Abstract
Quercus mongolica Fisch. ex Ledeb. (QM) has been used as an oriental traditional medicine to relieve hemorrhoids, fever, and enteritis. We screened the inhibitory activities of the extracts and compounds (1–6) isolated from QM on the production of inflammatory cytokines and chemokines to evaluate their anti-inflammatory activities. Further, we evaluated the expression levels of cytokines, chemokines, and immune factors on pedunculagin (PC, 1), which was selected from isolated compounds (1–6) because of its potential anti-inflammation effect. Additionally, we evaluated whether the inflammation mitigation effects of PC (1) following UVB exposure in keratinocytes occurred because of nuclear factor (NF)-κB and signal transducer and activator of transcription (STAT)/Janus kinase (JAK) activation. PC (1) remarkably suppressed interleukin (IL)-6, IL-10, IL-13, and monocyte chemoattractant protein-1 (MCP-1) mRNA expression and reduced the mRNA expression level of Cyclooxygenase-2 (COX-2) and also reduced the phosphorylation of p38 mitogen-activated protein kinases (p38), c-Jun N-terminal kinase (JNK), and extracellular signal-regulated kinase (ERK) in a concentration-dependent manner.
Keywords: Quercus mongolica Fisch. ex Ledeb., pedunculagin, skin inflammation disease
1. Introduction
Keratinocytes exposed to ultraviolet B (UVB) cause various inflammatory skin diseases, such as sunburn, psoriasis, and skin cancer [1,2]. Keratinocytes irradiated with UVB express and release inflammatory mediators in response to skin inflammation as well as pro-inflammatory cytokines during the progression phase of the inflammatory process, such as IL-6, IL-8, IL-10, and IL-13 [3,4,5]. Keratinocytes also release thymus and activation-regulated chemokine (TARC/CCL17) and macrophage-derived chemokine (MDC/CCL22), which is closely related to TARC [6]. TARC and MDC may play important roles in the development of chronic inflammation [7]. Further, UVB and pro-inflammatory mediators induce nuclear factor (NF)-κB activation, which is an important nuclear transcription factor that induces inflammation and immune activities [8,9,10]. Moreover, some mitogen-activated protein kinase (MAPK) pathways can also induce NF-κB activation, such as p38 and extracellular signal-regulated kinase (ERK) pathways, which are known to promote cell growth, proliferation, survival, and DNA damage [8,9,11]. Thus, keratinocytes play an important role in the pathogenesis of inflammatory skin diseases, like atopic dermatitis and psoriasis [12].
Quercus mongolica Fisch. ex Ledeb. (QM) is a species of deciduous oak native to Korea. QM exhibits anti-allergic, anti-microbial, and anti-oxidation activities and has been used to treat hemorrhoids, fever, and enteritis as an oriental traditional medicine [13,14,15,16]. Previous studies of the chemical composition of QM led to the isolation of various triterpenoid, tannins, flavonoids, and phenol glucoside gallates exhibiting a variety of bioactivities, including anti-oxidative, anti-tumor, and anti-fungal activities [17,18,19,20]. Previously, we isolated several phenolic compounds from QM, and evaluated its anti-photoaging activity [19].
In this study, to evaluate the anti-inflammatory activities of QM, we measured the inhibition of inflammatory chemokine (TARC and MDC) and cytokine (MCP-1, IL-6, IL-8, IL-10, and IL-13) production by extracts and compounds (1–6) isolated from QM. Further, we evaluated the expression of MCP-1, MDC, TARC, IL-6, IL-8, IL-10, and IL-13 and immune factors, such as COX-2, on PC (1) with potential regarding anti-inflammatory activities in keratinocytes irradiated with UVB. Additionally, we examined whether the inflammation mitigation effects of PC (1) on UVB exposure in keratinocytes were due to NF-κB and STAT/JAK activation.
2. Results
2.1. Phytochemicals from QM
In this study, the extracts of QM and compounds (1–6)—one ellagitannin [pedunculagin (PC, 1)], one gallotannin [(+)-gallocatechin (2)], one flavan-3-ol [(+)-catechin (3)], and three flavonoids [quercetin-3-O-(6″-O-galloyl)-β-d-glucopyranoside (QGG, 4), kaempferol-3-O-β-d-glucopyranoside-7-O-α-l-rhamnopyranoside (5), kaempferol-3-O-(6″-galloyl)-β-d-glucopyranoside (6)]—isolated previously [19] were used for evaluating its anti-inflammatory activities.
2.2. Inhibition of Chemokine and Cytokine Production
UVB irradiation causes inflammation by inducing the activation of various chemokines and cytokines, which are immune regulators produced by human keratinocyte cells. Keratinocytes (5 × 106 cells/mL) were treated with Lipopolysaccharides (LPS) for 30 min at 37 °C. Keratinocyte cytosolic and nuclear extracts were prepared as previously described [21]. To evaluate the effects of QM extracts and compounds on immune stimulation, we measured the expression levels of chemokines and cytokines. The ethyl acetate (EtOAc) layer showed the strongest activity compared to the other fractions (Table 1). Compound 1, which was isolated from the EtOAc layer, was the most effective inhibitor of inflammatory cytokines and chemokines (Table 2).
Table 1.
Inhibition of chemokine and cytokine production by QM extracts and fractions.
Chemokine and Cytokine | QM Extract | n-Hexane Layer | EtOAc Layer | H2O Layer |
---|---|---|---|---|
IC50 (μg/mL) | ||||
MCP-1 | 32.9 ± 2.7 b | <100 | 17.0 ± 1.5 a | 36.3 ± 0.4 b |
TARC | 36.0 ± 1.7 b | <100 | 16.1 ± 0.8 a | 49.9 ± 0.7 b |
IL-6 | 37.1 ± 0.9 b | <100 | 25.0 ± 1.1 a | 56.3 ± 2.1 c |
IL-8 | 27.4 ± 1.1 b | <100 | 20.5 ± 1.9 a | 45.5 ± 1.5 b |
IL-10 | 15.8 ± 1.3 a | <100 | 9.3 ± 2.2 a | 55.6 ± 2.3 b |
IL-13 | 21.1 ± 2.2 a | <100 | 5.8 ± 0.4 a | 65.0 ± 1.7 b |
Values represent the means ± S.D. of three determinations. Values with different superscripts in the same columns are significantly different (p < 0.05).
Table 2.
Inhibition of chemokine and cytokine production by compounds 1–6.
Chemokine and Cytokine | 1 | 2 | 3 | 4 | 5 | 6 |
---|---|---|---|---|---|---|
IC50 (μM) | ||||||
MCP-1 | 8.5 ± 2.3 a | 78.7 ± 1.1 d | 74.2 ± 5.5 b | 13.7 ± 4.1 ab | <100 | 15.2 ± 1.1 ab |
TARC | 6.9 ± 0.4 a | 42.6 ± 1.9 c | 20.7 ± 2.2 b | 11.2 ± 1.5 ab | 42.5 ± 2.5 c | 16.2 ± 1.5 ab |
IL-6 | 16.4 ± 2.1 ab | 39.0 ± 2.2 bc | 36.3 ± 3.1 b | 14.5 ± 1.7 a | 37.8 ± 2.6 bc | 16.6 ± 0.8 a |
IL-8 | 16.5 ± 1.3 b | 26.4 ± 0.9 c | 40.1 ± 1.5 d | 18.5 ± 0.3 b | 3.1 ± 1.2 a | 25.8 ± 0.7 c |
IL-10 | 5.4 ± 0.6 a | 8.9 ± 1.1 a | 15.7 ± 4.3 bc | 7.3 ± 0.6 a | 13.6 ± 1.5 b | 15.6 ± 2.3 b |
IL-13 | 16.1 ± 1.4 a | 40.4 ± 2.6 c | 44.8 ± 2.2 c | 26.2 ± 0.5 b | 32.6 ± 0.5 bc | 28.1 ± 0.9 b |
Values represent the means ± S.D. of three determinations. Values with different superscripts in the same columns are significantly different (p < 0.05).
2.3. mRNA Expression of Chemokines and Cytokines
Subsequent experiments were conducted to evaluate cytokine and chemokine mRNA levels following treatment with PC (1), which showed the best inhibitory activities on inflammatory chemokine and cytokine among the compounds (1–6). PC (1) showed potent inhibitory activities on the expression of chemokines and cytokines, including TARC and MDC, and IL-6, 8, 10, 13, and MCP-1 (Figure 1 and Figure 2). In particular, PC (1) dose-dependently suppressed IL-6, IL-10, and IL-13 mRNA expression. Further, at a dose of 20 μM, PC (1) significantly inhibited IL-8, IL-10, and IL-13. At the mRNA level, PC (1) dose-dependently inhibited UVB-induced MCP-1 (Figure 2).
Figure 1.
Effect of PC (1)-treated HaCaT cells on MDC and TARC expression. HaCaT cells were pre-treated with different concentrations of PC (1) (5, 10, 20 μM) for 1 h. The cells were further stimulated with 40 mJ/cm2 UVB. After 6 h, the cells were harvested, and relative mRNA levels were determined. Histograms show the densitometric data for TARC and MDC mRNA normalized to the level of GAPDH. Each value represents the mean ± SD of three individual experiments. Nor: Non-treated cell group (0 h), Cont: 40 mJ/cm2 UVB-treated cell group. Data are expressed as the means ± S.D., n = 3. * p < 0.001 and ** p < 0.0001 compared to the control group.
Figure 2.
Effect of PC (1) treatment on cytokine mRNA expression in HaCaT cells. HaCaT cells were treated with different concentrations of PC (1) (5, 10, 20 μM) for 1 h. The cells were further stimulated with 40 mJ/cm2 UVB. After 6 h, the cells were harvested, and relative mRNA levels were determined. Histograms show the densitometric data for TARC and MDC mRNA normalized to GAPDH. Each value represents the mean ± SD of three individual experiments. Nor: Non-treated cell group (0 h), Cont: 40 mJ/cm2 UVB treatment cell group. Data are expressed as the means ± S.D., n = 3. * p < 0.001 and ** p < 0.0001 compared to the control group.
2.4. mRNA Expression of COX-2
In unstimulated HaCaT cells, COX-2 mRNA expression was nearly undetectable. In contrast, UVB-irradiated HaCaT cells showed drastically increased COX-2 mRNA expression levels. The addition of exogenous PC (1) significantly reduced UVB-irradiated COX-2 mRNA expression (Figure 3).
Figure 3.
Effect of PC (1) treatment on COX-2 mRNA expression in HaCaT cells. HaCaT cells were treated with different concentrations of PC (1) for 1 h. The cells were further stimulated with 40 mJ/cm2 UVB. After 24 h, the cells were harvested, and relative mRNA levels were determined. Histograms show the densitometric data of COX-2 mRNA normalized to GAPDH. Each value represents the mean ± SD of three individual experiments. Nor: Non-treated cell group (0 h), Cont: 40 mJ/cm2 UVB-treated cell group. Data are expressed as the means ± S.D., n = 3. ** p < 0.0001 compared to the control group.
2.5. Inhibitory Activity on Phosphorylation of p38/JNK/ERK/IκB and Signaling Pathways Activating STAT/JAK and NF-κB
We investigated whether PC (1) influences UVB-irradiated HaCaT cells by western blotting. Cells were stimulated with UVB for 5 to 30 min, after which the levels of p38/JNK/ERK phosphorylation were determined. The results revealed that 20 μM PC (1) inhibited p38, JNK, and ERK expression and the phosphorylation of IκBα (Figure 4).
Figure 4.
Effect of PC (1) treatment on MAPK expression in HaCaT cells. HaCaT cells were pre-treated different concentrations of PC (1) (5, 10, 20 μM) for 1 h. The cells were further stimulated with 40 mJ/cm2 UVB. After 6 h, the cells were harvested, and the relative protein levels were determined. Histograms show the densitometric data of p-p38, p-JNK, p-ERK, and p-IκB protein normalized to GAPDH. Each value represents the mean ± SD of three individual experiments. Nor: Non-treated cell group (0 h), Cont: 40 mJ/cm2 UVB-treated cell group. Data are expressed as the means ± S.D., n = 3. * p < 0.001 and ** p < 0.0001 compared to the control group.
Further, we investigated the effect of PC (1) on UVB-irradiated NF-κB translocation and STAT1 phosphorylation. PC (1) dose-dependently inhibited the translocation of NF-κB from the cytoplasm to the nucleus (Figure 5A). PC (1) showed stronger inhibitory activities than the group treated with UVB irradiation alone, a potent pharmacological inhibitor of NF-κB translocation into the nucleus. This approach has been suggested as an indirect method for controlling inflammation-related disease. Finally, PC (1) dose-dependently decreased the expression of p-STAT1 (Figure 5B).
Figure 5.
Effect of PC (1) treatment on STAT and NF-κB protein expression in HaCaT cells. HaCaT cells were pre-treated with different concentrations of PC (1) (5, 10, 20 μM) for 1 h. The cells were further stimulated with 40 mJ/cm2 UVB light. After 6 h, the cells were harvested, and relative protein levels were determined. Histograms show the densitometric data of STAT and NF-κB protein normalized to GAPDH. Each value represents the mean ± SD of three individual experiments. Nor: Non-treated cell group (0 h), Cont: 40 J/cm2 UVB-treated cell group. A: STAT and NF-κB protein levels, B: NF-κB-FITC, DAPI, Rhodamine and Overlay expression. Data are expressed as the means ± S.D., n = 3. ** p < 0.0001 compared to the control group.
2.6. Cell Migration
The effects of PC (1) on the migration ability of HaCaT cells were evaluated in a wound healing assay. HaCaT cells uniformly grown as a monolayer were scratched, and all cells in the solid line were removed. As a result, control group cells showed some migration ability, while the group treated with PC (1) showed dose-dependent increases in migration capacities. Particularly, the cell migration capacity following treatment with 20 μM PC (1) was increased (Figure 6).
Figure 6.
Increased cell proliferation and migration activities of PC (1)-treated HaCaT cells. HaCaT cells were scratched with a yellow tip. Migration levels of HaCaT cells were observed using an optical microscope and photographs were obtained. HaCaT cells were treated with different concentrations of PC (1) (5, 10, 20 μM) for 24 h. PC (1) treatment led to an increase in the migration of HaCaT cells. Nor: Non-treated cell group (0 h), Cont: 40 mJ/cm2 UVB-treated cell group.
3. Discussion
Inflammatory diseases are manifested by a deregulated skin barrier function and a disruption of the Th2/Th1 immune balance [22,23]. Crosstalk between immune and genetic factors is involved in inflammation-related diseases, such as atopic and contact dermatitis, a particularly difficult condition to treat. Among environmental factors, UV light induces inflammatory reactions characterized by increases of many chemokines and cytokines. We therefore examined the effect of PC (1) on Th2 immune modulation. PC (1) effectively suppressed increased Th2 activation as determined from its inhibitory effect on UVB-irradiated production of TARC and MDC. TARC and MDC, members of the chemokine subfamily, are expressed by keratinocytes. These selectively control the refection and migration of Th2 lymphocytes to inflammatory sites and are considered as major factors in the pathogenesis of inflammatory disease, such as atopic dermatitis [7,24]. Other cytokines function as signaling peptides to regulate the cell cycle and control tissue-specific cell homing. In the skin, chemokines are secreted by resident cells. Chemokines and cytokines participate in the induction and maintenance of inflammation in the skin [25]. Moreover, inflammatory diseases are characterized by an enhanced production of MCP-1, a member of the CC-chemokine family. MCP-1 directs the production of leukocytes to the inflammatory focus [26]. These results demonstrate the potential use of PC (1) to treat skin inflammatory diseases.
UVB light induces the generation of reactive oxygen species (ROS), which play a key role in enhancing inflammation by activating the NF-κB and activator protein-1 transcription factors and increasing COX-2 expression in various inflammatory diseases [27,28]. Therefore, the effect of PC (1) on the expression of COX-2 mRNA was also evaluated to determine the anti-inflammatory activity of the treatments. The potent inhibitory activity of COX-2 mRNA expression on PC (1) strongly suggest that PC (1) plays an anti-inflammatory role in keratinocytes.
MAPKs are known for directing intracellular response signaling pathways to various stimuli, such as mitogens, and creating an inflammatory response to regulate mitosis, cellular differentiation, cell survival, and inflammation stress [29,30,31,32]. The stimulations could induce target gene expression by activation p38, JNK, and ERK transcription factors. p38 kinases are responsive to stimuli to regulate an inflammation response, such as IL-6 and IL-8 production and the expression of nitric oxide and metalloproteinase [33]. c-Jun N-terminal kinases (JNKs) phosphorylate c-Jun and increase activator protein-1 to regulate the inflammatory response [34]. The MAPK/ERK pathway, also known as the Ras-Raf-MEK-ERK pathway, communicates a signal from a cell surface receptor to the cell nucleus DNA, such as translocation of NF-κB to express inflammation genes [35]. In addition, it has been reported that various chronic inflammation skin diseases, such as atopic dermatitis, are induced by activation and expression of pro-inflammatory cytokines through NF-κB and JAK/STAT signaling pathways [36,37,38]. All these factors are closely associated with chemokine and cytokine production in UVB-irradiated HaCaT cells. Therefore, the anti-inflammatory effect of PC (1) by controlling the expression of inflammatory factors through p38, JNK, and ERK demonstrates that PC (1) activates molecular events that block the translocation of NF-κB and activation of STAT1.
Various cytokines and growth factors produced in keratinocytes maintain the homeostasis of the skin and are involved in immune and inflammatory reactions and cell proliferation [39]. When inflammation responses are induced by inflammatory mediators, cells were recruited and activated to the inflamed site [40]. This result supports that PC (1) improves anti-inflammation by increasing the cell migration ability of keratinocytes.
4. Materials and Methods
4.1. Plant Material
The leaves of QM were collected from the Korea National Arboretum in Pocheon, Gyeong-gi, Republic of Korea in October 2011. The plant was identified by Dr. Sung-Sik Kim (Korea National Arboretum). A voucher specimen (QM 2011-10) has been deposited at the herbarium of the College of Pharmacy, Chung-Ang University.
4.2. Extract Preparation and Compound Identification
QM extract preparation and compound identification has been described previously [19]. The air-dried QM leaves (4.2 kg) were extracted with 80% acetone to yield QM extract (400 g), and were partitioned into n-hexane fraction (22.7 g), EtOAc fraction (35.5 g), and water fraction (240 g). The EtOAc fraction was further fractionated by column chromatography to afford five subfractions, Fr.1 (4.8 g), Fr.2 (5.4 g), Fr.3 (7.9 g), Fr.4 (8.1 g), and Fr.5 (5.3 g). Fr.1 was further chromatographed over a Sephadex LH-20 and ODS column to yield pedunculagin (1, 470 mg) and (−)-epigallocatechin (2, 105 mg). Fr.2 was chromatographed over Sephadex LH-20 and ODS to yield (+)-catechin (3, 59 mg) and quercetin 3-O-(6″-O-galloyl)-β-d-glucopyranoside (4, 56 mg). Similarly, Fr.3 was chromatographed over ODS to yield kaempferol-3-O-β-d-glucopyranoside-7-O-α-l-rhamnopyranoside (5, 98 mg). Fr.4 was chromatographed over ODS to yield kaempferol 3-O-(6″-galloyl)-β-d-glucopyranoside (6, 378 mg). The structures of the compounds (1–6) were identified by analysis of 1H and 13C NMR spectra and comparison with references (Figures S1–S9). These fractions, compounds, and QM extract were used to study the anti-inflammatory activity on UV-B irradiated human skin cells, presently.
4.3. General Experimental Procedure
Dulbecco’s modified Eagle medium (DMEM), fetal bovine serum, and streptomycin-penicillin were purchased from Gibco (Grand Island, NY, USA). Recombinant human IL-6, IL-8, IL-10, IL-13, and macrophage-derived chemokine (MDC) and TARC Quantikine ELISA kits were purchased from R&D Systems (Minneapolis, MN, USA). The nuclear and cytoplasmic extraction reagents and first-strand cDNA synthesis kit were purchased from Thermo Scientific (Waltham, MA, USA). The primary antibodies for p38, c-Jun N-terminal kinase (JNK), and ERK were purchased form Abcam (Cambridge, UK). Antibodies against NF-κB, inhibitory kappa B alpha (IκBα), phosphorylated IκBα, phosphorylated signal transducer and activator of transcription 1 (p-STAT-1), and signal transducer and activator of transcription 1 (STAT-1) were purchased from Cell Signaling Technology (Danvers, MA, USA). PVDF membrane, TEMED, SDS, and acrylamide were purchased from Bio-Rad (Hercules, CA, USA).
4.4. Cell Culture
Immortalized human keratinocytes (HaCaT) were purchased from the American Type Culture collection (Manassas, VA, USA). The cells were were grown at 37 °C in a 5% CO2 humidified atmosphere in high-glucose DMEM containing 10% fetal bovine serum and 1% streptomycin/penicillin.
4.5. Immunoassays for Cytokines and Chemokines
Keratinocytes (1 × 105 cells/300 μL for the cytokine assay or 5 × 105 cells/400 μL for the chemokine assay) were grown in a 24-well plate and treated with 1 μg/mL LPS and samples for 24 h. After centrifugation at 412× g for 10 min, IL-6, IL-8, IL-10, IL-13, TARC, and MCP-1 levels in the culture supernatant was analyzed using the ELISA kits and the absorbance was measured at 450 nm using a microplate reader (Tecan, Ltd., Salzburg, Austria).
4.6. Total RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
After treatment of the samples, total RNA was extracted using TRIzol Reagent (Molecular Research Centre, Ohio, USA). Briefly, 2 µg total RNA was reverse transcribed into cDNA using a first strand cDNA synthesis kit (Fermentas, Waltham, MA, USA). The cDNA was used as a template for PCR amplification; 28 cycles of PCR were carried out using a DNA engine gradient cycler (MJ Research, Inc., Waltham, MA, USA). This was followed by denaturation for 30 s at 95 °C, annealing at 55 to 60 °C for 1 min, and extension at 72 °C for 30 s. GAPDH was used as an internal control. The sequences of the PCR primers used are shown below (Table 3).
Table 3.
PCR primer used in this experiment.
Gene | Sense | Antisense |
---|---|---|
MDC | GCATGGCTCGCCTACAGACT | GCAGGGAGGGAGGCAGAGGA |
TARC | ATGGCCCCACTGAAGATGCT | TGAACACCAACGGTGGAGGT |
IL-6 | ATGAACTCCTTCTCCACAAGC | GTTTTCTGCCAGTGCCTCTTTG |
IL-8 | ATGACTTCCAAGCTGGCCGTGGCT | TCTCAGCCCTCTTCAAAAACTTCT |
IL-10 | GCCTAACATGCTTCGAGATC | CTCATGGCTTTGTAGATGCC |
IL-13 | TGAGGAGCTGGTCAACATCA | CAGGTTGATGCTCCATACCAT |
MCP-1 | ACTGAAGCTCGTACTCTC | CTTGGGTTGTGGAGTGAG |
COX-2 | CTGGCACCCAGCACAATGAAG | ACCGACTGCTGTCACCTTCA |
4.7. Preparation of Cytosolic and Nuclear Extracts
After treatment of the samples, keratinocytes were harvested by centrifugation at 412× g for 10 min and washed twice with phosphate-buffered saline (PBS). The cells were suspended in 400 μL lysis buffer (10 μM KCl, 1.5 μM MgCl2, 0.1 μM EDTA, 0.1 μM EGTA, 1 μM dithiothreitol, 0.5 μM PMSF, 1 μM sodium orthovanadate, 2 μg/mL aprotinin, 2 μg/mL leupeptin, and 10 mM Hepes-KOH, pH 7.8) and were allowed to swell on ice for 15 min. Next, 25 μL of a 10% Nonidet NP-40 solution (final concentration approximately 0.6%) was added, and the tubes were vigorously vortexed for 10 s. The homogenates were centrifuged at 12,000× g for 10 min at 4 °C. The supernatants were stored as cytoplasmic extracts at −70 °C. The nuclear pellets were resuspended in 50 μL of ice-cold hypertonic solution containing 5% glycerol and 0.4 M NaCl lysis buffer. The tubes were incubated on ice for 30 min and then centrifuged at 12,000× g for 15 min at 4 °C. The supernatants were collected as the nuclear extracts and stored at −70 °C. Protein concentrations were determined using the Bradford method according to the manufacturer’s instructions (Bio-Rad Laboratories, Hercules, CA, USA).
4.8. Western Blot Assay
After treatment of the samples, the cells were washed with ice-cold PBS, and treated with homogenizing buffer (Roche Diagnostics, Basel, Switzerland) and protease inhibitor (Roche Diagnostics, Indianapolis, IN). Cell lysates were centrifuged at 13,475× g for 10 min and the supernatants were collected. Protein concentrations were determined by using Bradford protein assay reagent (Bio-Rad Laboratories); 20 µg of protein was loaded and separated on a 7.0% to 10% SDS gel and then transferred onto a PVDF membrane, which was probed with specific primary antibodies overnight, and incubated with secondary antibodies for 1 hour at room temperature. Western blots were developed by enhanced chemiluminescence (Amersham Biosciences, Buckinghamshire, UK) and quantified using a Gel-pro analyzer (Media Cybernetics, Inc., Rockville, MD, USA).
4.9. Immunofluorescence
Cells were aliquoted in an 8-well Lab-Tek chamber (Nalge-Nunc, enfield, NY, USA) with 1 × 103 cells and grown for 24 h after samples were treated. The cells were washed with ice-cold PBS, after which 95% Triton X-100 was added and incubated for 10 min. After washing, 1% of bovine serum albumin was added and incubated for 1 hour and the NF-κB primary antibody (1:100) was added and incubated at 4 °C overnight. The secondary antibody was Alexa 488-conjugated goat anti-mouse IgG (Invitrogen, Carlsbad, CA, USA) (fluorescein isothiocyanate) (1:1000). Stained cells were mounted on slides after washing with PBS and observed by fluorescent microscopy to determine NF-κB activity.
4.10. Cell Migration Assay
Cell migration was measured in a scratch wound assay. HaCaT cells were seeded at a density of 5 × 105 cells in a 12-well plate and cultured to >90% confluence. The cells were pre-treated for 1 h and then exposed to 40 mJ/cm2 of UVB radiation and scratched using a 200-μL micropipette tip. After treating samples for 24 h, images of the scratch wound were acquired using a phase contrast microscope.
4.11. Statistical Analysis
Analysis of variance was performed using SPSS software (SPSS, Inc., Chicago, IL, USA). All data are expressed as the mean ± SD, and statistically significant differences between experimental group and control group values were analyzed by one-way analysis of variance followed by the t-test. * A p-value < 0.001 and ** p-value < 0.0001 were considered statistically significant.
5. Conclusions
QM and the isolated compounds (1–6) showed inhibitory activities towards inflammatory cytokines and chemokines. The EtOAc fraction of QM and PC (1) among the isolated compounds (1–6) showed potent activities against MCP-1, TARC, IL-6, IL-8, IL-10, and IL-13 in keratinocytes irradiated with UVB.
PC (1) relieved inflammation by enhancing the regeneration of keratinocytes exposed to UVB. PC (1) also inhibited chemokine and cytokine overexpression induced by UV irradiation in keratinocytes in a concentration-dependent manner. Additionally, we examined whether the result of inflammation relaxation of PC (1) occurred because of the activity of NF-κB and STAT/JAK in UVB-irradiated keratinocytes. PC (1) not only reduced p38, JNK, and ERK phosphorylation in a concentration-dependent manner but also reduced the expression of NF-κB and STAT1, indicating that PC (1) inhibits the production of chronic inflammatory disease factors induced by UVB irradiation. These results suggest that 1 and QM can be further developed to treat chronic inflammatory skin diseases, like atopic dermatitis and psoriasis.
Acknowledgments
This study was carried out with the support of the ‘R&D Program for Forest Science Technology (Project No. 2017037B10-1819-BA01)’ provided by the Korea Forest Service (Korea Forestry Promotion Institute).
Abbreviations
QM | Quercus mongolica Fisch. ex Ledeb. |
PC | Pedunculagin |
NF-κB | Nuclear factor-κB |
STAT | Signal transducer and activator of transcription |
JAK | Janus kinase |
COX-2 | Cyclooxygenase-2 |
P38 | p38 mitogen-activated protein kinases |
IL | Interleukin |
MCP-1 | Monocyte chemoattractant protein-1 |
JNK | c-Jun N-terminal kinase |
ERK | Extracellular signal-regulated kinase |
UVB | Ultraviolet B |
TARC | Thymus and activation-regulated chemokine |
MDC | Macrophage-derived chemokine |
MAPK | Mitogen-activated protein kinase |
DMEM | Dulbecco’s modified Eagle medium |
HaCaT | Human keratinocytes |
RT-PCR | Reverse transcription-polymerase chain reaction |
PBS | Phosphate-buffered saline |
LPS | Lipopolysaccharides |
EtOAc | Ethyl acetate |
Supplementary Materials
The following are available online at https://www.mdpi.com/1420-3049/24/17/3094/s1, Figure S1: 1H-NMR spectrum of 1 (300 MHz, Acetone-d6); Figure S2: 1H-NMR spectrum of 2 (300 MHz, DMSO-d6); Figure S3: 1H-NMR spectrum of 3 (300 MHz, MeOH-d4); Figure S4: 1H-NMR spectrum of 4 (300 MHz, MeOH-d4); Figure S5: 13C-NMR spectrum of 4 (75 MHz, MeOH-d4); Figure S6: 1H-NMR spectrum of 5 (300 MHz, MeOH-d4); Figure S7: 13C-NMR spectrum of 5 (75 MHz, MeOH-d4); Figure S8: 1H-NMR spectrum of 6 (300 MHz, DMSO-d6); Figure S9: 13C-NMR spectrum of 6 (75 MHz, DMSO-d6).
Author Contributions
Conceptualization, H.H.K. and M.W.L.; methodology, H.H.K., D.H.K.; software, H.H.K., D.H.K.; resources, M.W.L., H.H.K.; writing—original draft preparation, H.H.K., I.H.H. and J.Y.; writing—review and editing, M.W.L., J.Y.; project administration, M.W.L.; funding acquisition, M.W.L.
Funding
This research was funded by ‘R&D Program for Forest Science Technology (Project No. 2017037B10-1819-BA01)’ provided by the Korea Forest Service (Korea Forestry Promotion Institute).
Conflicts of Interest
The authors declare that there is no conflict of interest regarding the publication of this paper.
Footnotes
Sample Availability: Not available.
References
- 1.Buckman S.Y., Gresham A., Hale P., Hruza G., Anast J., Masferrer J., Pentland A.P. COX-2 expression is induced by UVB exposure in human skin: Implications for the development of skin cancer. Carcinogenesis. 1998;19:723–729. doi: 10.1093/carcin/19.5.723. [DOI] [PubMed] [Google Scholar]
- 2.Yoshizumi M., Nakamura T., Kato M., Ishioka T., Kozawa K., Wakamatsu K., Kimura H. Release of cytokines/chemokines and cell death in UVB-irradiated human keratinocytes, HaCaT. Cell Biol. Int. 2008;32:1405–1411. doi: 10.1016/j.cellbi.2008.08.011. [DOI] [PubMed] [Google Scholar]
- 3.Miodovnik M., Koren R., Ziv E., Ravid A. The inflammatory response of keratinocytes and its modulation by vitamin D: The role of MAPK signaling pathways. J. Cell. Physiol. 2012;227:2175–2183. doi: 10.1002/jcp.22951. [DOI] [PubMed] [Google Scholar]
- 4.Ashida M., Bito T., Budiyanto A., Ichihashi M., Ueda M. Involvement of EGF receptor activation in the induction of cyclooxygenase-2 in HaCaT keratinocytes after UVB. Exp. Dermatol. 2003;12:445–452. doi: 10.1034/j.1600-0625.2003.00101.x. [DOI] [PubMed] [Google Scholar]
- 5.Wilmer J.L., Luster M.I. Chemical induction of interleukin-8, a proinflammatory chemokine, in human epidermal keratinocyte cultures and its relation to cytogenetic toxicity. Cell Biol. Toxicol. 1995;11:37–50. doi: 10.1007/BF00769991. [DOI] [PubMed] [Google Scholar]
- 6.Vestergaard C., Yoneyama H., Murai M., Nakamura K., Tamaki K., Terashima Y., Imai T., Yoshie O., Irimura T., Mizutani H., et al. Overproduction of Th2-specific chemokines in NC/Nga mice exhibiting atopic dermatitis—Like lesions. J. Clin. Investig. 1999;104:1097–1105. doi: 10.1172/JCI7613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shimada Y., Takehara K., Sato S. Both Th2 and Th1 chemokines (TARC/CCL17, MDC/CCL22, and Mig/CXCL9) are elevated in sera from patients with atopic dermatitis. J. Dermatol. Sci. 2004;34:201–208. doi: 10.1016/j.jdermsci.2004.01.001. [DOI] [PubMed] [Google Scholar]
- 8.Raport C.J., Gosling J., Schweickart V.L., Gray P.W., Charo I.F. Molecular Cloning and Functional Characterization of a Novel CC Chemokine, Stimulated T Cell Chemotactic Protein (STCP-1) That Specifically Acts on Activated T Lymphocytes. J. Biol. Chem. 1997;272:25229–25237. doi: 10.1074/jbc.272.40.25229. [DOI] [PubMed] [Google Scholar]
- 9.Henkel T., Machleidt T., Alkalay I., Krönke M., Ben-Neriah Y., Baeuerle P.A. Rapid proteolysis of IκB-α is necessary for activation of transcription factor NF-κB. Nature. 1993;365:182–185. doi: 10.1038/365182a0. [DOI] [PubMed] [Google Scholar]
- 10.Das J., Ghosh J., Manna P., Sil P.C. Taurine suppresses doxorubicin-triggered oxidative stress and cardiac apoptosis in rat via up-regulation of PI3-K/Akt and inhibition of p53, p38-JNK. Biochem. Pharmacol. 2011;81:891–909. doi: 10.1016/j.bcp.2011.01.008. [DOI] [PubMed] [Google Scholar]
- 11.Xia Z., Dickens M., Raingeaud J., Davis R.J., Greenberg M.E. Opposing Effects of ERK and JNK-p38 MAP Kinases on Apoptosis. Science. 1995;270:1326–1331. doi: 10.1126/science.270.5240.1326. [DOI] [PubMed] [Google Scholar]
- 12.Albanesi C., De Pità O., Girolomoni G. Resident skin cells in psoriasis: A special look at the pathogenetic functions of keratinocytes. Clin. Dermatol. 2007;25:581–588. doi: 10.1016/j.clindermatol.2007.08.013. [DOI] [PubMed] [Google Scholar]
- 13.Bak J.P., Kim J.B., Park J.H., Yang Y.J., Kim I.S., Choung E.S., Kang S.C. Screening and compound isolation from natural plants for anti-allergic activity. J. Korean Soc. Appl. Biol. Chem. 2011;54:367–375. doi: 10.3839/jksabc.2011.058. [DOI] [Google Scholar]
- 14.Yeo H.-D., Lee H.-C., Kug Lim B., Kyu Kim H., Suk Choi M., Yang J.-K. Antifungal Activity of the Quercus Mongolica Extracts against Botrytis cinerea. J. Korean Wood Sci. Technol. 2008;36:88–101. [Google Scholar]
- 15.Kong Y.J., Kang T.S., Lee M.K., Park B.K., Oh D.H. Antimicrobial and Antioxidative Activities of Solvent Fractions of Quercus mongolica Leaf. Korean Soc. Food Sci. Nutr. 2001;30:338–343. [Google Scholar]
- 16.Kim C., Shin M., Ahn D. The Encyclopedia of Oriental Herbal Medicine. Jungdam; Seoul, Korea: 1998. [Google Scholar]
- 17.Ishimaru K., Nonaka G.-I., Nishioka I. Phenolic glucoside gallates from quercus mongolica and q. acutissima. Phytochemistry. 1987;26:1147–1152. doi: 10.1016/S0031-9422(00)82367-5. [DOI] [Google Scholar]
- 18.Omar M., Matsuo Y., Maeda H., Saito Y., Tanaka T. New ellagitannin and galloyl esters of phenolic glycosides from sapwood of Quercus mongolica var. crispula (Japanese oak) Phytochem. Lett. 2013;6:486–490. doi: 10.1016/j.phytol.2013.06.004. [DOI] [Google Scholar]
- 19.Kim H.H., Kim D.H., Oh M.H., Park K.J., Heo J.H., Lee M.W. Inhibition of matrix metalloproteinase-1 and type-I procollagen expression by phenolic compounds isolated from the leaves of Quercus mongolica in ultraviolet-irradiated human fibroblast cells. Arch. Pharm. Res. 2015;38:11–17. doi: 10.1007/s12272-014-0329-1. [DOI] [PubMed] [Google Scholar]
- 20.Yuan J., Sun Q. Chemical constituents of Quercus mongolica Fisch. China J. Chin. Mater. Med. 1998;23:548–549, 576. [PubMed] [Google Scholar]
- 21.Schreiber E., Matthias P., Müller M.M., Schaffner W. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res. 1989;17:6419. doi: 10.1093/nar/17.15.6419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kim B.E., Leung D.Y.M., Boguniewicz M., Howell M.D. Loricrin and involucrin expression is down-regulated by Th2 cytokines through STAT-6. Clin. Immunol. 2008;126:332–337. doi: 10.1016/j.clim.2007.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Howell M.D., Fairchild H.R., Kim B.E., Bin L., Boguniewicz M., Redzic J.S., Hansen K.C., Leung D.Y.M. Th2 Cytokines Act on S100/A11 to Downregulate Keratinocyte Differentiation. J. Investig. Dermatol. 2008;128:2248–2258. doi: 10.1038/jid.2008.74. [DOI] [PubMed] [Google Scholar]
- 24.Jahnz-Rozyk K., Targowski T., Paluchowska E., Owczarek W., Kucharczyk A. Serum thymus and activation-regulated chemokine, macrophage-derived chemokine and eotaxin as markers of severity of atopic dermatitis. Allergy. 2005;60:685–688. doi: 10.1111/j.1398-9995.2005.00774.x. [DOI] [PubMed] [Google Scholar]
- 25.Nedoszytko B., Sokołowska-Wojdyło M., Ruckemann-Dziurdzińska K., Roszkiewicz J., Nowicki R.J. Chemokines and cytokines network in the pathogenesis of the inflammatory skin diseases: Atopic dermatitis, psoriasis and skin mastocytosis. Postep. Dermatol. Alergol. 2014;31:84–91. doi: 10.5114/pdia.2014.40920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kaburagi Y., Shimada Y., Nagaoka T., Hasegawa M., Takehara K., Sato S. Enhanced production of CC-chemokines (RANTES, MCP-1, MIP-1α, MIP-1β, and eotaxin) in patients with atopic dermatitis. Arch. Dermatol. Res. 2001;293:350–355. doi: 10.1007/s004030100230. [DOI] [PubMed] [Google Scholar]
- 27.Kim H.-J., Kim K.-W., Yu B.-P., Chung H.-Y. The effect of age on cyclooxygenase-2 gene expression: NF-κB activation and IκBα degradation. Free Radic. Biol. Med. 2000;28:683–692. doi: 10.1016/S0891-5849(99)00274-9. [DOI] [PubMed] [Google Scholar]
- 28.Surh Y.-J., Chun K.-S., Cha H.-H., Han S.S., Keum Y.-S., Park K.-K., Lee S.S. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: Down-regulation of COX-2 and iNOS through suppression of NF-κB activation. Mutat. Res. Fundam. Mol. Mech. Mutagen. 2001;480:243–268. doi: 10.1016/S0027-5107(01)00183-X. [DOI] [PubMed] [Google Scholar]
- 29.Lowes M.A., Bowcock A.M., Krueger J.G. Pathogenesis and therapy of psoriasis. Nature. 2007;445:866. doi: 10.1038/nature05663. [DOI] [PubMed] [Google Scholar]
- 30.Guttman-Yassky E., Krueger J. Psoriasis: Evolution of pathogenic concepts and new therapies through phases of translational research. Br. J. Dermatol. 2007;157:1103–1115. doi: 10.1111/j.1365-2133.2007.08135.x. [DOI] [PubMed] [Google Scholar]
- 31.Nograles K.E., Davidovici B., Krueger J.G. New insights in the immunologic basis of psoriasis. Semin. Cutan. Med. Surg. 2010;27:3. doi: 10.1016/j.sder.2010.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Johnson G.L., Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 2002;298:1911–1912. doi: 10.1126/science.1072682. [DOI] [PubMed] [Google Scholar]
- 33.Schulze-Osthoff K., Bauer M.K., Vogt M., Wesselborg S. Oxidative stress and signal transduction. Int. J. Vitam. Nutr. Res. 1997;67:336–342. [PubMed] [Google Scholar]
- 34.Thalhamer T., McGrath M., Harnett M. MAPKs and their relevance to arthritis and inflammation. Rheumatology. 2008;47:409–414. doi: 10.1093/rheumatology/kem297. [DOI] [PubMed] [Google Scholar]
- 35.Su Y.-W., Chiou W.-F., Chao S.-H., Lee M.-H., Chen C.-C., Tsai Y.-C. Ligustilide prevents LPS-induced iNOS expression in RAW 264.7 macrophages by preventing ROS production and down-regulating the MAPK, NF-κB and AP-1 signaling pathways. Int. Immunopharmacol. 2011;11:1166–1172. doi: 10.1016/j.intimp.2011.03.014. [DOI] [PubMed] [Google Scholar]
- 36.Han E.H., Hwang Y.P., Choi J.H., Yang J.H., Seo J.K., Chung Y.C., Jeong H.G. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation. Environ. Toxicol. Pharmacol. 2011;32:136–145. doi: 10.1016/j.etap.2011.04.004. [DOI] [PubMed] [Google Scholar]
- 37.Ju S.M., Song H.Y., Lee S.J., Seo W.Y., Sin D.H., Goh A.R., Kang Y.-H., Kang I.-J., Won M.-H., Yi J.-S. Suppression of thymus-and activation-regulated chemokine (TARC/CCL17) production by 1, 2, 3, 4, 6-penta-O-galloyl-β-d-glucose via blockade of NF-κB and STAT1 activation in the HaCaT cells. Biochem. Biophys. Res. Commun. 2009;387:115–120. doi: 10.1016/j.bbrc.2009.06.137. [DOI] [PubMed] [Google Scholar]
- 38.Komine M., Kakinuma T., Kagami S., Hanakawa Y., Hashimoto K., Tamaki K. Mechanism of thymus-and activation-regulated chemokine (TARC)/CCL17 production and its modulation by roxithromycin. J. Investig. Dermatol. 2005;125:491–498. doi: 10.1111/j.0022-202X.2005.23840.x. [DOI] [PubMed] [Google Scholar]
- 39.Han S., Baek H., Bae K., Lee K., Yeo J., Kweon H., Woo S., Lee I., Lee M., Lee M. Studies on the Antimicorbial Effect of Collected Bee Venom Using Electric Shock Method (Ⅰ) Korean J. Apic. 2005;20:53–58. [Google Scholar]
- 40.Lantz R.C., Chen G., Solyom A., Jolad S., Timmermann B. The effect of turmeric extracts on inflammatory mediator production. Phytomedicine. 2005;12:445–452. doi: 10.1016/j.phymed.2003.12.011. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.