Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2019 Sep 16;9:13285. doi: 10.1038/s41598-019-49922-3

Transcriptome-based identification and characterization of genes responding to imidacloprid in Myzus persicae

Jianyu Meng 1, Xingjiang Chen 1, Changyu Zhang 2,
PMCID: PMC6746728  PMID: 31527769

Abstract

Myzus persicae is a serious and widespread agricultural pest, against which, imidacloprid remains an effective control measure. However, recent reports indicate that this aphid has evolved and developed resistance to imidacloprid. This study aimed to elucidate the underlying mechanisms and genetic basis of this resistance by conducting comparative transcriptomics studies on both imidacloprid-resistant (IR) and imidacloprid-susceptible (IS) M. persicae. The comparative analysis identified 252 differentially expressed genes (DEGs) among the IR and IS M. persicae transcriptomes. These candidate genes included 160 and 92 genes that were down- and up-regulated, respectively, in the imidacloprid-resistant strain. Using functional classification in the GO and KEGG databases, 187 DEGs were assigned to 303 functional subcategories and 100 DEGs were classified into 45 pathway groups. Moreover, several genes were associated with known insecticide targets, cuticle, metabolic processes, and oxidative phosphorylation. Quantitative real-time PCR of 10 DEGs confirmed the trends observed in the RNA sequencing expression profiles. These findings provide a valuable basis for further investigation into the complicated mechanisms of imidacloprid resistance in M. persicae.

Subject terms: Transcriptomics, Entomology

Introduction

The green peach aphid, Myzus persicae (Sulzer), is a widely distributed agricultural pest that has been reported to inflict serious damage on more than 400 plant species, both directly, through phloem feeding, and indirectly, through the transmission of viruses1. Over the past several decades, the pest has typically been controlled using synthetic insecticides. However, the excessive use of such insecticides has promoted the development of resistance of M. persicae to many chemical products, including organophosphates, carbamates and pyrethroids2. In contrast, neonicotinoid insecticides, which exhibit high binding affinity to insect nicotinic acetylcholine receptors (nAChRs), remain an effective measure for controlling M. persicae, owing to their efficacy, long-lasting effects, and harmlessness to mammals3. In fact, the first neonicotinoid insecticide, imidacloprid, is still the main product used to control both sucking and biting insect pests and is the world’s most popular insecticide4,5. However, as in other types of insecticides, the failure to incorporate insecticide resistance management strategies can increase resistance levels in target pest populations; imidacloprid resistance in M. persicae has now been reported in the USA, Europe, China, and Japan68.

The insecticides used in pest management can be considered as environmental stress factors to insect populations. Therefore, it is a common adaptive strategy for pests to develop insecticide resistance9. The main mechanisms of neonicotinoid resistance include reduced target-site sensitivity and enhanced metabolic detoxification10. A field-evolved instance of imidacloprid resistance in M. persicae was associated with a single mutation (R81T) in the loop D region of the nAChR β1 subunit, which reduced the binding affinity of nAChR for imidacloprid. This is the first example of field-evolved resistance to imidacloprid that is mediated via a target-site mechanism4. However, nAChR mutations have also been reported to play dominant roles in imidacloprid resistance in other insects. In Nilaparvata lugens, for example, a target site mutation (Y151S) in the α1 and α3 subunits of nAChRs appears to be responsible for high-level imidacloprid resistance11, and in Musca domestica, the reduced expression of the α2 subunit of nAChRs has been associated with imidacloprid resistance12.

In addition, a number of studies have associated high expression levels of cytochrome P450 genes with neonicotinoids resistance in insects4. For example, the overexpression of CYP6CY3, CYP6G1, CYP6CM1 and CYP4C64 has been associated with imidacloprid resistance in M. persicae, Drosophila melanogaster and Bemisia tabaci10,13,14. An increase in the activities of detoxification enzymes, such as glutathione S-transferases (GSTs) and carboxylesterases, is also known to be associated with imidacloprid resistance in aphids15. Although reduced target-site sensitivity and enhanced metabolic detoxification are known to contribute to imidacloprid resistance, it is also possible that both resistance mechanisms and adaptation strategies are complex processes that involve an array of metabolic and genetic factors and that such complex processes are responsible for the development of imidacloprid resistance in M. persicae.

Global surveys of transcriptional changes in insecticide-treated insects could help elucidate the metabolic and regulatory mechanisms that underlie insecticide resistance. Currently, powerful next-generation RNA sequencing (RNA-Seq) technology can be used to determine the gene expression profiles and, thereby, helping to elucidate the development of insecticide resistance1618. In this study, high-throughput RNA-Seq was used to determine the transcriptome profiles of imidacloprid-resistant (IR) and imidacloprid-susceptible (IS) M. persicae, with a focus on genes that could provide insight into the mechanisms of physiological adaptation of insects to imidacloprid stress.

Results

RNA sequencing

Samples of IS and IR M. persicae were subjected to Illumina-based RNA-Seq, with three replicates for each strain (IS1, IS2, IS3, IR1, IR2, and IR3). The Illumina sequencing data are shown in Table 1. After filtering, 24,205,298, 24,416,009, and 26,269,490 clean reads were obtained from the IS strain and 28,656,579, 23,803,901, and 23,359,309 clean reads were obtained from the IR strain. The Q20 percentage and GC content of clean reads in the digital gene expression (DGE) libraries ranged from 96.78% to 98.25% and from 39.71% to 40.99%, respectively, and a mean of 92.19% of clean reads was mapped to the M. persicae genome database.

Table 1.

Summary of Illumina RNA-sequencing data.

Samples Raw reads Clean reads Q20 GC content Total mapped Mapped ratio Notes
IS1 24,688,350 24,205,298 96.78% 40.55% 44,350,857 91.61% Replicate 1
IS2 24,914,645 24,416,009 97.67% 39.80% 43,792,242 89.68% Replicate 2
IS3 26,805,241 26,269,490 98.25% 40.03% 47,999,205 91.36% Replicate 3
IR1 29,072,436 28,656,579 98.23% 39.55% 53,969,698 94.17% Replicate 1
IR2 24,481,332 23,803,901 97.66% 39.71% 44,727,119 93.95% Replicate 2
IR3 24,443,951 23,359,309 97.62% 40.96% 43,139,976 92.34% Replicate 3

Differentially expressed genes

Using the DEG-Seq. 2R package, a total of 252 imidacloprid-responsive DEGs were identified in the IS and IR M. persicae transcriptomes; these included 160 and 92 genes that were down- and up-regulated, respectively, in the IR M. persicae (Fig. 1, Supplementary Table S1).

Figure 1.

Figure 1

Differentially expressed gene (DEG) analysis of imidacloprid-resistant and imidacloprid-susceptible Myzus Persicae. (a) Volcano plot of DEGs. Dots represent individual genes. Red dots represent up-regulated genes, and green dots down-regulated genes. Blue dots indicate genes that are not differentially expressed. (b) Heatmap analysis of hierarchical clustering of DEGs. Red and blue indicate high and low expression in the imidacloprid-resistant strain, respectively.

Functional annotation and classification

Gene Ontology (GO) indicated that 186 (73.8%) DEGs were assigned to 303 subcategories, including 45 (24.2%) biological process (BP) terms (of which, 88 were significant; corrected P-values < 0.05), 36 (19.4%) cellular component (CC) terms, and 105 (56.5%) molecular function (MF) terms (Fig. 2, Supplementary Table S2). Most DEGs in the BP category were putatively attributed to “signal transduction”, “single organism signaling”, “cell communication”, and “signaling”, those in the CC category were attributed to “extracellular region” and “cytoskeleton” and those in the MF category were attributed to “structural molecule activity”, “metal ion binding”, “cation binding”, and “structural constituent of cuticle”.

Figure 2.

Figure 2

Gene ontology classification of differentially expressed genes. Category of biological process (BP); Category of cellular component (CC); Category of molecular function (MF).

Meanwhile, Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation revealed that 100 DEGs were annotated for M. persicae. These annotated genes were classified into 45 groups based on the secondary pathway hierarchy (Supplementary Table S3). The major pathways included metabolic pathways (21 proteins), oxidative phosphorylation (9 proteins), Hippo signaling pathway – fly (5 proteins), and phenylalanine metabolism (4 proteins; Fig. 3). In the database of the present study, phenylalanine metabolism (api00360), oxidative phosphorylation (api00190), Hippo signaling pathway – fly (api04391), tyrosine metabolism (api00350), and ECM-receptor interaction (api04512) pathways were found to be with higher corrected P-values < 0.05. These annotations establish an invaluable basis for elucidating the specific processes, functions, and pathways involved in the imidacloprid resistance of M. persicae.

Figure 3.

Figure 3

Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.

qRT- PCR validation of DEGs

qRT-PCR analysis of 10 randomly selected genes confirmed the expression trends observed in the RNA-Seq results (Fig. 4, Supplementary Table S4), thereby, suggesting that the DEG profiles were reliable. Increases in the expression of the selected genes were small, and the biological relevance of these changes is likely minimal.

Figure 4.

Figure 4

Quantitative real-time PCR (qRT-PCR) validation of the expression of differentially expressed genes identified using RNA-sequencing. The expression levels were normalised to GAPDH, EF1α, and β-actin genes.

Discussion

The green peach aphid, M. persicae, is an economically important pest that is typically controlled using insecticides. However, the irrational use of imidacloprid has promoted the rapid development of insecticide resistance in many M. persicae populations, resulting in the failure in controlling the pest68. Undoubtedly, the development of insecticide resistance is complex and is a common adaptation to insecticide exposure. This study aimed to identify imidacloprid-responsive genes in M. persicae, to establish a basis for investigating the responses and adaptive physiological changes that contribute to insect resistance.

For insect pests, insecticide exposure can be considered a common environmental stress and the cuticle is the first and main barrier for insects against environmental stresses. As such, cuticular proteins have been reported to play crucial roles in the insecticide resistance and tolerance of a variety of insect species, including M. persicae, Lymantria dispar, Aphis gossypii and Plutella xylostella13,1618. Indeed, cuticle protein genes (larval cuticle protein A2B/A3A, 111039230/111039229; cuticle protein 111027628, 111034584, 111038352; cuticle protein 12.5/65/38/21/7/3, 111042794/111035272/111032404/111039228, 111039055/111039056/111032178; endocuticle structural glycoprotein SgAbd-2/4/8/9, 111031116/111028315, 111031121/111031114/111041497) were down-regulated in the IR strain of M. persicae, when compared to the expression levels in the IS strain. In this study, the down-regulation of cuticle protein genes in the IR strain was consistent with previous studies that reported the down-regulation of eight cuticle protein genes in thiamethoxam-resistant A. gossypii17. Such changes in expression suggest that cuticle protein genes contribute to the protection of M. persicae from the mechanical damage caused by imidacloprid exposure.

The ABC transporters are responsible for the translocation of a variety of substrates (e.g. nutrients, lipids, inorganic ions and xenobiotics) and can be categorised into eight subfamilies from ABCA to ABCH19. The ABC transporters present in the blood-brain barrier of insects can protect the nervous system from insecticides20 and are reportedly involved in insecticide resistance21,22. Indeed, the contribution of ABC transporters to insecticide resistance has been reported for 27 different insecticides including, imidacloprid, pyrethroids, and avermectin21,23,24. With regard to imidacloprid, ABC transporters have been reported to enhance its exclusion from the brain and to hinder its access to target sites24. Recently, the down-regulation of these genes was reported to be linked to insecticide resistance22,25. Similarly, in our study, it was found that ABCG23 (ABCG23, 111040927) was down-regulated in IR M. persicae, which suggests that the ABC transporter is involved in imidacloprid metabolism and transport.

Glutathione S-transferases (GSTs) are a widespread superfamily of genes that occur in almost all living organisms and participate in a variety of cellular physiological processes, including the detoxification of harmful endobiotic and xenobiotic compounds. Insect GSTs are generally categorised into two main groups: cytosolic and microsomal, based on their cellular location. In insects, most GSTs are cytosolic proteins and are classified as delta, epsilon, omega, sigma, theta, and zeta26. In recent years, a number of studies have investigated the correlation between insect GST genes and insecticide resistance. These studies have demonstrated that insect GSTs play important roles in insecticide detoxification and eliminate the oxidative stress caused by insecticide exposure27. The up-regulation of GST genes has been associated with insecticide detoxification28. However, the down-regulation of GST genes following insecticide exposure has also been reported in several insect species. In Leptinotarsa decemlineata, for example, the expression of LdGSTe4 and LdGSTe6 was significantly down-regulated after cyhalothrin, fipronil, and endosulfan exposure, and that of PxGSTd2, PxGSTe2, PxGSTe5, PxGSTo1, PxGSTs1, PxGSTs2, and PxGSTt1 was down-regulated by β-cypermethrin exposure29. Similarly, our results indicated that GST (111036096, 111036826) was down-regulated in IR M. persicae. Bautista et al. suggested that this phenomenon may be an adaptive mechanism to insecticide pressure and an energy trade-off strategy to ensure that energy is allocated to the most effective genes responsible for detoxification when stimulated by insecticide exposure30. This suggests that GST plays a relatively minor role in the imidacloprid metabolism of M. persicae. However, because insect GST genes exhibit a variety of expression responses to insecticide exposure29, functional studies are needed to examine this hypothesis and identify the specific GST members involved in insecticide detoxification.

Trypsin is a serine protease responsible for digestion; it also contributes to insecticide detoxification31. Recently, Zhu et al. (2015) reported that the midgut trypsin activity of Bt-resistant Spodoptera frugiperda was relatively lower than that of a susceptible strain32. Indeed, in our study, trypsin gene (111033016) was also down-regulated in IR M. persicae. These findings suggest that the expression and function of trypsin are associated with insecticide resistance. However, little is known about the exact role of trypsin in imidacloprid resistance. It has been demonstrated that the lack of midgut trypsin made some insects adapt to insecticide toxins by a mechanism where incomplete or non-activation of the protoxin occurs, and finally induced resistance development33.

Mitochondria play critical roles in a variety of cellular processes, among which energy generation is the most critical and which is primarily achieved through coupled oxidative phosphorylation. The electron transport chain (ETC) consists of four macromolecular protein complexes (complex I–IV), that coordinate to maintain mitochondrial inner membrane potential34. In this study, the mitochondrial complex-related genes NADH dehydrogenase (ETC I, 111029398), succinate dehydrogenase (ETC II, 111027244), cytochrome b-c1 complex (ETC III, 111038823, 111027246), and cytochrome c oxidase (ETC IV, 111034852) were all down-regulated in IR M. persicae, which indicated that imidacloprid exposure reduced the expression of ETC I, II, III, and IV component genes. It is possible that the respiration and energy production of IR aphids may have been weakened by imidacloprid exposure. There is no evidence that the ETC contributed to the enhanced imidacloprid tolerance, but the apparent alteration in the expression of complex I–IV in IR M. persicae clearly associates the mitochondrial complex-related genes with imidacloprid resistance. Previous studies have suggested that the overexpression of cytochrome P450s is the primary reason for neonicotinoid resistance35,36. Indeed, CYP6CY3, which is a cytochrome P450 gene in M. persicae, has been suggested to play a primary role in the development of insecticide resistance4,13. However, the association between mitochondrial complexes and cytochrome P450s with the resistance of M. persicae to imidacloprid requires further investigation.

In conclusion, this study provides, to our knowledge, the first description of genes related to imidacloprid resistance in M. persicae using an RNA-Seq approach. The results indicate that the response patterns of aphids are complex during the development of imidacloprid resistance, as demonstrated by changes in the expression of genes involved cuticle structure, binding, metabolic processes, and oxidative phosphorylation. Further investigations are needed to assess the specific roles of these genes in the response of M. persicae to the stress of insecticide exposure. These findings will provide a basis for investigating the development and mechanisms of insecticide resistance.

Materials and Methods

Aphid strains

One IS strain and one IR strain of M. persicae were used. The IS strain was obtained from tobacco in Guizhou province, China, in 2009, and was subsequently reared in the absence of insecticides. The IR strain was generated from the IS population under continuous imidacloprid selection pressure37. In this study, the imidacloprid resistance of the IR strain was ~45-fold greater than that of the IS strain. Both the IS and IR strains were maintained on tobacco plants at 23–25 °C, with a 16-h photoperiod (16 h light, 8 h dark) and relative humidity of 60%.

RNA isolation

Total RNA was isolated using TRIzol reagent (Invitrogen, CA, USA). The RNA concentration and purity were measured using a NanoPhotometer® spectrophotometer (IMPLEN, CA, USA). The integrity of RNA was confirmed using the Bioanalyzer 2100 system (Agilent, CA, USA).

Library preparation and sequencing

DGE-Seq was performed using the mRNA isolated from the IS and IR strains, with three biological replicates per strain. Sequencing libraries were constructed using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). Briefly, Poly-T oligo-attached magnetic beads were used to purify mRNA, which was then fragmented using divalent cations, and first-strand cDNA was synthesised using random primers and reverse transcriptase, whereas second-strand was synthesised using DNA Polymerase I and RNase H. After 3′-end adenylation, the cDNA fragments were ligated to adapters and then selectively enriched by PCR. The libraries were purified using the AMPure XP system. The quality of the sample libraries was assessed using the Agilent Bioanalyzer 2100 system. Finally, DGE sequencing was implemented using an Illumina HiSeq 2000 instrument.

Read mapping and expression quantification

Raw reads in fastq format were processed using in-house Perl scripts. The adapter, ploy-N, and low-quality sequences from raw reads were eliminated to obtain clean reads. Q score, GC content, and sequence duplication level were calculated to obtain high-quality clean reads, which were subsequently used for all the downstream analyses. The clean reads were mapped to the M. persicae genome (GenBank no. GCA_001856785.1), and the expression levels of the genes were calculated using fragments per kilobase per million reads (FPKM) values38.

Differentially expressed gene (DEG) analysis and annotation

Differential expression analysis was performed using DESeq39, and the Benjamini and Hochberg’s method was used to adjust the resulting P-values, to minimise the false detection rate (FDR). Genes were identified as differentially expressed (i.e. DEGs) if the adjusted P-value was <0.0540. The functional annotation and classification of the genes were performed using the GO database, and biological pathway annotations were obtained using the KEGG database.

Quantitative real-time PCR analysis

Quantitative real-time PCR (qRT-PCR) analysis was performed to validate the expression profiles of 10 randomly selected DEGs and three internal controls, namely the elongation factor 1α (EF1α), β-actin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes. The primers used in qRT-PCR are summarized in Table 2. qRT-PCR reactions were performed using a SYBR Premix DimerEraser Kit (Takara, Dalian, China) on an ABI 7500 system (ABI, CA, USA). All qRT-PCR experiments were performed in triplicate using independent samples. The expression levels were determined by the 2−ΔΔCt method41, using the geometric mean of three selected internal control genes for normalisation.

Table 2.

Primers used for qRT-PCR validation of differentially expressed genes.

Gene name Forward primer (5′-3′) Reverse primer (5′-3′) Gene description
LOC111034675 5’TGCGGGAGGTGTGAGAGCTG TCGCCGTTTTTCAATGTATCG maltase A3-like
LOC111036239 CGCGGTACATGAATTGCACAACTG ACGCAATGTCGAAGAACGGTATC aspartate aminotransferase, cytoplasmic-like
LOC111032872 CCGCGTGAGGATATGTGTTGAC ACGGCCAGAGGACACACGATG protein O-linked-mannose beta-1, 2-N-acetylglucosaminyltransferase 1-like
LOC111040357 GAGCCAAGAAAATGCAGATGAATAC TCCGCATGAATGAGACCCAAATC homeodomain-interacting protein kinase 2
LOC111028270 TCCCGGGTTTATCGTGGCAAG CCCAACAACATGAGCAACAAATAAC serine/threonine-protein kinase tousled-like 2
LOC111029398 CGCCCGATGCCATTAGTTCAAC TGGCATTCAAGTCATCTGTCTCATC NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11,mitochondrial
LOC111036096 GGCAGCATACAAACTCACTTACTTC AGGGCATTTTGGGCTTGATTG glutathione S-transferase-like
LOC111042314 GCCGCCGAACAGTCTGCAAAAC AGCGGCCAGGTAGGGTGAAG serine/arginine-rich splicing factor 8-like
LOC111037432 CGCCAAAACATCAACAATCAACAAG GGTTGGCGTGGTTGTTAAGATTTG GATA zinc finger domain-containing protein 14-like
LOC111039230 GCGACGACGTGACCGGTTACTAC TGGCGGCCTTAGCGACGATC larval cuticle protein A2B-like
EF1α CCGATGTCTATGTCTGCTAAGG CATGATTTGAGCCTCGCCAA
β-actin CGGTTCAAAAACCCAAACCAG TGGTGATGATTCCCGTGTTC
GAPDH GCGGTTTCGACGTGTCAGTTTG CCGGAGCCCACAATGCACAC

Supplementary information

Supplementary Table S3 (28.5KB, xls)
Supplementary Table S4 (29.5KB, xls)

Acknowledgements

This study was supported by the National Natural Sciences Foundation of China (grant nos 31460483 and 31401754).

Author Contributions

C.Y.Z. conceived and designed the experiment. J.Y.M. and X.J.C. conducted the experiments and analysed the results. J.Y.M. and C.Y.Z. wrote the paper. All authors reviewed the manuscript.

Data Availability

The RNA-Seq raw data were deposited in the NCBI Sequence Read Archive (SRA) with the accession number PRJNA558181.

Competing Interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information accompanies this paper at 10.1038/s41598-019-49922-3.

References

  • 1.Beckingham C, Phillips J, Gill M, Crossthwaite AJ. Investigating nicotinic acetylcholine receptor expression in neonicotinoid resistant Myzus persicae FRC. Pestic. Biochem. Physiol. 2013;107:293–298. doi: 10.1016/j.pestbp.2013.08.005. [DOI] [PubMed] [Google Scholar]
  • 2.Devonshire AL, et al. The evolution of insecticide resistance in the peach-potato aphid, Myzus persicae. Philos. Trans. R. Soc. B. 1998;353:1677–1684. doi: 10.1098/rstb.1998.0318. [DOI] [Google Scholar]
  • 3.Watson GB, et al. Novel nicotinic action of the sulfoximine insecticide sulfoxaflor. Insect Biochem. Mol. Biol. 2011;41:432–439. doi: 10.1016/j.ibmb.2011.01.009. [DOI] [PubMed] [Google Scholar]
  • 4.Bass C, et al. Mutation of a nicotinic acetylcholine receptor β subunit is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. BMC Neurosci. 2011;12:51. doi: 10.1186/1471-2202-12-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cui L, Qi HL, Yang DB, Yuan HZ, Rui CH. Cycloxaprid: A novel cis-nitromethylene neonicotinoid insecticide to control imidacloprid-resistant cotton aphid (Aphis gossypii) Pestic. Biochem. Physiol. 2016;132:96–101. doi: 10.1016/j.pestbp.2016.02.005. [DOI] [PubMed] [Google Scholar]
  • 6.Foster SP, Cox D, Oliphant L, Mitchinson S, Denholm I. Correlated responses to neonicotinoid insecticides in clones of the peach-potato aphid, Myzus persicae (Hemiptera: Aphididae) Pest Manag. Sci. 2008;64:1111–1114. doi: 10.1002/ps.1648. [DOI] [PubMed] [Google Scholar]
  • 7.Slater R, Paul VL, Andrews M, Garbay M, Camblin P. Identifying the presence of neonicotinoidresistant peach-potato aphid (Myzus persicae) in the peach-growing regions of southern France and northern Spain. Pest Manag. Sci. 2011;68:634–638. doi: 10.1002/ps.2307. [DOI] [PubMed] [Google Scholar]
  • 8.Meng JY, Zhang CY, Lu N, Shang SH. Resistance of Myzus persicae populations to imidacloprid in tobacco production areas in Guizhou province. Jiangsu Agric. Sci. 2015;43:162–164. [Google Scholar]
  • 9.Jin T, Zeng L, Lu YY, Xu YJ, Liang GW. Identification of resistance responsive proteins in larvae of Bactrocera dorsalis (Hendel), for pyrethroid toxicity by a proteomic approach. Pestic. Biochem. Physiol. 2010;96:1–7. doi: 10.1016/j.pestbp.2009.07.013. [DOI] [Google Scholar]
  • 10.Yang X, et al. Two cytochrome P450 genes are involved in imidacloprid resistance in field populations of the whitefly, Bemisia tabaci, in China. Pestic. Biochem. Physiol. 2013;107:343–350. doi: 10.1016/j.pestbp.2013.10.002. [DOI] [PubMed] [Google Scholar]
  • 11.Liu ZW, et al. A nicotinic acetylcholine receptor mutation conferring target-site resistance to imidacloprid in Nilaparvata lugens (brown planthopper) Proc. Natl. Acad. Sci. 2005;102:8420–8425. doi: 10.1073/pnas.0502901102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Markussen MD, Kristensen M. Low expression of nicotinic acetylcholine receptor subunit Mdα2 in neonicotinoid-resistant strains of Musca domestica L. Pest Manag. Sci. 2010;66:1257–1262. doi: 10.1002/ps.2007. [DOI] [PubMed] [Google Scholar]
  • 13.Puinean AM, et al. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. PLoS Genet. 2010;6:e1000999. doi: 10.1371/journal.pgen.1000999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Daborn PJ, et al. A single P450 allele associated with insecticide resistance in Drosophila. Science. 2002;297:2253–2256. doi: 10.1126/science.1074170. [DOI] [PubMed] [Google Scholar]
  • 15.Pan WL, Dang ZH, Gao ZL. Comparison of activities of detoxic enzymes in the imidacloprid-resistant and susceptible strains of the cotton aphid, Aphis gossypii. Acta Entomol. Sin. 2003;46:793–796. [Google Scholar]
  • 16.Cao CW, et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pestic. Biochem. Physiol. 2015;119:54–61. doi: 10.1016/j.pestbp.2015.02.005. [DOI] [PubMed] [Google Scholar]
  • 17.Pan YO, et al. Transcriptomic comparison of thiamethoxam-resistance adaptation in resistant and susceptible strains of Aphis gossypii Glover. Comp. Biochem. Phys. D. 2015;13:10–15. doi: 10.1016/j.cbd.2014.11.001. [DOI] [PubMed] [Google Scholar]
  • 18.Gao Y, et al. Transcriptome-based identification and characterization of genes commonly responding to five different insecticides in the diamondback moth, Plutella xylostella. Pestic. Biochem. Physiol. 2018;144:1–9. doi: 10.1016/j.pestbp.2017.11.007. [DOI] [PubMed] [Google Scholar]
  • 19.Dean M, Annilo T. Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annu. Rev. Genomics Hum. Genet. 2005;6:123–142. doi: 10.1146/annurev.genom.6.080604.162122. [DOI] [PubMed] [Google Scholar]
  • 20.Miller DS. Regulation of ABC transporters at the blood-brain barrier. Clin. Pharmacol. Ther. 2015;97:395–403. doi: 10.1002/cpt.64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Buss D, Callaghan A. Interaction of pesticides with p-glycoprotein and other ABC proteins: a survey of the possible importance to insecticide, herbicide and fungicide resistance. Pestic. Biochem. Physiol. 2008;90:141–153. doi: 10.1016/j.pestbp.2007.12.001. [DOI] [Google Scholar]
  • 22.Xiao Y, et al. Missplicing of the ABCC2 gene linked with Bt toxin resistance in Helicoverpa armigera. Sci. Rep. 2014;4:6184. doi: 10.1038/srep06184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dermauw W, Van Leeuwen T. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance. Insect Biochem. Mol. Biol. 2014;45:89–110. doi: 10.1016/j.ibmb.2013.11.001. [DOI] [PubMed] [Google Scholar]
  • 24.Gaddelapati SH, Kalsi M, Roy A, Palli SR. Cap ‘n’ collar C regulates genes responsible for imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata. Insect Biochem. Molec. 2018;99:54–62. doi: 10.1016/j.ibmb.2018.05.006. [DOI] [PubMed] [Google Scholar]
  • 25.Lei YY, et al. Midgut transcriptome response to a Cry toxin in the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) Gene. 2014;533:180–187. doi: 10.1016/j.gene.2013.09.091. [DOI] [PubMed] [Google Scholar]
  • 26.Friedman R. Genomic organization of the glutathione S-transferase family in insects. Mol. Phylogenet. Evol. 2011;61:924–932. doi: 10.1016/j.ympev.2011.08.027. [DOI] [PubMed] [Google Scholar]
  • 27.Pavlidi N, Vontas J, Leeuwen TV. The role of glutathione S-transferases (GSTs) in insecticide resistance in crop pests and disease vectors. Curr. Opin. Insect Sci. 2018;27:97–102. doi: 10.1016/j.cois.2018.04.007. [DOI] [PubMed] [Google Scholar]
  • 28.Li X, Schuler MA, Berenbaum MR. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007;52:231–253. doi: 10.1146/annurev.ento.51.110104.151104. [DOI] [PubMed] [Google Scholar]
  • 29.Han JB, Li GQ, Wan PJ, Zhu TT, Meng QW. Identification of glutathione S-transferase genes in Leptinotarsa decemlineata and their expression patterns under stress of three insecticides. Pestic. Biochem. Physiol. 2016;133:26–34. doi: 10.1016/j.pestbp.2016.03.008. [DOI] [PubMed] [Google Scholar]
  • 30.Bautista MA, et al. Evidence for trade-offs in detoxification and chemosensation gene signatures in Plutella xylostella. Pest Manag. Sci. 2015;71:423–432. doi: 10.1002/ps.3822. [DOI] [PubMed] [Google Scholar]
  • 31.Tetreau G, Stalinski R, David JP, Després L. Increase in larval gut proteolytic activities and Bti resistance in the Dengue fever mosquito. Arch. Insect Biochem. Physiol. 2013;8:71–83. doi: 10.1002/arch.21076. [DOI] [PubMed] [Google Scholar]
  • 32.Zhu YC, et al. Evidence of multiple/cross resistance to Bt and organophosphate insecticides in Puerto Rico population of the fall armyworm, Spodoptera frugiperda. Pestic. Biochem. Physiol. 2015;122:15–21. doi: 10.1016/j.pestbp.2015.01.007. [DOI] [PubMed] [Google Scholar]
  • 33.Oppert B, Kramer KJ, Beeman RW, Johnson D, McGaughey WH. Proteinase-mediated insect resistance to Bacillus thuringiensis toxins. J. Biol. Chem. 1997;272:23473–23476. doi: 10.1074/jbc.272.38.23473. [DOI] [PubMed] [Google Scholar]
  • 34.Blecha J, et al. Antioxidant defense in quiescent cells determines selectivity of electron transport chain inhibition-induced cell death. Free Radical Bio. Med. 2017;112:253–266. doi: 10.1016/j.freeradbiomed.2017.07.033. [DOI] [PubMed] [Google Scholar]
  • 35.Nauen R, Denholm I. Resistance of insect pests to neonicotinoid insecticides: Current status and future prospects. Arch. Insect Biochem. Physiol. 2005;58:200–215. doi: 10.1002/arch.20043. [DOI] [PubMed] [Google Scholar]
  • 36.Karunker I, et al. Over-expression of cytochrome P450 CYP6CM1 is associated with high resistance to imidacloprid in the B and Q biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae) Insect Biochem. Mol. Biol. 2008;38:634–644. doi: 10.1016/j.ibmb.2008.03.008. [DOI] [PubMed] [Google Scholar]
  • 37.Rufingier C, Pasteur N, Lagnel J, Martin C, Navajas M. Mechanisms of insecticide resistance in the aphid Nasonovia ribisnigri (Mosley) (Homoptera: Aphididae) from France. Insect Biochem. Mol. Biol. 1999;29:385–391. doi: 10.1016/S0965-1748(99)00014-4. [DOI] [PubMed] [Google Scholar]
  • 38.Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quantifying mammalian transcriptomes by RNA-seq. Nat. Methods. 2008;5:621–628. doi: 10.1038/nmeth.1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11:R106. doi: 10.1186/gb-2010-11-10-r106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tang WC, et al. Analysis of digital gene expression profiling in the gonad of male silkworms (Bombyx mori) under fluoride stress. Ecotox. Environ. Safe. 2018;153:127–134. doi: 10.1016/j.ecoenv.2018.01.028. [DOI] [PubMed] [Google Scholar]
  • 41.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C (T) method. Nature protocols. 2008;3:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table S3 (28.5KB, xls)
Supplementary Table S4 (29.5KB, xls)

Data Availability Statement

The RNA-Seq raw data were deposited in the NCBI Sequence Read Archive (SRA) with the accession number PRJNA558181.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES