± 2.40 3.69 HR +/− +/+ NA 1.0 ± 0.00 R +/+ 2.50 ± 0.50 MR +/+ +/−
RS-TW-128-6-1-11 20.00 ± 0.00 9.49 ± 1.12 2.37 HR +/+ −/− +/+ 1.2 ± 0.05 MR +/+ 1.50 ± 0.50 R +/+ +/+
RS-TW-128-7-2-11 10.00 ± 0.00 5.71 ± 1.43 1.43 HR +/− NA +/+ 0.5 ± 0.10 R +/+ 2.50 ± 0.50 MR +/+ +/+
RS-TW-130-8-3-11 50.00 ± 10.00 31.25 ± 5.25 15.63 MR +/+ −/− −/− 0.9 ± 0.10 R +/+ 1.50 ± 0.50 R +/+ +/+
RS-TW-130-8-6-11 45.00 ± 5.00 28.11 ± 1.17 14.05 MR +/+ NA NA 1.1 ± 0.10 MR +/+ 1.50 ± 0.50 R +/+ +/+
PVB-4 (RC) 0.00 ± 0.0 0.00 ± 0.0 0.00 HR +/+ +/+ +/+ – – – – – – –
LBR-15 (RC) – – – – – – – – – – 1.00 ± 0.5 HR +/+ +/+
NR-5 (RC) – – – – – – – 0.4 ± 0.4 R +/+ – – – –
Punjab Chhuhara (SC) 100.00 ± 0.0 100.00 ± 0.0 100.00 HS −/− −/− −/− 4.2 ± 0.3 HS −/− 6.00 ± 0.0 HS −/− −/−

CI coefficient of infection, PDI percent disease index, DI disease incidence, HR highly resistant, R resistant, HS highly susceptible, DAT days after transplanting, DAS days after sowing, DAI days after inoculation, RC resistant check, SC susceptible check, RGI root gall index, DSI disease severity index, +/+ homozygous resistant, +/− heterozygous, –/– homozygous susceptible

Table 4.

Identified BC1F4 lines of tomato possessing pyramided genes

Pyramided genes RS-TW-2-3-1-5 RS-TW-16-1-10-8 RS-TW-124-5-4-11 RS-TW-125-3-4-2 RS-TW-125-3-10-11 RS-TW-125-3-16-11 RS-TW-126-6E-1-11 RS-TW-126-8-3-11 RS-TW-128-4-1E-21 RS-TW-128-6-1-11 RS-TW-128-7-2-11 RS-TW-130-8-3-11 RS-TW-130-8-6-11
Ty-1 P P P P P P P NA P P P P P
Ty-2 P A NA NA NA NA P P P A NA A NA
Ty-3 P P NA A NA P NA A NA P P A NA
Mi-1.2 P P P P P P P P P P P P P
Ph-2 P P P P P P P P P P P P P
Ph-3 P A P P P P P P P P P P P

P present, A absent, NA not amplified

Phenotypic evaluation for ToLCD resistance

Field evaluation and disease assessment during rainy season against ToLCD revealed that 60 lines, out of 100, were highly resistant (HR), 10 were resistant (R), and remaining lines ranged from susceptible to highly susceptible. All 100 lines were also evaluated at seedling stage under an insect-proof net house through artificial viruliferous white fly inoculation. Artificial screening revealed that among 100 lines, 42 lines were HR and 9 were R, while remaining lines exhibited susceptible to highly susceptible reaction against ToLCD (Supplementary Table 1). Among these ToLCD HR or R lines, 13 lines possessed resistance against other two diseases viz. late blight and RKN. In artificial screening, among these 13 lines (Table 2), seven lines viz. RS-TW-2-3-1-5, RS-TW-16-1-10-8, RS-TW-125-3-16-11, RS-TW-126-6E-1-11, RS-TW-128-4-1E-21, RS-TW-128-6-1-11 and RS-TW-128-7-2-11 was found HR with coefficient of infection (CI) 0.18, 2.68, 3.81, 4.22, 3.69, 2.37 and 1.43 against ToLCD, respectively. One line (RS-TW-125-3-4-2) showed CI value of 15.47 and categorized under resistant (R) for ToLCD. Five lines viz. RS-TW-124-5-4-11, RS-TW-125-3-10-11, RS-TW-126-8-3-11, RS-TW-130-8-3-11 and RS-TW-130-8-6-11 was found moderately resistant (MR) with CI value of 16.61, 17.21, 18.19, 15.63 and 14.05 against ToLCD, respectively. Resistant (PVB-4) and susceptible (Punjab Chhuhara) checks were performed well as expected in this investigation.

Phenotypic evaluation of late blight resistance

Evaluation of late blight resistance was performed during field screening from January to March, 2017 and observed that, no incidence of late blight disease symptoms among the plant material. Artificial screening of late blight was conducted through detached leaf assay and maintained high humidity with cool temperature in the month of February, 2017. None of the lines was found to be completely free from disease symptoms indicating that, there was existence of high and uniform inoculums of P. infestans with favourable climatic conditions. After 7 days of inoculation, disease scoring was recorded and found that, out of 100 lines screened, 11 lines were categorized to HR and 38 were resistant (Supplementary Table 2). Among them, 13 lines (Table 3) were categorized to multiple disease resistance in which one line (RS-TW-2-3-1-5) showed lowest disease severity index (DSI = 0.05) and categorized to HR. Eight lines viz. RS-TW-124-5-4-11, RS-TW-125-3-4-2, RS-TW-125-3-16-11, RS-TW-126-6E-1-11, RS-TW-126-8-3-11, RS-TW-128-6-1-11, RS-TW-130-8-3-11 and RS-TW-130-8-6-11 exhibited DSI of 1.5 and categorized as R. Four lines viz. RS-TW-16-1-10-8, RS-TW-125-3-10-11, RS-TW-128-4-1E-21 and RS-TW-128-7-2-11 were found MR with DSI of 3.0, 2.50, 2.50 and 2.50, respectively. Resistant and susceptible checks behaved well as expected with DSI of 1.0 for LBR-15 and 6.0 for Punjab Chhuhara.

Phenotypic evaluation of RKN resistance

Field evaluation revealed that only 20 lines, out of 100, were resistant and six lines were MR against RKN disease. Artificial screening was conducted through sick plot technique and found that only 17 lines, out of 100 were R and four were MR for RKN disease (Supplementary Table 3). Among them, 13 lines (Table 2) were resistant against multiple targeted disease and pest. One (RS-TW-128-7-2-11) of 13 lines showed very less nematode infestation with 0.5 root gall index (RGI) and was categorized as R against RKN. Five lines viz. RS-TW-16-1-10-8, RS-TW-125-3-16-11, RS-TW-126-6E-1-11, RS-TW-126-8-3-11 and RS-TW-130-8-3-11 were found R with RGI of 0.9 against RKN. Three lines viz. RS-TW-2-3-1-5, RS-TW-124-5-4-11, RS-TW-125-3-4-2, RS-TW-125-3-10-11 and RS-TW-128-4-1E-21 were found to be resistant with only 1.0 RGI for RKN resistance. Two lines viz. RS-TW-128-6-1-11 and RS-TW-130-8-6-11 were categorized to MR for RKN disease with 1.2 and 1.1 RGI, respectively.

Evaluation of horticultural traits in advance lines

Nine horticultural traits were estimated during 2016-17 production year. Thirteen lines (Table 5) harboring multiple disease and pest resistance was compared with those of resistant and susceptible checks. Lines viz. RS-TW-2-3-1-5, RS-TW-16-1-10-8, RS-TW-125-3-4-2, RS-TW-125-3-10-11, RS-TW-125-3-16-1, RS-TW-126-8-3-11, RS-TW-128-4-1E-21, RS-TW-128-6-1-11, RS-TW-128-7-2-11 and RS-TW-130-8-6-11 exhibited higher yield potential over all the resistant and susceptible checks used in this study (Fig. 1). Line RS-TW-16-1-10-8 possess higher amount of lycopene as compared to all the checks while lines viz. RS-TW-2-3-1-5 (0.34), RS-TW-16-1-10-8 (0.31), RS-TW-124-5-4-11 (0.32), RS-TW-125-3-4-2 (0.47), RS-TW-125-3-10-11 (0.30), RS-TW-126-8-3-11 (0.43), RS-TW-128-6-1-11 (0.46) and RS-TW-130-8-6-11 (0.41) were identified as possessing lesser amount of titrable acidity (g 100−1 mL of tomato juice) in the multiple disease and pest resistant lines as compare to all the parents/checks.

Fig. 2.

Fig. 2

Agarose gel (2%) showing PCR product with Mi23 primer for RKN resistant gene Mi-1.2

Fig. 3.

Fig. 3

Agarose gel (2%) showing PCR product with JB-1 primer for ToLCD resistant gene Ty-1

Fig. 4.

Fig. 4

Agarose gel (2%) showing PCR product with TG105 primer for ToLCD resistant gene Ty-2

Fig. 5.

Fig. 5

Agarose gel (2%) showing PCR product with FLUW-25 primer for ToLCD resistant gene Ty-3

Fig. 6.

Fig. 6

Agarose gel (2%) showing PCR product with dTG422 primers for late blight resistant gene Ph-2

Fig. 7.

Fig. 7

Agarose gel (2%) showing PCR product with TG328 primer for late blight resistant gene Ph-3

Table 5.

Mean performance of multiple disease resistant lines of tomato for horticultural traits

BC1F4 lines Fruit weight (g) Fruit yield (kg plant−1) No. of locules fruit−1 Pericarp thickness (mm) P/E ratio Dry matter (%) TSS (°Brix) Lycopene content (mg 100−1 mL) Titrable acidity (g 100−1 mL)
RS-TW-2-3-1-5 46.66 ± 2.16 2.84 ± 0.06 3.03 ± 0.02 3.76 ± 0.05 1.13 ± 0.02 5.15 ± 0.03 4.04 ± 0.04 3.55 ± 0.04 0.34 ± 0.04
RS-TW-16-1-10-8 31.52 ± 1.52 2.91 ± 0.05 2.07 ± 0.06 4.30 ± 0.03 1.25 ± 0.04 5.20 ± 0.02 5.02 ± 0.06 3.99 ± 0.07 0.31 ± 0.03
RS-TW-124-5-4-11 105.41 ± 0.91 1.26 ± 0.04 3.63 ± 0.13 4.47 ± 0.18 1.30 ± 0.02 4.74 ± 0.03 4.99 ± 0.01 3.35 ± 0.02 0.32 ± 0.04
RS-TW-125-3-4-2 61.84 ± 1.84 3.05 ± 0.10 3.70 ± 0.10 4.31 ± 0.12 0.91 ± 0.02 4.80 ± 0.01 4.71 ± 0.11 3.30 ± 0.08 0.47 ± 0.02
RS-TW-125-3-10-11 64.63 ± 1.63 3.06 ± 0.15 2.78 ± 0.03 3.74 ± 0.08 1.19 ± 0.03 4.88 ± 0.04 4.39 ± 0.04 3.20 ± 0.06 0.30 ± 0.04
RS-TW-125-3-16-11 80.60 ± 2.59 3.12 ± 0.05 3.57 ± 0.06 4.89 ± 0.09 1.00 ± 0.02 5.01 ± 0.07 4.06 ± 0.06 2.78 ± 0.03 0.53 ± 0.03
RS-TW-126-6E-1-11 43.91 ± 3.51 1.40 ± 0.11 2.70 ± 0.10 3.36 ± 0.06 1.17 ± 0.01 4.28 ± 0.02 3.87 ± 0.03 3.39 ± 0.06 0.51 ± 0.03
RS-TW-126-8-3-11 65.50 ± 1.70 2.80 ± 0.05 3.56 ± 0.06 3.63 ± 0.12 0.96 ± 0.03 4.18 ± 0.02 3.41 ± 0.09 2.76 ± 0.04 0.43 ± 0.02
RS-TW-128-4-1E-21 55.41 ± 0.91 2.79 ± 0.01 2.58 ± 0.07 4.82 ± 0.02 1.08 ± 0.02 4.14 ± 0.08 4.72 ± 0.12 3.80 ± 0.03 0.64 ± 0.04
RS-TW-128-6-1-11 78.17 ± 0.17 2.17 ± 0.11 3.00 ± 0.03 4.22 ± 0.18 0.92 ± 0.03 3.39 ± 0.03 3.90 ± 0.03 3.20 ± 0.03 0.46 ± 0.02
RS-TW-128-7-2-11 80.72 ± 2.09 2.30 ± 0.09 2.83 ± 0.07 5.19 ± 0.13 1.47 ± 0.01 3.47 ± 0.07 4.57 ± 0.03 3.76 ± 0.03 0.59 ± 0.02
RS-TW-130-8-3-11 46.15 ± 1.36 1.80 ± 0.06 3.51 ± 0.11 3.89 ± 0.07 1.13 ± 0.02 3.82 ± 0.06 3.84 ± 0.02 2.93 ± 0.04 0.56 ± 0.04
RS-TW-130-8-6-11 65.56 ± 1.56 2.57 ± 0.06 2.83 ± 0.07 4.81 ± 0.11 1.29 ± 0.03 4.76 ± 0.09 3.54 ± 0.09 3.49 ± 0.02 0.41 ± 0.02
PVB-4 (Check) 85.00 ± 0.50 2.45 ± 0.06 3.40 ± 0.10 4.95 ± 0.03 1.01 ± 0.01 4.63 ± 0.08 4.11 ± 0.03 3.48 ± 0.02 0.49 ± 0.03
LBR-15 (check) 110.32 ± 0.84 1.98 ± 0.03 4.01 ± 0.03 4.77 ± 0.10 0.99 ± 0.02 5.13 ± 0.04 3.63 ± 0.02 3.53 ± 0.02 0.63 ± 0.03
NR-5 (check) 70.01 ± 1.01 2.01 ± 0.06 3.04 ± 0.05 5.01 ± 0.02 1.36 ± 0.03 5.38 ± 0.04 4.32 ± 0.03 3.81 ± 0.03 0.64 ± 0.02
Punjab Chhuhara (check) 78.82 ± 1.00 2.18 ± 0.05 3.97 ± 0.05 6.15 ± 0.07 1.71 ± 0.02 3.72 ± 0.05 4.71 ± 0.02 2.75 ± 0.02 0.79 ± 0.03
CD @ 5% 8.66 0.22 0.45 0.75 0.09 0.19 0.26 0.18 0.06

Fig. 1.

Fig. 1

Comparison of fruit yield between the multiple disease resistant lines and their parents/checks

Discussion

This investigation represents the application of phenotypic screening techniques combined with MAS including suitable resistant and susceptible checks to identify triple disease (ToLCD, late blight and RKN) resistant lines in tomato. The Ty, Ph and Mi pyramided genes were evaluated using CAPS and SCAR molecular markers and found satisfactory results. Multiple disease resistant lines could be most valuable product in such areas where incidences of these diseases and pest have been found simultaneously. Among 13 multiple disease resistant lines, eight lines possessed higher yield potential over the parents/checks during rainy season cultivation. MAS made possible to differentiate the plants carrying either gene Ty-1/Ty-2/Ty-3 versus plants with Ty-1+Ty-2+Ty-3 which was very difficult through conventional breeding. Among three genes (Ty-1, Ty-2 and Ty-3) screened for ToLCD, only Ty-1 gene harboring line (RS-TW-125-3-4-2) showed little infection with 15.47 CI while line RS-TW-126-8-3-11, harboring only Ty-2 gene, showed moderate level of resistance in phenotypic screening. Kalloo and Banerjee (2000) reported that, Ty-2 gene harboring lines showed moderate level of resistance against ToLCD while Ty-3 gene carried lines showed resistant reaction in phenotypic screening. Prasanna et al. (2015) also reported that, lines that carried Ty-3 gene showed high degree of resistance against both the begomoviruses viz. monopartite and bipartite. The lines that harbored at least two gene out of three (Ty-1, Ty-2, and Ty-3) were also found promising for resistance to ToLCD. Late blight evaluation of BC1F4 population was conducted for local pathogen isolates with the target of Ph-2 and Ph-3 genes. Race specific phenotypic screening to determine resistance against late blight requires particular congenial environmental conditions. During the current study, there was no incidence of late blight disease observed during field screening that may be due to unfavorable environmental conditions for disease incidence. Therefore, artificial detached leaf assay data was only significant screening to determine resistance against late blight during current experimentation. ToLCD, late blight and RKN diseases poses a great challenge to plant breeders for development of durable resistance for long time. Boiteux and Charchar (1996) reported that, the genotypes, which harbored resistance against RKN have genetic resistance within their gene pool. The identified lines showing nematode resistant gene observed less multiplication of RKN than other lines without Mi-1.2 gene. RKN include many species which may able to attack on the root system of almost all tomato accessions but at different proportions as per diverse genetic background of the plants (Jacquet et al. 2005). Only root gall index (RGI) cannot indicate the durability of resistance against RKN (Zhou et al. 2000), therefore confirmation of Mi gene through molecular marker becomes necessary. Seah et al. (2007) used the Mi23 (F/R) primer for marker assisted selection of RKN resistance and confirmed that, Mi23 primer could be used to detect the Mi-1.2 gene. During current study, within few lines, no amplification observed against some particular genes that may be due to non-specificity at the primer-binding sites. Out of 13 multiple disease resistant lines, 12 lines were homozygous and one (RS-TW-125-3-4-2) was heterozygous for Mi-1.2 gene. Availability of these homozygous lines for Mi-1.2 is utmost important for resistance breeding and gene pyramiding in further studies.

Conclusion

In the current scenario of climate change, having durable resistance is most challenging. Major pest and diseases in tomato are ToLCD, late blight and RKN. The present investigation applied the integrated application of phenotypic and molecular screening methods to identify elite gene pyramided tomato breeding lines. Out of 100 lines evaluated, 51 lines harbored resistance to ToLCD, 49 lines to late blight and 17 lines to RKN while among them, 13 lines were identified to possess resistance against triple diseases in different combinations. These multiple disease resistant lines can play a significant role in resistance breeding and gene pyramiding programme for development of tomato variety/hybrids. Besides this, there is urgent need for fine mapping of these resistant gene for future precise application in MAS studies.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Acknowledgements

Funding for gene pyramiding was granted by the Department of Biotechnology (BT/PR6499/AGII/106/890/2012), Government of India. The authors are also thankful to Dr. Peter Hanson, World Vegetable Centre, Taiwan for providing resistant sources of late blight and leaf curl virus.

Author’s contribution

Conceptualization of research work and designing of experiments (AK, SKJ); Execution of field/lab experiments and data collection (AK, SKJ, AS, SK, SJ); Analysis of data and interpretation (AK, MSD); Preparation of manuscript (AK, SKJ, AS).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interests.

Human and animal rights

This research did not contain any studies on human and/or animal participants performed by any of the authors.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Ammiraju JSS, Veremis JC, Huang X, et al. The heat-stable root-knot nematode resistance gene Mi-9 from Lycopersicon peruvianum is localized on the short arm of chromosome 6. Theor Appl Genet. 2003;106:478–484. doi: 10.1007/s00122-002-1106-y. [DOI] [PubMed] [Google Scholar]
  2. AOAC . Official methods of analysis. 17. Gaithersburg: The Association of Official Analytical Chemists; 2000. [Google Scholar]
  3. Banerjee MK, Kalloo MK. Sources and inheritance of resistance to leaf curl virus in Lycopersicon. Theor Appl Genet. 1987;73:707–710. doi: 10.1007/BF00260780. [DOI] [PubMed] [Google Scholar]
  4. Boiteux LS, Charchar JM. Genetic resistance to root-knot nematode (Meloidogyne javanica) in eggplant (Solanum melongena) Plant Breed. 1996;115:198–200. doi: 10.1111/j.1439-0523.1996.tb00902.x. [DOI] [Google Scholar]
  5. Bridge J, Page SLJ. Estimation of root-knot nematode infestation levels on roots using a rating chart. Trop Pest Manag. 1980;26:296–298. doi: 10.1080/09670878009414416. [DOI] [Google Scholar]
  6. Cap GB, Roberts PA, Thomason IJ. Inheritance of heat-stable resistance to Meloidogyne incognita in Lycopersicon peruvianum and its relationship to the Mi gene. Theor Appl Genet. 1993;85:777–783. doi: 10.1007/BF00225019. [DOI] [PubMed] [Google Scholar]
  7. Chen C-H, Sheu Z-M, Wang T-C. Host specificity and tomato-related race composition of Phytophthora infestans isolates in Taiwan during 2004 and 2005. Plant Dis. 2008;92:751–755. doi: 10.1094/PDIS-92-5-0751. [DOI] [PubMed] [Google Scholar]
  8. Chunwongse J, Chunwongse C, Black L, Hanson P. Molecular mapping of the Ph-3 gene for late blight resistance in tomato. J Hortic Sci Biotechnol. 2002;77:281–286. doi: 10.1080/14620316.2002.11511493. [DOI] [Google Scholar]
  9. Danso Y, Akromah R, Osei K. Molecular marker screening of tomato (Solanum lycopersicum L.) germplasm for root-knot nematodes (Meloidogyne species) resistance. Afr J Biotechnol. 2011;10:1511–1515. [Google Scholar]
  10. De Barro PJ, Liu S-S, Boykin LM, Dinsdale AB. Bemisia tabaci: a statement of species status. Annu Rev Entomol. 2011;56:1–19. doi: 10.1146/annurev-ento-112408-085504. [DOI] [PubMed] [Google Scholar]
  11. Dhaliwal MS, Sharma A. Breeding for resistance to virus diseases in vegetable crops. In: Peter KV, editor. Innovations in horticultural sciences. New Delhi: New India Publishing Agency; 2016. pp. 303–327. [Google Scholar]
  12. Dhaliwal MS, Jindal SK, Sharma A, et al. Breeding tomato for leaf curl virus resistance. Agric Res J. 2018;55:38. doi: 10.5958/2395-146X.2018.00006.6. [DOI] [Google Scholar]
  13. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987;19:15–87. [Google Scholar]
  14. Elling AA. Major emerging problems with minor Meloidogyne species. Phytopathology. 2013;103:1092–1102. doi: 10.1094/PHYTO-01-13-0019-RVW. [DOI] [PubMed] [Google Scholar]
  15. Foolad MR, Merk HL, Ashrafi H, Kinkade MP (2006) Identification of new sources of late blight resistance in tomato and mapping of a new resistance gene. In: Ivors  K (ed) Proceeding of the 21st annual tomato disease workshop, North Carolina State University, Fletcher, NC, USA, 9–10 Nov 2006
  16. Foolad MR, Merk HL, Ashrafi H. Genetics, genomics and breeding of late blight and early blight resistance in tomato. CRC Crit Rev Plant Sci. 2008;27:75–107. doi: 10.1080/07352680802147353. [DOI] [Google Scholar]
  17. Gallegly ME, Marvel ME. Inheritance of resistance to tomato race O of Phytophthora infestans. Phytopathology. 1955;45:103–109. [Google Scholar]
  18. Garcia BE, Maxwell DP (2007) Analysis of sequences from the TG105 marker of chromosome 11 as a tag for Ty-2 locus from S. habrochaites. 144.92.198.11/GeminivirusResistantTomatoes/Markers/TG105.pdf
  19. Gardner RG, Panthee DR. NC 1 CELBR and NC 2 CELBR: early blight and late blight-resistant fresh market tomato breeding lines. HortScience. 2010;45:975–976. doi: 10.21273/HORTSCI.45.6.975. [DOI] [Google Scholar]
  20. Hadisoeganda W, Sasser JN. Resistance of tomato, bean, southern pea, and garden pea cultivars to root-knot nematodes based on host suitabilty. Plant Dis. 1982;66:145–150. doi: 10.1094/PD-66-145. [DOI] [Google Scholar]
  21. Hutton SF, Scott JW. Ty-6, a major begomovirus resistance gene located on chromosome 10. Rep Tomato Genet Coop. 2014;64:14–18. [Google Scholar]
  22. Hutton SF, Scott JW, Schuster DJ. Recessive resistance to tomato yellow leaf curl virus from the tomato cultivar Tyking is located in the same region as ty-5 on chromosome 4. HortScience. 2012;47:324–327. doi: 10.21273/HORTSCI.47.3.324. [DOI] [Google Scholar]
  23. Jacquet M, Bongiovanni M, Martinez M, et al. Variation in resistance to the root-knot nematode Meloidogyne incognita in tomato genotypes bearing the Mi gene. Plant Pathol. 2005;54:93–99. doi: 10.1111/j.1365-3059.2005.01143.x. [DOI] [Google Scholar]
  24. Ji Y, Salus MS, Van Betteray B, et al. Co-dominant SCAR markers for detection of the Ty-3 and Ty-3a loci from Solanum chilense at 25 cM of chromosome 6 of tomato. Life Sci. 2007;57:6–9. [Google Scholar]
  25. Kalloo G, Banerjee M. H:24 moderately leaf curl resistant variety of tomato (Lycopersicon esculentum Mill.) Veg Sci. 2000;27:117–120. [Google Scholar]
  26. Kanakala S, Jyothsna P, Shukla R, et al. Asymmetric synergism and heteroencapsidation between two bipartite begomoviruses, tomato leaf curl New Delhi virus and tomato leaf curl Palampur virus. Virus Res. 2013;174:126–136. doi: 10.1016/j.virusres.2013.03.011. [DOI] [PubMed] [Google Scholar]
  27. Kaur S. Screening of tomato (Solanum lycopersicum L.) germplasm for root-knot nematode resistance using conventional and molecular marker techniques. Indian J Nematol. 2014;44:56–61. [Google Scholar]
  28. Luthria DL, Mukhopadhyay S, Krizek DT. Content of total phenolics and phenolic acids in tomato (Lycopersicon esculentum Mill.) fruits as influenced by cultivar and solar UV radiation. J Food Comp Anal. 2006;19:771–777. doi: 10.1016/j.jfca.2006.04.005. [DOI] [Google Scholar]
  29. McKinney H. Influence of soil temperature and moisture on infection of wheat seedlings by Helminthosporium sativum. J Agric Res. 1923;26:195–218. [Google Scholar]
  30. Merk HL, Ashrafi H, Foolad MR. Selective genotyping to identify late blight resistance genes in an accession of the tomato wild species Solanum pimpinellifolium. Euphytica. 2012;187:63–75. doi: 10.1007/s10681-012-0729-6. [DOI] [Google Scholar]
  31. Milligan S, Bodeau J, Yaghoobi J, et al. The root knot nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell. 1998;10:1307–1319. doi: 10.1105/tpc.10.8.1307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mutschler-Chu M (2018) https://plbrgen.cals.cornell.edu/people/martha-mutschler-chu/
  33. Nelson SC. Late blight of tomato (Phytophthora infestans) Coop Ext Serv. 2008;45:1–10. [Google Scholar]
  34. Panthee DR, Gardner RG. ‘Mountain Merit’: a late tomato hybrid. HortScience. 2011;45:1547–1548. doi: 10.21273/HORTSCI.45.10.1547. [DOI] [Google Scholar]
  35. Peng D, Tang W. Advance of resistance gene Mi to root-knot nematodes in tomato. Yournal Shenyang Agric Univ. 2001;32:220. [Google Scholar]
  36. Pérez De Castro A, Blanca JM, Díez MJ, Nuez Viñals F. Identification of a CAPS marker tightly linked to the tomato yellow leaf curl disease resistance gene Ty-1 in tomato. Eur J Plant Pathol. 2007;117:347–356. doi: 10.1007/s10658-007-9103-2. [DOI] [Google Scholar]
  37. Prasanna HC, Sinha DP, Rai GK, et al. Pyramiding Ty-2 and Ty-3 genes for resistance to monopartite and bipartite tomato leaf curl viruses of India. Plant Pathol. 2015;64:256–264. doi: 10.1111/ppa.12267. [DOI] [Google Scholar]
  38. Seah S, Williamson VM, Garcia BE, et al. Evaluation of a co-dominant SCAR marker for detection of the Mi-1 locus for resistance to root-knot nematode in tomato germplasm. Tomato Genet Coop Rep. 2007;57:37–40. [Google Scholar]
  39. Shankarappa KS, Sriharsha Rangaswamy KT, et al. Development of tomato hybrids resistant to tomato leaf curl virus disease in South India. Euphytica. 2008;164:531–539. doi: 10.1007/s10681-008-9750-1. [DOI] [Google Scholar]
  40. Srivastava RP, Kumar S. Fruit and vegetable preservation: principles and practices. Lucknow: International Book Distribution Co.; 2002. pp. 353–364. [Google Scholar]
  41. Taylor AL, Sasser JN (1978) Biology, identification and control of root-knot nematodes (Meloidogyne species). Department of Plant Pathology, North Carolina State University, United States Agency for International Development, Raleigh
  42. Tiwari N, Padmalatha KV, Singh VB, et al. Tomato leaf curl Bangalore virus (ToLCBV): infectivity and enhanced pathogenicity with diverse betasatellites. Arch Virol. 2010;155:1343–1347. doi: 10.1007/s00705-010-0710-4. [DOI] [PubMed] [Google Scholar]
  43. Veremis JC, Van Heusden AW, Roberts PA. Mapping a novel heat-stable resistance to Meloidogyne in Lycopersicon peruvianum. Theor Appl Genet. 1999;98:274–280. doi: 10.1007/s001220051068. [DOI] [Google Scholar]
  44. Wang Q, Ge C, Yin G, et al. Progress on breeding for resistance to root-knot nematodes in tomato. J Laiyang Agric Coll. 2001;18:216–220. [Google Scholar]
  45. Williamson VM, Hussey RS. Nematode pathogenesis and resistance in plants. Plant Cell. 1996;8:1735. doi: 10.1105/tpc.8.10.1735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhou E, Wheeler T, Starr J. Root galling and reproduction of Meloidogyne incognita isolates from texas on resistant cotton genotypes. J Nematol. 2000;32:513–518. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES