Structure-based optimization of a PDZ-binding motif within a viral peptide stimulates neurite outgrowth

Abstract

Protection of neuronal homeostasis is a major goal in the management of neurodegenerative diseases. Microtubule-associated Ser/Thr kinase 2 (MAST2) inhibits neurite outgrowth, and its inhibition therefore represents a potential therapeutic strategy. We previously reported that a viral protein (G-protein from rabies virus) capable of interfering with protein–protein interactions between the PDZ domain of MAST2 and the C-terminal moieties of its cellular partners counteracts MAST2-mediated suppression of neurite outgrowth. Here, we designed peptides derived from the native viral protein to increase the affinity of these peptides for the MAST2–PDZ domain. Our strategy involved modifying the length and flexibility of the noninteracting sequence linking the two subsites anchoring the peptide to the PDZ domain. Three peptides, Neurovita1 (NV1), NV2, and NV3, were selected, and we found that they all had increased affinities for the MAST2–PDZ domain, with K_d values decreasing from 1300 to 60 nm, while target selectivity was maintained. A parallel biological assay evaluating neurite extension and branching in cell cultures revealed that the NV peptides gradually improved neural activity, with the efficacies of these peptides for stimulating neurite outgrowth mirroring their affinities for MAST2–PDZ. We also show that NVs can be delivered into the cytoplasm of neurons as a gene or peptide. In summary, our findings indicate that virus-derived peptides targeted to MAST2–PDZ stimulate neurite outgrowth in several neuron types, opening up promising avenues for potentially using NVs in the management of neurodegenerative diseases.

Introduction

The stabilization of homeostasis and the promotion of neuron survival are major challenges in the treatment of neurodegenerative diseases and neuron protection after nerve damage. The PI3K⁸/AKT-signaling pathway mediates cell survival and promotes resistance to apoptosis by inactivating components of the apoptotic machinery (1, 2). The PI3K/AKT-signaling pathway also controls neuronal morphology and the dynamic formation of neurites during development. In mature neurons, the PI3K/AKT-signaling pathway activates neurite extension and branching (referred to hereafter as neurite outgrowth).

Neurite outgrowth is strongly repressed by inhibitory factors, such as phosphatase and tensin homolog deleted on chromosome 10 (PTEN), an upstream inhibitor of the PI3K/AKT/mechanistic target of the rapamycin cascade-signaling pathway (3–5). PTEN silencing restores neurite outgrowth in various types of neurons (6–9) and promotes branching (8, 10, 11) in cells and in vivo. Neurite outgrowth in human neuroblastoma cells (SHSY5Y) could be restored by the silencing of an AGC kinase widely expressed in the nervous system, the microtubule-associated serine-threonine kinase 2 (MAST2) (12). The similar impacts of gene silencing observed for both PTEN and MAST2 probably reflect the occurrence of protein–protein interactions between these proteins, involving the PDZ domain (post-synaptic density protein 95, Drosophila disc large tumor suppressor, and zona occludens 1) of MAST2. Valiente et al. (13) showed that the PDZ domain of MAST2 (MAST2–PDZ) binds the C-terminal PDZ-binding motif (PBM) of PTEN, greatly increasing the phosphorylation of PTEN by MAST2 at sites thought to control both the cellular distribution and activity of PTEN. Through the formation of this binary complex, MAST2 and PTEN act in synergy to inhibit the signal transduction pathways required for neuronal survival, neurite outgrowth, and regeneration (13–15). Specific disruption of the complex formed by MAST2–PDZ and the PBM of PTEN would therefore be expected to block this inhibition, stimulating neuron survival, neurite outgrowth, and regeneration.

We previously showed that virulent strains of the rabies virus (RABV) promote the survival of infected neurons, through the binding of the C terminus of the viral G-protein to MAST2 via a PDZ–PBM interaction resembling that between PTEN and kinase (16). We have shown that the RABV G-protein of virulent strains promotes neurite outgrowth by activating the AKT-signaling pathway in a PBM-dependent manner (16, 17). Using NMR, we determined the high-resolution structures of the PDZ/PBM complexes formed by MAST2 and PTEN and by MAST2 and RABV G-protein (18, 19). The PBMs of RABV G-protein and PTEN both display an unconventional mode of binding to MAST2–PDZ involving two anchor sites and similar binding affinities enabling these proteins to compete at the binding site of MAST2–PDZ. Finally, we have shown that the expression of the RABV G-protein in human neuroblastoma cells modifies the cellular distribution of PTEN in a PBM-dependent manner (18, 19). Thus, the C-terminal sequence of RABV G-protein promotes neuron survival by disrupting the complex formed between MAST2–PDZ and PTEN. MAST2–PDZ appears to be a promising target for neuroprotective therapy. We aimed to design short-interfering polypeptides capable of efficiently promoting neurite outgrowth by targeting MAST2–PDZ.

In this study, we first identified the minimal core of the viral G-protein required for a peptide to trigger neurite outgrowth in different types of neurons after lentiviral vector-mediated transduction. Then, using the original PBM of the RABV G-protein (NV1–PBM) as our starting material, we performed a rational search for sequence modifications increasing the affinity of the PBM for MAST2–PDZ. We investigated the efficacy of three peptides, Neurovita1 (NV1), Neurovita2 (NV2), and Neurovita3 (NV3), by comparing their capacities to trigger neurite extension and branching in neurons transduced with the corresponding lentiviral vectors. The affinity and specificity profiles of the NV–PBMs were checked with a collection of 222 human PDZ domains (20). Finally, NV3–PBM was delivered to the cells as a peptide after fusion to a cell-penetrating molecule (CPM), as an alternative to lentivector transduction with the aim to use it as a potential drug compound for neurodegenerative diseases, and the capacity of the peptide to stimulate neurite outgrowth was assessed.

Results

Relevance of the in vitro biological models we chose to study Neurovita properties

The aim of the study was to analyze the biological properties of different sequences of Neurovita based on the basis of the strength of their interaction with the PDZ of MAST2. Thus, it is required that the selected cell models used in the biological assays do express MAST2. MAST2 expression was detected by qPCR in human neuroblastoma, mouse primary cells, and rat neuroscreen (NS) cells (Fig. S1A) and by immunocytochemistry using a specific MAST2 antibody in human neuroblastoma and rat NS (Fig. S1B). In addition, we confirmed that MAST2 silencing in the human SH-SY5Y neuroblastoma cell line used in our laboratory stimulates neurite outgrowth (Fig. 1A) as previously shown by Loh et al. (12).

Figure 1.

Lentivector-delivered NV1 in SH-SY5Y or NS triggers neurite outgrowth in a PBM-dependent manner. A, silencing of MAST2 (SH MAST2) triggers spontaneous neurite outgrowth in SH-SY5Y culture. This effect is not observed when cells were treated with pL.KO1shRNA (Control). Two-tailed unpaired Student's t test, = p < 0.0001, was used. These results are representative of two independent experiments. B, structure of the RABV G-protein gene encoding an SP (19 aa), an EC, a TM (22 aa), and a Cyto (44 aa) together with a C-terminal PBM. Scheme on the right shows G-protein trafficking from the ER to the plasma membrane in RABV-infected cells. Diagram of the lentiviral vector transgene expression cassettes: NV1 contains the SP, two amino acids from the EC domain (2 aa), the TM, and the Cyto domain. NV1Δ is identical except that it lacks the last 4 aa at the C terminus of the PBM. C, neurite outgrowth triggered by NV1 and NV1Δ in SH-SY5Y cells 24 h post-transduction with the lentivectors. Left panel, expression of NV1 and NV1Δ assessed by WB with a RABV G-protein Cyto-specific antibody. The expected masses of NV1Δ and NV1 are 9.0 and 9.5 kDa, respectively. Expression of tubulin is used as a loading control. To note, NV1 and NV1Δ bands, obtained in the same membrane but on noncontiguous lanes, were spliced (dashed line). Right panel, measurement of neurite outgrowth in SH-SY5Y cells expressing NV1 or NV1Δ 30 h post-transduction. Images of 30 fields (mean of 300 cells per field) were taken with a UV microscope for each condition. The images were analyzed by ImageJ and the NeuronJ plugin to calculate the average neurite length. N.T. = nontransduced cells. Results are representative of six independent experiments. D, neurite outgrowth triggered by NV1 and NV1Δ in NS cells 72 h post-transduction with the lentivectors. Left panel, protein levels assessed by WB. Expression of tubulin is used as a loading control. Right panel, measurement of neurite outgrowth in NS cells expressing NV1 or NV1Δ 72 h post-transduction. n = 36 fields (mean number of cells per field, 324). N.T. = nontransduced cells. Results are representative of five independent experiments. C and D, ANOVA with Bonferroni's multiple comparison post hoc test, **** = p < 0.0001.

Construction of the initial NV1 peptide

The infection of neurons with RABV led to the expression of five viral proteins: the N, M, G, NS, and L proteins. The G-protein (Fig. 1B, diagram of the full-length RABV G-protein) is a 524-aa type I glycoprotein. It is synthesized in the endoplasmic reticulum (ER) of the soma, and it is then glycosylated in the Golgi apparatus (see G-protein trafficking in Fig. 1B). The G-protein then migrates to the plasma membrane of the neurites, where it associates with the viral endoplasmic reticulum and M protein, for virion formation and egress by budding. The G-protein is attached to the ER and plasma membranes via its unique transmembrane domain (TM). The ectodomain (EC) of the G-protein is located within the luminal compartment of the ER initially, and then at the cell surface after fusion to the plasma membrane. During G-protein trafficking from the ER to the plasma membrane, the cytoplasmic domain (Cyto) containing the C-terminal PBM is always exposed to the cytoplasm of the somato-dendritic neuronal area, where it can interact with cellular partners, such as MAST2, via its PDZ domain. The formation of this complex triggers neurosurvival-signaling pathways and the localization of MAST2 to a submembrane area of the infected cells (16).

We identified the parts of the viral G-protein required for a short-interfering polypeptide to mimic the neurosurvival properties of the viral G-protein. We constructed a mini-RABV G-protein, NV1 (Fig. 1B, NV1 scheme). NV1 harbors a 99.6% deletion of the EC domain but retains the SP, TM, and Cyto-PBM domains, which are required for its processing. We investigated the role of the C-terminal PBM in the biological properties of NV1 by generating a polypeptide lacking four aa at the C terminus, NV1Δ (Fig. 1B, NV1Δ scheme). The properties of the NVs were investigated following the transduction of two types of neuronal cell lines: SH-SY5Y cells and NS. The NV1 and NV1Δ proteins were detected by Western blotting (WB) with a specific Cyto-G antibody in SHSY5Y cell lysates 24 h after transduction (Fig. 1C) and in NS cell lysates 48 h after transduction (Fig. 1D). Neurite outgrowth in NV1Δ-transduced cells was similar to that in nontransduced cells (Fig. 1, C and D). By contrast, NV1 triggered a significantly stronger neurite outgrowth by comparison with NV1Δ in both types of cell (1.6 times stronger in SHSY5Y cells 30 h after transduction, and 3.1 times stronger in NS cells 72 h after transduction (Fig. 1, C and D, right panels, and Fig. S2 for NeuronJ drawings).

Neurite outgrowth was also triggered in neurons other than neuroblastoma and pheochromocytoma cells grown in the presence of a DF medium (NGF or Bt₂cAMP for NS and SHSY5Y, respectively). The effects of NV1 were assessed in transduced human iPSc-derived motor neurons (Fig. 2A) and in transduced E16 mouse primary cortical neurons (Fig. 2B). In these two models, where lentivirus transduced more than 80% of cells (data not shown), NV1 stimulated neurite outgrowth more efficiently than NV1Δ (1.8-fold increase in human motor neurons and 1.2-fold increase in primary mouse cortical neurons). Thus, NV1 induces neurite outgrowth in a PBM-dependent manner in primary cultures of neurons, whether of mouse or human origin.

Figure 2.

NV1 stimulates neurite outgrowth in human iPSc-derived motor neurons and mouse cortical neurons. A, neurite outgrowth in iPSc-derived human motor neurons expressing NV1 and NV1Δ 72 h post-transduction. Images of six fields (500 cells) were taken with the Cell Insight Platform. Analysis was performed using the neuronal profiling bio-application. Neurite outgrowth was measured in triplicate wells. Two-tailed unpaired Student's t tests, **, p = 0.0081, were used. Scale bar, 20 μm. Results are representative of two independent experiments. B, neurite outgrowth in mouse cortical neurons expressing NV1 and NV1Δ 72 h post-transduction. Image of 10 fields (mean of 650 cells per field) were taken with the Cell Insight Platform. Neurite outgrowth was measured using the Neuronal Profiling Bio-Application. Neurite outgrowth was measured in triplicate experiments. N.T. = nontransduced cells, ANOVA was with Bonferroni's multiple comparison post hoc test, **** = p < 0.0001. Scale bar, 50 μm. Results are representative of two independent experiments.

These results show that it is feasible to construct a polypeptide conserving the properties of the viral G-protein if this polypeptide includes the cytoplasmic part of the G-protein and the last 4 aa from the C terminus of the PBM.

Optimization of NV–PBMs sequences to improve their binding to MAST2–PDZ

We previously solved the high-resolution structures of the C-terminal sequences of 13 residues of PTEN and RABV G-protein bound to MAST2–PDZ and calculated their affinities (1.99 and 1.26 μm, respectively) (19). We discovered that, unlike most PBMs, the PBMs of PTEN and of viral G-protein have an unusually large interaction surface (700 Ų), encompassing not only the 4 aa at the C terminus of the PBM (-QTRL-_COOH for G-protein and -ITKV_COOH for PTEN), but also a second anchoring region located at the N terminus of the assayed peptides (_NH2SW- for G-protein and _NH2PF- for PTEN) (Fig. 3A). The sequences interacting with MAST2–PDZ are _NH2SWESHKSGGQTRL_COOH and _NH2PFDEDQHTQITKV_COOH for G-protein and PTEN, respectively. They contain three contiguous regions, the N-terminal anchor (2-aa residues in blue in Fig. 3), a linker (7-aa residues in green), and the conventional C-terminal anchor (4-aa residues in orange).

Figure 3.

Search for improved NV–PBMs. A, structure of MAST2–PDZ (in gray) bound to the viral peptide Cyto13 (Protein Data Bank code 2KQL). The N-terminal anchor, the linker, and the C-terminal anchor of Cyto13 are shown in blue, green, and orange, respectively. The 13 C-terminal aa of NV1 and PTEN are indicated. B, thermodynamic parameters from ITC experiments for 11 peptides interacting with MAST2–PDZ. C, enthalpy (ΔH) and entropy (TΔS) values for peptides from the first and second rounds of optimization are shown in blue and orange, respectively. Values for NV1, NV2, and NV3 and PTEN peptides are indicated.

We began our search for peptides with a greater affinity for MAST2–PDZ by focusing on the 13 residues at the C-terminal end of the viral G-protein (_SWCyto13_QTRL) and human PTEN (_PFPTEN_ITKW). Using our high-resolution NMR structures of MAST2–PDZ/peptide complexes, we rationally designed sequences likely to increase the enthalpic contribution and decrease the entropic cost of binding to MAST2–PDZ. Isothermal titration calorimetry was performed in binding experiments with the MAST2–PDZ domain; the thermodynamic quantities associated with peptide binding were compared with the data obtained for the original sequences (18, 19).

We focused on optimizing the seven-residue linker (positions −4 to −10) tethering the N- and C-terminal anchors of viral G-protein onto MAST2–PDZ, which has been shown to be a sensitive target for improving binding affinity (18, 21). By contrast, we kept the C-terminal anchor -QTRL_COOH, which maintains specificity, intact, together with the N-terminal dipeptide _NH2SW-, which significantly increases binding affinity.

We began by maintaining linker length at seven residues and mutating exposed residues to increase the degree of hydrophobic contact of the two original linker sequences (Ser(-6) and Lys(-7) for _SWCyto13_QTRL or Asp(-8), and Asp(-10) for _PFPTEN_ITKV) (Fig. 3B).

These modifications increased affinity modestly with respect to _SWCyto13_QTRL, by a factor of 3 at best (Fig. 3B). This was not unexpected because, for all assayed sequences with a linker of this length, any decrease in the free enthalpy of binding is strongly compensated by a simultaneous decrease in the associated entropy. The mean compensation between these two thermodynamic quantities was estimated at 80% from the slope of the plot of the corresponding data displayed in Fig. 3C.

By analyzing the kinetic behavior of potential candidates with seven-residue linkers, we previously showed (18) that the flexibility of linker sequences strongly affects their affinity for MAST2–PDZ. However, the high-resolution 3D structures of the PDZ/PBM complexes provided no evidence of contact between MAST2–PDZ and the linker present in the Cyto13 of viral G-protein or PTEN. This discrepancy was probably mostly due to the conformational entropy of the potential ligand in the unbound state, because the polypeptides most disordered when free in solution were the poorer binders. We therefore reduced linker length from 7 to 5 aa and designed seven new sequences, for which we compared binding abilities (lines 5 to 11 in Fig. 3B). The deletion of 2 aa from sequence 442 to generate sequence 441 led to a significant increase in the entropy of binding with no marked change in enthalpy contribution, resulting in a 4-fold increase in affinity. For these shorter sequences, the compensation between the enthalpy and the entropy terms remained at 80% (Fig. 3C). The binding affinities of the new candidates were also modulated by the substitution of one or both of the doublet glycine present at positions −4 and −5. The Gly to Gln change at position −4 yielded the candidate with the highest affinity, PBM 454.

We retained the two sequences with the highest affinities from this second step in peptide design: PBM 441 (which we named NV2–PBM) and PBM 454 (which we named NV3–PBM). Affinity was 10 times higher than that of the starting sequence (NV1–PBM) for NV2–PBM (K_d of 120 nm) and 20 times higher for NV3–PBM (K_d of 60 nm). The kinetics of binding for NV1–PBM (original sequence) and NV3–PBM (sequence with the highest affinity) were compared in stopped-flow experiments. For NV3–PBM, we were able to obtain an accurate value for the association rate constant (1.4 × 10⁷ m⁻¹·s⁻¹, a 1.6-fold increase with respect to NV1–PBM). We could obtain estimates only for the very slow dissociation process, with an approximate dissociation rate constant of 0.89 s⁻¹, more than 1 order of magnitude higher than the corresponding values for the other peptides tested, such as the original PBM, PTEN–PBM (9.7 s⁻¹), and NV1–PBM (16.6 s⁻¹). The residence time of NV3–PBM on the MAST2–PDZ domain was 1.1 s, a value 10 times greater than that for the initial NV1–PBM sequence.

Affinity profiles of the three NV sequences

We addressed the issue of PDZ-NV–PBM specificities by performing automated holdup assays (20). We used this high-throughput chromatographic approach to quantify PDZ–PBM interaction affinities at equilibrium in solution for a collection of 222 human PDZ domains, corresponding to 83% of the original PDZome (266 PDZ domains) overexpressed in a soluble form. The holdup screens probing the interaction of the PDZome with NV1-, NV2-, and NV3–PBM, were performed in triplicate. In Fig. 4, the PDZ-binding intensities (BI) of NV–PBMs are ranked in descending order from left to right. Using a stringent BI threshold of 0.2 to retain only high-confidence binding pairs, the holdup assay identified 5, 8, and 15 hits for NV1–PBM, NV2–PBM, and NV3–PBM, respectively. The PDZ domains recognized by NV1–PBM also bound to NV2–PBM. The NV2–PBM binders were also included in the set of proteins recognized by NV3–PBM. The number of binders detected increased with affinity for MAST2–PDZ, but the slope of BI decay in the binding profiles indicated that recognition specificity was roughly maintained from NV1–PBM to NV3–PBM. Furthermore, this affinity-based ranking demonstrated that all three NV–PBMs targeted MAST2–PDZ preferentially among the 222 PDZ domains tested.

Figure 4.

PDZome-binding profiles for NV peptides. PDZ domains (x axis) are ranked in descending order of BI (y axis). Magnifications show the best binders of NV1, NV2, and NV3 (BI > 0.2 IU). BI values greater than 0.6 IU, between 0.3 and 0.6 IU, and lower than 0.3 IU are shown in red, orange, and yellow, respectively. Biotin was used as a control for the BI profile.

Comparison of the biological activities of NV constructs in NS cells

Mini-G sequences encoding NV2–PBM or NV3–PBM were constructed as described (Fig. 5A). They were delivered to NS cells by lentivirus vectors. The viability of the three lentivirus vectors encoding NV1, NV2, and NV3 was demonstrated by quantifying NV transcripts in the transduced NS cells (Fig. 5B, left panel). Each viral vector produced similar amounts of the corresponding NV1, NV2, and NV3 polypeptides, as shown by WB (Fig. 5B, right panel). We then compared the effects on neurite outgrowth of NV1, NV2, and NV3 in NS cells, 72 h after transduction (Fig. 5C and Fig. S2 for NeuronJ drawings). Peptide rankings for the stimulation of neurite outgrowth (NV3 > NV2 > NV1) were identical to those obtained in vitro for affinity for MAST2–PDZ.

Figure 5.

Increasing the affinity of NV–PBMs for MAST2 protein increases their biological activity. A, diagram of the lentiviral transgene expression cassettes showing the length of the cytoplasmic domain of the constructs (44 aa for the Cyto domain of NV1 and 42 aa for the Cyto domains of NV2 and NV3). The PBM is underlined. * indicates the replacement or the deletion of one residue. B, transduction efficiencies for NV1, NV2, and NV3, as assessed by RT-PCR (left) or by WB on NS cells 48 h post-transduction with lentivectors. NT = nontransduced cells. Tubulin was used as a loading control. C, neurite outgrowth of NV3-, NV2-, NV1-, and NV1Δ-expressing NS cells 72 h post-transduction. n = 20 fields (NV3, NV2, and NV1); n = 10 fields (NV1Δ, N.T.). ANOVA was done with Bonferroni's multiple comparison post hoc test, *** = p = 0.0002; **** = p < 0.0001. Results are representative of three independent experiments. D, arborization (Sholl analysis) in NV3-, NV2-, and NV1-expressing NS cells 72 h post-transduction. The analysis was performed in the same sets of NV1-, NV2-, and NV3-treated NS cells. n = 10 fields (NV3, NV2, NV1, and NT). Two-way ANOVA, **** = p < 0.0008 as shown. Results are representative of three independent experiments.

We then analyzed whether the greater capacity of NV3 and NV2 to stimulate neurite outgrowth was associated with a greater complexity of neurite arborization. We performed Sholl analysis (22) to determine how many times the neurites of a given cell crossed concentric circles of increasing radius centered on the cell soma. The results of the analysis are expressed as the mean number of neurites crossing each circle of increasing radius from 0 to 250 μm for NS cells transduced with each type of construct and for nontransduced cells (Fig. 5D). The expression of the various NVs was associated with a significant increase in neurite arborization complexity relative to that for nontransduced cells, even though the increase between arborization triggered by NV1 and NV2 stays modest. As already shown above for the neurite outgrowth phenotype, NV3 yielded the best increase in arborization.

Practical impact on drug design

The NVs were expressed in neurons via lentiviral vector transduction. However, this type of vectorization is not optimal for human therapeutic applications; therefore, alternative ways to deliver NV need to be considered. Peptide delivery is a possible option, only if two criteria are respected: (a) the active sequence is coupled with a CPM to facilitate passage across the outer membrane of the neurons, and (b) the entire polypeptide size remains small to facilitate its production.

We reduced the size of the most active peptide NV3 by restricting the peptide to its cytoplasmic domain (NV3-Cyto). A new lentiviral vector, NV3-Cyto, was designed to determine whether the removal of the part of the sequence responsible for endomembrane anchorage (the SP, two amino acids of the EC, and the TM domain) could be tolerated (Fig. 6A). We assessed lentivector viability for NV3 and NV3-Cyto by performing RT-PCR on NS cells after transduction (Fig. 6B). NS cells transduced with NV3-Cyto displayed neurite outgrowth, but less than that observed with the parental peptide NV3 (Fig. 6C). Unlike cells transduced with the parental peptide, the cells transduced with NV3-Cyto were unable to achieve higher levels of branching (data not shown). The properties of NV3-Cyto–transduced cells were similar to those of cells transduced with the initial construct, NV1 (as shown in Fig. 6C for neurite outgrowth and Fig. 6D for branching). Thus, NV polypeptides encoding the PBM sequence having a high affinity for MAST2–PDZ can still trigger neurite elongation, even if membrane anchorage is lost.

Figure 6.

NV3-Cyto is as efficient as NV1. A, diagram of the two NV3 lentivector transgene constructs. NV3-Cyto is truncated and lacks the SP, the 2 aa from the EC domain, and the TM domain. It consists of the Cyto domain of NV3 only. B, transcription of the NV3, NV3-Cyto, and NV1 transgenes in NS cells. 18S is used as the standard. n = 3. Two-tailed unpaired Student's t tests, ** = p = 0.0017, were used. C, neurite outgrowth in NV3-, NV3-Cyto-, and NV1-expressing NS cells 72 h post-transduction. NT = nontransduced cells. n = 30 fields (NT and NV3-cyto) and n = 40 fields (NV1, NV2, and NV3). ANOVA was with Bonferroni's multiple comparison post hoc test. Two-tailed unpaired Student's t tests, *** = p = 0.0002; **** = p < 0.0001, were used. Results are representative of three independent experiments. D, arborization (Sholl analysis) for NV1- and NV3-Cyto–expressing NS cells 72 h post-transduction. NT = nontransduced cells. n = 5 fields, two-way ANOVA. n.s = not significant. Results are representative of three independent experiments.

To directly deliver NV3-Cyto into neurons as a peptide, we coupled the NV3-Cyto construct and its control, NV3-CytoΔ, to a CPM, as displayed in Fig. 7A. We used the variable part (VHH) of a single-chain llama antibody as the CPM, because this molecule has been shown to cross the blood–brain barrier and the plasma membrane of brain cells (23, 24). Constructs encoding CPM-NV3-Cyto and CPM-NV3-CytoΔ, as a control (CPM-Neurovita and CPM-NeurovitaΔ, respectively), were genetically engineered (Fig. 7A) and expressed in bacterial periplasm, and the resulting proteins were purified. We have previously shown that when CPM-Neurovita was added to a mixed culture of humans neurons, astrocytes and microglia CPM-Neurovita target neurons preferentially (25). Here, we analyzed whether CPM-Neurovita could be detected in NS by WB or flow cytometry after CPM-Neurovita was added to the culture medium (Fig. S3). Six hours after the addition of CPM-Neurovita to the culture medium, CPM-Neurovita could be detected by WB in the cell lysates at the expected molecular mass of 22.7 kDa (Fig. S3A). Thirty minutes after the addition of CPM-Neurovita to the culture medium, CPM-Neurovita entry was detected by flow cytometry when the cells had been previously permeabilized (Fig. S3B, left panel), whereas no staining was observed on nonpermeabilized cells (Fig. S3B, right panel). This indicates that CPM-Neurovita associates with some cellular area made accessible to the antibody by the permeabilization treatment such as the cytoplasm or the submembrane area.

Figure 7.

Delivery of Neurovita as a peptide using a CPM. A, diagram of the CPM-Neurovita molecule and its PBM-deleted counterpart (CPM-NeurovitaΔ). B, neurite outgrowth in CPM-Neurovita/CPM-NeurovitaΔ- transduced or nontransduced (NT) NS cells 72 h post-treatment. n = 13 fields (NT), n = 6 fields (CPM-Neurovita), n = 10 fields (CPM-NeurovitaΔ). Two-tailed unpaired Student's t test, **** = p < 0.0001, was used. Results are representative of four independent experiments. C, NS neurite outgrowth was monitored by live-cell imaging on Incucyte (Sartorius) in nine fields (mean of 43 cells per field) and analyzed with ImageJ and NeuronJ plugin. Percentage of neurite-bearing NS cells (53) after treatment with either CPM-Neurovita or CPM-NeurovitaΔ is shown. Over a 12-h time period, from 18 to 30 h post-treatment, CPM-Neurovita triggered neurite outgrowth in NS cells in a PDZ–BM-dependent manner. The marks correspond to the percentages of neurite-bearing cells observed every hour over the 12-h period in CPM-Neurovita–treated culture (left) or in CPM-NeurovitaΔ–treated culture (right). Two-way ANOVA, p < 0.0001 was used. Results are representative of two independent experiments. D, over this 12-h period, the speed of outgrowth, expressed as μm/h, was monitored on the recorded live cell images. CPM-Neurovita increased the speed of neurite outgrowth in the NGF-treated NS cells. Two-tailed unpaired Student's t-tests, p = 0.0005, was used. Results are representative of two independent experiments.

When added to the culture medium of NS cells, CPM-Neurovita (2.35 pg/cell) triggered stronger neurite outgrowth than the one observed for CPM-NeurovitaΔ– cells or nontreated cells (Fig. 7B). Time-lapse recordings over a period of 12 h (starting 18 h to after treatment up to 30 h post-treatment) with Incucyte Technology were used to compare the speed of neurite growth. The number of neurites per neuron (Fig. 7C) and the speed of growth (Fig. 7D) were significantly greater in NS cells treated with CPM-Neurovita than in cells treated with CPM-NeurovitaΔ.

Thus, NV efficacy is qualitatively maintained when the NV sequence is delivered as a cell-penetrating interfering peptide.

Discussion

Protein–protein interaction domains, including PDZ domains governing signaling pathways critical for cell homeostasis, are emerging as promising targets for therapeutic applications (26–30). These signaling pathways can be manipulated with short-interfering peptides, which disrupt these interactions. Viruses are obligate intracellular parasites, and their multiplication depends on cellular resources. The mimicry of PBM by viral proteins is a simple strategy by which several viruses take control of the cellular machinery. In particular, this mimicry enables some viruses to modify the commitment of infected cells to death or survival (16, 31, 32). Identification of the viral sequences involved and elucidation of their mechanisms of action could potentially facilitate the design of efficient interfering peptides. We have identified a viral protein, the RABV G-protein, that promotes neurite outgrowth by disrupting interactions between the PDZ of the MAST2 kinase and its endogenous ligands, such as PTEN, via its C-terminal PBM. In this study, we investigated whether we can leverage the robust strategy evolved by a virus for ensuring its own propagation in the brain to develop a short-interfering peptide that promotes neurite outgrowth by specifically targeting MAST2–PDZ.

We hypothesized that NV peptides derived from the RABV G-protein and competing with the endogenous ligand for binding to the MAST2–PDZ domain would promote neurite outgrowth following their delivery into cells. We first showed that short peptides encoding the Cyto-domain of the G-protein reproduce the properties of RABV. However, the presence of certain parts of the viral RABV G-protein involved in association with endomembranes, such as the SP and TM domain, were necessary to ensure their correct cellular targeting. The resulting interfering peptide, NV1, encodes a PBM bound to MAST2–PDZ with an affinity in the micromolar range similarly to PTEN, which is one of the endogenous ligands of MAST2–PDZ. We suggested that increasing the affinity of the interfering peptide for MAST2–PDZ would increase the peptide potency to stimulate neurite outgrowth. We used structural, kinetic, and thermodynamic data for a large number of PDZ/peptide complexes to design peptides with a higher affinity for MAST2–PDZ, with the viral and one endogenous partner of MAST2 (i.e. RABV G-protein and PTEN) as the starting material. One of the original features of our approach relates to the specificity of MAST2–PDZ recognition. In addition to increasing the affinity of NV peptides for MAST2–PDZ, we also wished to maintain this specificity for MAST2–PDZ to prevent undesirable additional interactions with other endogenous proteins. PDZ binding selectivity seems to have been achieved throughout evolution (33, 34). Extensive scans of random peptides against a large collection of PBM domains led to the definition of discrete sets of PDZ classes, conserved from worms to humans, encompassing the last seven amino acid residues of potential PBM candidates (35). Most attempts to improve the strength of a given PDZ–PBM interaction have focused on modifications to the pre-existing stretch of seven amino acid residues at the C terminus of the PBM, position by position. Such efforts have generally resulted in a loss of the specificity of this interaction pair with respect to competing PDZ or PBM molecules (16, 36–38). Indeed, we previously showed that one mutation at position −3 in the PBM sequence of the RABV G-protein is sufficient to extend cellular protein recognition patterns and to switch cell fate from survival to death (16). We therefore decided to keep the C terminus QTRL> intact in the new NVs.

Some PDZ domains make use of amino acid sequences beyond the canonical PDZ domain fold, which are referred to as extended PDZ domains. Similarly, some PDZ ligands require extension sequences beyond the C-terminal PBM, including some more than 10 residues from the last C-terminal residue, for complex formation with the PDZ domain of the partner protein (38). We have shown that both RABV G-protein and PTEN make use of a PBM extension up to position −12 for binding to MAST2–PDZ (18, 19). The unusually large interaction interface between MAST2–PDZ and G-protein or the PTEN C terminus involves not only the four-amino acid canonical PBMs, but also a two-amino acid N-terminal anchor (SW and PF for G-protein and PTEN, respectively). This N-terminal anchor increases MAST2–PDZ-binding affinity and probably plays a crucial role in narrowing the specificity of interaction between MAST2 and its partners (18). This finding is reminiscent of observations from other studies indicating that PTEN also uses an N-terminal extension to bind the third PDZ domain of PAR-3, improving the specificity of PTEN for its target and its subcellular distribution at the junctional membrane of polarized cells (39). We suggested that in this case the N-terminal anchor might be involved in PBM–PDZ specificity and might increase the affinity of the PBM for MAST2–PDZ. We therefore did not modify this part of the molecule either.

By conserving the two viral anchoring sites, _NH2SW- and -QTRL_COOH, from virulent RABV strains, which promote neuron survival, we were able to conserve the specificity of NV peptides for MAST2–PDZ, as illustrated by high-throughput PDZome screening.

We increased the affinity of NV peptides for MAST2–PDZ mostly by decreasing the entropic cost of binding by modulating the flexibility of the central linker connecting the two binding sites of NV peptides, thereby greatly increasing the residence time of NV on MAST2–PDZ. After two rounds of optimization, we obtained peptides with an affinity 20 times higher (K_D = 60 nm) than that of the initial viral or endogenous peptides (1300 nm). Such an affinity, in the nanomolar range, is particularly high for a PDZ/ligand system, especially for molecules targeting a single PDZ domain. For example, interfering peptides targeting the Disheveled PDZ and functioning as an inhibitor of the Wnt/β-catenin–signaling pathway or targeting the PDZ1 of PSD95 and functioning as an inhibitor of nitric oxide (NO) synthesis have K_d values in the micromolar range (40–42). A few examples of nanomolar affinity (3–16 nm) have been reported for multivalent inhibitors targeting multi-PDZ–containing proteins, such as those targeting proteins of the MAGUK family (43).

The selected peptides, NV1, NV2, and NV3, are capable of inducing the neurite outgrowth of NS cells with an efficiency related to their affinity for MAST2–PDZ. These data strongly support our hypothesis that NV activity can be increased by enhancing the strength of interaction with the cellular partner.

Given their capacity to promote neuron survival, NVs could have therapeutic applications for diseases of the nervous system in which neuron survival is compromised. The different ways to deliver NVs will be determined by the nature of the disease. For chronic diseases, it may be advantageous to deliver NVs in gene form, via a viral vector, such as a lentivirus or an adeno-associated virus, which can transduce neurons. The delivery of a peptide, rather than a gene, may be more appropriate when a fast mode of action is required, for example in the case of an acute nerve injury. We therefore tried to adapt NV sequences for peptide production, by reducing the peptide size, to facilitate production and delivery.

We showed that for the optimized peptide NV3 that the processing and translocation were dispensable. Therefore, we were able to halve the size of the peptides, while maintaining the activity of the original construct. However, the 20-fold improvement in affinity initially achieved was counterbalanced by imperfections of targeting. This design was feasible only for NV3, the peptide with the highest affinity for the target. Indeed, our first attempt to generate a similar construct from the NV1 peptide resulted in a total loss of neurite outgrowth stimulation (data not shown). We subsequently demonstrated the feasibility of replacing the viral vector delivery system by fusing a shortened NV3 peptide to a CPM.

In this study, resulting from a combination of biophysical and cellular approaches, we showed for the first time that a virus-derived peptide could be optimized to trigger neurite outgrowth in several types of neurons. This work opens up a number of very promising perspectives for the use of NV as a potential drug candidate in neurodegenerative diseases.

Experimental procedures

Cell lines, plasmids encoding RABV G-protein sequences, lentivectors, and CPM-Neurovita

Neuroscreen cells, a subclone of rat pheochromocytoma 12 (PC12) neuronal cells, were obtained from Cellomics and cultured according to the supplier's instructions. NS cells were grown in nondifferentiating (NDF) medium (Roswell Park Memorial Institute 1640 (RPMI 1640) medium, Thermo Fisher Scientific France, catalog no. 11875093; 5% fetal bovine serum (FBS); 10% horse serum; 1% 200 mm glutamine, Thermo Fisher Scientific France, catalog no. 25030149 and 1% 100× penicillin/streptomycin (Pen-Strep), Thermo Fisher Scientific France, catalog no. 15140148). The differentiating (nondifferentiating) medium had the same composition with the addition of 200 ng/ml of NGF (Sigma, catalog no. N2513). A clone of the human SH-SY5Y neuroblastoma cell line, which was originally used to decipher the role of the kinome, including the role of MAST2, in neurite outgrowth, was obtained from Dr. S. H. Loh and was grown as described previously (12). The NDF for these cells consisted of Dulbecco's modified Eagle's medium/F-12 (Thermo Fisher Scientific France, catalog no. 31330038) supplemented with 10% FBS plus 1% 100× Pen-Strep and 1% 200 mm glutamine. The DF medium for these cells was Neurobasal medium (Thermo Fisher Scientific France, catalog no. 21103049) supplemented with B27 medium (Thermo Fisher Scientific France, catalog no. A3582801), 1% 100× Pen-Strep, 1% 200 mm glutamine, and 1 mm Bt₂cAMP (Sigma, catalog no. D06627).

Cortical neurons were prepared from E16 Swiss mice as described by Vitry et al. (44). Embryonic mouse brains were dissected in Hanks' balanced salt solution (HBSS) (Life Technologies, Inc., catalog no. 14175) supplemented with 10 mm HEPES (Life Technologies, Inc., Inc. catalog no. 15630), 0.05% glucose (Sigma, catalog no. G8769), and 50 μg/ml gentamicin (Life Technologies, Inc., catalog no. 15750). Meninge-free brain cortices were collected in HBSS supplemented with 400 units/ml DNase (Roche Applied Science, catalog no. 04536282001) and incubated with the Liberase HD enzymatic mixture (Sigma, catalog no. 5401054001). The digested tissues were triturated mechanically, and the enzymatic reaction was stopped by adding FBS. The suspension was washed in HBSS and centrifuged for 5 min at 200 × g, and the resulting cell pellet was suspended in Neurobasal medium (Life Technologies, Inc., catalog no. 21103) supplemented with 25 nm 2-mercaptoethanol (Sigma, catalog no. M7522), 50 μg/ml gentamicin, 5 mm HEPES, 2 mm Glutamax (Life Technologies, Inc., catalog no. 35050), N2 (Life Technologies, Inc., catalog no. 17502), and B27 (Life Technologies, Inc., catalog no. 17504). Viable cells were used to seed the wells at a density of 10⁴ to 3 × 10⁴ cells per cm² on plates coated with poly-d-lysine (Sigma, catalog no. P6407) and laminin (Sigma, catalog no. L2020). The cells were allowed to sediment and to adhere for 20 min at room temperature. They were then transferred to an incubator containing 9% CO₂ in air maintained at 37 °C, for 40 min, before the addition of 10 μg/ml fluorodeoxyuridine (Sigma, catalog no. F0503) and 25 μg/ml uridine (Sigma, catalog no. U3003). The iPSc clones (clone 2.1 (45) and clone 3.1, unpublished)⁹ were stimulated to differentiate into motor neurons as described by Maury et al. (46).

The G-(SP-(2 aa)-TM-Cyto) plasmid, which encompasses all the protein domains of the full-length RABV G-protein (RABVvir strain) 2 (signal peptide (SP), transmembrane (TM), cytoplasmic domain (Cyto), and the two amino acids (2 aa) flanking the TM), was described in patent application WO2010/116258 (47). The nucleotide sequences of NV1, NV1Δ, NV2, and NV3 were obtained by PCR and inserted into the pLenti6.3/V5-TOPO® (blasticidin) or pLenti7.3/V5-TOPO® (enhanced GFP) vector with the TA cloning kit (Invitrogen France catalog no. K5315-20). Lentiviruses were produced in 293T cells by standard procedures, as described by Zufferey et al. (48). The number of HIV particles was determined with the HIV p24 ELISA kit (PerkinElmer Life Sciences, catalog no. NEK 050B). The infectivity of recombinant lentivectors was systematically monitored by RT-qPCR and/or flow cytometry. The GenBank^TM accession numbers of the lentivectors are: Lenti-NV1 (KJ742386), Lenti-NV1Δ (KJ742387), Lenti-NV2 (MH197113) and Lenti-NV3 (MH197112). The CPM-Neurovita) and its PBM-deleted counterpart (CPM-NeurovitaΔ) were described in European patent application EP14306388 (49).

CPM-Neurovita is a 209-aa-long (22.7 kDa) chimeric molecule consisting of the following: (i) Neurovita; (ii) a CPM formed by a Neuro-Tag domain (a RABV-derived peptide from the RABVvirG-Protein ectodomain that recognizes the acetylcholine receptor α7 subunit), and by the variable part (VHH) of a llama single-chain antibody capable of crossing biological membranes and the blood– brain barrier (23); and (iii) a StrepTag sequence to label the molecule. CPM-NeurovitaΔ is the disabled form of the molecule with a deletion of the last 4 aa of the PBM. The GenBank^TM accession numbers are KJ784393 (CPM-Neurovita) and KJ784394 (CPM-NeurovitaΔ). The genes were synthesized chemically (MWG Operon, Germany) and inserted into the pASK-IBA2 plasmid (IBA, BioTAGnology, Germany) under the control of the tetracycline promoter. The ompA signal sequence added by this plasmid directs the expressed protein into the periplasmic space of the bacteria and is cleaved during translocation. The recombinant plasmids were used to transform XL1-blue Escherichia coli bacteria (Stratagene). Recombinant bacteria were identified by PCR, and glycerol stocks were generated. CPM-Neurovita peptides were expressed and purified from the bacterial periplasm as described by Lafaye et al. (50). The periplasmic extract was further purified by immunoaffinity chromatography with a mouse high-affinity anti-StrepTag IgG1 mAb, C23.21 (kindly provided by Pierre Lafaye). The molecules were stored in 0.25× PBS at −80 °C. CPM expression was monitored by Western blotting with the C23.21 mAb, with quantification by Odyssey Li-Cor IR chemo luminescence (Li-Cor) with a standardized VHH-StrepTag preparation.

Neurite outgrowth

SH-SY5Y and NS cells

Neurite outgrowth assays on SH-SY5Y and NS were performed as described in detail by Loh et al. (12) and Prehaud et al. (16). Briefly, SH-SY5Y or NS cells were used to seed 24-well plates (CellBind plastic ware, Corning, catalog no. 83-3337) containing nondifferentiating medium, at a density of 40,000 cells per well. They were cultured overnight at 37 °C. The medium was then replaced with DF medium, and the cells were incubated for a further 6 h. They were then infected with 30 ng of p24 lentiviral vector or treated with 2.35 pg/cell CPM-Neurovita or CPM-NeurovitaΔ in DF medium for 1 h. The cells were washed once with DF medium, and incubated in DF medium for 24 h at 37 °C. Thirty hours (SH-SY5Y) or 72 h (NS) post-transduction, the cells were fixed by incubation with 3% paraformaldehyde (PFA) in phosphate-buffered saline (PBS, Thermo Fisher Scientific France, catalog no. 14040141) for 20 min at room temperature and treated for 5 min with 0.1% Triton X-100 and 50% normal goat serum (NGS) in PBS. Neuron-specific anti-βIII-tubulin antibody (Promega France catalog no. G7121) and Hoechst 33342 (Thermo Fisher Scientific France, catalog no. 62249) were used to stain the neurite processes and the nuclei, respectively. Alternatively, the cells were also stained with crystal violet, which preserves the neurite processes. SH-SY5Y human neuroblastoma cells (30 fields, mean of 300 cells per field) and NS cells (36 fields, mean of 324 cells per field) were imaged with a Leica DM 5000B UV microscope equipped with a DC 300FX camera (×40 or ×20 objective). The images were analyzed using ImageJ 1.38X Software (Wayne Rasband, National Institutes of Health) and its plug-in NeuronJ (51). The effects of bias were minimized by performing the experiment blind, with relabeling of the samples.

Motor neurons

Motor neurons were plated at a density of 10,000 cells per well (48-well plates). Gene transfer was performed with lentiviral vectors (6 ng of p24 per well) the next day.

Transduction was obtained in 80–90% of cells. Nontreated conditions was used as a quality control of the culture. Cells were fixed 3 days later (4% PFA in PBS for 20 min at room temperature). The cells were washed in PBS and incubated for 1 h at room temperature in PBS containing 2% NGS, 1% bovine serum albumin (BSA, Sigma, catalog no. A2153), and 0.1% Triton X-100 (Sigma, catalog no. X100). Cells were then incubated overnight at 4 °C with anti-βIII-tubulin antibody (TUBB3, Biolegend France catalog no. 801201), washed three times in PBS, and incubated for 1 h at room temperature with Alexa Fluor 555-conjugated anti-mouse IgG2a antibody (Thermo Fisher Scientific, catalog no. A-21137). Nuclei were stained with 1 mg/ml Hoechst H33342 (Thermo Fisher Scientific France, catalog no. 62249). Motor neurons (500 cells) were analyzed with the Cell Insight platform (Cellomics, Thermo Fisher Scientific France), using the Neuronal Profiling Bio-application suite. Neurite outgrowth phenotype was determined in triplicate experiments.

Mouse cortical neurons

Mouse cortical neurons (3 days in vitro) were plated on 96-well dark-sided cell-binding plates (Corning, catalog no. 3340). They were infected with 10 ng of p24/well of lentiviral vector 2 h after seeding. The medium was changed 12 h after infection. Three days post-infection, the medium was carefully removed, and the neurons were fixed by incubation with 4% PFA for 20 min at room temperature. Plates were washed three times with PBS and the cells were permeated by incubation with 0.3% Triton X-100 (Sigma, catalog no. X100) for 10 min at room temperature. Analysis of neuronal βIII t51ulin immunofluorescence and Hoechst staining were performed as described above for SH-SY5Y/NS cells. Primary cortical neurons (10 fields, mean of 650 cells per field) were analyzed with the Cell Insight platform (Cellomics, Thermo Fisher Scientific France), using the Neuronal Profiling Bio-application suite. Neurite outgrowth phenotype was determined in triplicate experiments.

Time-lapse experiments in NS cells

We determined the neurite-bearing cell phenotype and assessed the speed of neurite outgrowth by using NS cells in NDF to seed collagen-coated 24-well plates (CellBind plastic ware, Corning, catalog no. 83-3337) at a density of 40,000 cells per well. The cells were cultured overnight at 37 °C. The NDF medium was replaced by DF medium containing only 10 ng/ml NGF and 7% FBS (52), 24 h after seeding, and the cells were incubated for a further 3 h. They were then treated with 700 ng/well CPM-Neurovita or CPM-NeurovitaΔ in DF medium. Cells were incubated in DF medium for 48 h at 37 °C, under an atmosphere containing 5% CO₂ in an IncuCyte Live-Cell analysis system. Images were recorded every hour over a 2-day period. For live-cell imaging on IncuCyte, NS cells (nine fields mean of 43 cells per field) were recorded on bright-field images and analyzed with Fiji/ImageJ (59) and the NeuronJ plug-in. The percentage of neurite-bearing cells (53) and the speed of neurite outgrowth and elongation were monitored over 12 h, from 18 to 30 h after treatment.

Arborization analysis

Sholl analysis (22, 54) was used to assess dendritic arborization. This analysis was performed as described by Sahay et al. (22) and Lioy et al. (55). Measurements were obtained from 8-bit converted images with the Sholl analysis plugin (51). Branching complexity was quantified by counting the intersection of neurites with each of 10 concentric circles of increasing radius drawn around the cell body. We picked 30 neurons at random from each group for analysis. Experiments were performed at least three times. Bias was minimized by performing the experiments blind after sample relabeling.

Reverse transcription and quantitative PCR

The procedures used for RT-qPCR have been described elsewhere (56). Basically, cDNA was synthesized from 1 μg of total RNA with the SuperScript II reverse transcriptase (Thermo Fisher Scientific France, catalog no. 18064014). RT-qPCR was performed in triplicate with an ABI Prism 7500 fast sequence detector system with GoTaq PCR master mix (Promega France catalog no. M7133). After normalization against 18S rRNA, the relative abundance of mRNA was obtained by calculating the difference in threshold cycles between the test and control samples (mock value set at 1), as according to the ΔΔC_T method. The primers used were as follows: Lenti-1 (AGACGCCATCCACGCTGTTTTGACCTCCATAG); Lenti-2 (CCAAAACACAATGGAAAAACCAGAAGGGGTAC); Lenti-3 (GTGTTGCGTAGGTTCTGATCGATTGACTCTTC); 18S (forward, CTT AGA GGG ACA AGT GGC G, and reverse, ACG CTG AGC CAG TCA GTG TA); and MAST2, Quantitect primers (Qiagen, Germany) QT00042574.

WB

Proteins were suspended in RIPA buffer (Sigma catalog no. R0278) supplemented with Complete ULTRA EDTA (Roche Applied Science, catalog no. 05892970001), PhosSTOP (Roche Applied Science, catalog no. 04906845001), and nuclease (Thermo Fisher Scientific France, catalog no. 88701). Protein extracts were diluted in NuPAGE LDS buffer (Thermo Fisher Scientific France, catalog no. NP0007) containing the NuPAGE-reducing agent (Thermo Fisher Scientific France, catalog no. NP0004). Protein samples (15 μg/μl) were then loaded onto NuPAGE Novex 12% BisTris gels (Thermo Fisher Scientific France, catalog no. NP0341) and subjected to electrophoresis in MOPS SDS running buffer (Thermo Fisher Scientific France, catalog no. NP0001). The protein bands were blotted onto PVDF Immobilon-FL membranes (Millipore France, catalog no. IPFL00010). Membranes were blocked with 5% BSA in PBS-T buffer (PBS with 0.1% Tween 20) and incubated overnight at 4 °C with the primary antibody in blocking buffer containing 0.1% Tween 20 (Sigma, catalog no. P1379). The membrane was washed with 0.1% Tween 20 in PBS, and the antigen/antibody complex was detected with HRP-conjugated secondary antibody. Membranes were washed with PBST and visualized with the ECL Western blotting kit (Thermo Fisher Scientific France, catalog no. 35055) on a G-Box (SYNGENE USA). The primary antibodies were the anti-βIII-tubulin (Promega France catalog no. G7121) and an anti-RABV G-cytodomain (produced in-house, NIV biological collection) antibody. The secondary antibody was an HRP-conjugated anti-mouse IgG antibody (GE Healthcare, UK, catalog no. NA9310).

MAST2 immunofluorescence in NS or SH-SY5Y cells

Neuronal cells were seeded on poly-l-lysine collagen–coated glass slide (3e+04 cells per slide) in a 24-well cell culture plate. Twenty four hours later, cells were rinsed with PBS buffer (three times) and fixed with 100% methanol at −20 °C for 20 min. Then cells were washed three times with PBS, blocked with 5% goat serum in PBS for an hour at room temperature, rinsed three times with PBS, and incubated overnight at 4 °C with the anti-MAST2 antibody (1:500, Thermo Fisher Scientific France, catalog no. PA5-75974) diluted in 5% goat serum in PBS. The day after, the glass slides were washed three times with PBS and incubated with the secondary antibody conjugated with AF555 (1:500, Thermo Fisher Scientific France, catalog no. A27039) and Hoechst 33342 (Thermo Fisher Scientific France, catalog no. H3570) for 1 h at room temperature. Then the slides were washed three times with PBS and mounted with prolong gold (Thermo Fisher Scientific France, catalog no. P36982). Cells were imaged with a Zeiss LSM70 confocal UV microscope.

Penetration of CPM-Neurovita in NS

The flow cytometry procedures, have been described in Prehaud et al. (47, 57). Briefly, NGF-treated (6 h) NS cells, which had been seeded on 6-well plates (0.5.e+06 cells per well), were treated with 20 ng of CPM-Neurovita or mock-treated with PBS buffer for 30 min at 4 °C. Then, cells were washed three times with PBS buffer before being permeabilized to detect both the molecules bound to the membrane and the molecules in the cytoplasm. The CPM-Neurovita molecules were detected with an anti-Strep Tag mAb C23.2 (IP collection, Dr. Pierre Lafaye) plus a Cy5-conjugated anti-mouse antibody (The Jackson Laboratory).

For WB analyses, 1e+06 NS cells cultivated in NDF medium were processed as above after being treated with 9 μg of CPM-Neurovita or mock-treated with PBS buffer for 6 h at 37 °C. Then cells were washed three times with PBS buffer, lysed with RIPA buffer, and processed for WB using the anti-Strep tag antibody C23.2.

MAST2 silencing

SH-SY5Y were silenced for the expression of MAST2 by using specific lentiviral shRNA MAST2 (TRCN0000001733, TRCN0000001735, and TRCN0000001736) and pL.KO1shRNA (RHS4080) as control. The lentiviral shRNAs were found among the collection of the Open Biosystems Expression Arrest^TM TRC library (Broad Institute, Massachusetts Institute of Technology, and Harvard, sold by Thermo Fisher Scientific). Lentiviral shRNA viral stocks were produced as described previously. Briefly, SH-SY5Y (74 × 10⁶ cells in 12 ml of medium) was infected with 900 ng of p24 equivalent of each lentiviral shRNA vector stock for 2 days. Then an aliquot of the cells was taken, and total RNA was extracted, and gene expression was monitored by RT-qPCR. Neurite outgrowth was assayed in cultures exhibiting a knockdown of expression of >80%. Silencing experiment was conducted on triplicate individual samples.

Statistical analysis

ANOVA with Bonferroni's multiple comparison post hoc test and Student's t test were conducted with Graph Pad Prism version 7 or 8 software.

Sample preparation for biophysical methods

MAST2–PDZ was expressed and purified as described previously (58). PBM peptides were synthesized on solid-phase supports, with the Fmoc (9-fluorenyl methoxycarbonyl) strategy (ProteoGenix; see Fig. 3B for sequences). All biophysics experiments were performed in 50 mm Tris/HCl, 150 mm NaCl, pH 7.5.

Isothermal titration microcalorimetry

ITC measurements were performed as described previously (16) with VP-ITC and ITC200 calorimeters (Malvern). MAST2–PDZ (10 to 30 μm) was titrated at 298 K by 20–45 consecutive injections of 2–7-μl aliquots of the peptides (110–280 μm). Raw data were normalized and corrected for the heats of dilution of the peptides. Equilibrium dissociation constants were determined by fitting nonlinear curves to the corrected based on a model with one set of sites, with Origin7.0 software (OriginLab).

Stopped-flow experiments

The kinetics of association between MAST2–PDZ and the NV3 peptide were studied at 20 °C with SFM300 stopped-flow equipment with fluorescence detection (BioLogic). Typically, 150 μl of MAST2–PDZ solution was rapidly mixed with an equal volume of peptide solution. For each peptide, three concentrations (2.5, 5, and 10 μm) were tested at a constant MAST2–PDZ-peptide ratio of 1:10 to respect pseudo-first–order conditions. The maximal concentration of MAST2–PDZ was 1 μm. A mixing time of 15 ms was used (total flow rate of 20 ml·s⁻¹), resulting in a dead time of 2.5 ms. Data points recorded between 0 and 3 ms were excluded from the fitting process. The flow cell was illuminated with a monochromatic UV light at 295 nm (bandwidth 8 nm), and emitted fluorescence was collected perpendicularly to the incident beam through a 325-nm high-pass filter. Kinetic data were acquired and analyzed as described previously (18). We stored and processed 10–12 averaged traces independently. Averaged kinetic traces from stopped-flow experiments were fitted independently with the following mono-exponential equation: F(t) = A·e^−kobs·t + offset. For each peptide concentration, the mean values of amplitude, the observed rate constant, and the corresponding standard deviations were calculated from the fitted values deduced from each series of averaged kinetic data. Intrinsic association and dissociation rate constants, k_on and k_off, were determined from the linear regression of the variation of k_obs as a function of peptide concentration.

Hold-up

As described by Vincentelli et al. (20), 222 PDZ domains clones from a complete collection of 266 PDZome clones were successfully expressed. The automated holdup assay protocol was performed on a Tecan freedom Evo200 machine with 384-well plates. A 41 μm stock solution of biotinylated Neurovita peptide fixed on streptavidin beads was incubated with a 4 μm His-MBP–PDZ domain solution. After incubation, the liquid phase of the plates was collected and filtered, and the concentration of unbound PDZ domains in the filtered flow-throughs was measured by microfluidic capillary gel electrophoresis with a LabChip GX II machine (Caliper, PerkinElmer Life Sciences). BIs were calculated as described in the supporting information of Ref. 20.

Author contributions

Z. K., E. T., F. D., C. L.-O., S. V., C. B., J. R., A. C., K. R., and C. P. investigation; Z. K. methodology; Z. K., E. T., D. B., S. V., R. V., C. P., N. W., and M. L. writing-original draft; D. B., S. V., A. C., R. V., H. B., C. P., N. W., and M. L. conceptualization; D. B., R. V., C. P., and N. W. supervision; D. B., N. W., and M. L. funding acquisition; D. B., C. P., and M. L. validation; H. B., C. P., N. W., and M. L. writing-review and editing; C. P. data curation.